an f graph as a quotient space of the universal tree
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity were analyzed The intra-assay and interassay variabilities (coefficient ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and...
- 11
- 593
- 0
Realizing an AD+ model as a derived model of a premouse
... if there is a set of ordinals S, an ordinal and a formula such that x ✓ A $ L↵ [S, x] = [S, x] If is an ordinal and A ✓ ! , then A is determined if either of the two players has a winning strategy ... initial segment of the last model of T (P)} by rearranging stacks The technique of rearranging stacks enables us to define the S P -operator in Sections 2.5 and 2.6 in the measurable cofinality case ... ✓↵+1 case, using the translation procedure and a reflection argument Chapter handles the ADR case The S-operators defined in Section and the translation defined in Section applies to the ADR case...
- 164
- 281
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... oligonucleotides for RevNES (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange ... 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection with a specific siRNA was performed...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... performed as by Li et al [11] Five micrograms of reporter plasmid DNA containing the CAT gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase ... The authors thank O Wrange for recombinant human NF1 and N Tanese for the generous gift of antihuman NF1-C serum References Fig Site-2 and Site-3 elements act in a concerted manner to cause the ... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT...
- 8
- 426
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade ... diffuse staining with an occasional patchy appearance and both types of labeling partially colocalized in these patches, suggesting the presence of aggregates (Fig 5A) In addition, the localization ... (Santa Cruz, CA, USA); anti-MEK2 (ab32517), anti-MEK1 (ab32091), anti-Raf1 (ab18761), anticalreticulin (ab2907), anti-GM130 (ab52649), anti-RSK1 p90 (ab32114), anti-N-cadherin (ab18203) and anti-GAPDH...
- 11
- 419
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... an immediate consequence of the fact that the mapping F is an α-contraction Corollary 3.2 ET is equivalent to BCP∗ , the restriction of the BCP to the class of nonArchimedean bounded metric spaces ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem...
- 6
- 268
- 0
Báo cáo y học: " Arterial embolization of an extrapleural hematoma from a dislocated fracture of the lumbar spine: a case report" potx
... was because of an EH and not because of the hemothorax An angiography was immediately performed to restore hemostasis; a shepherd-hook catheter (4 F, CX catheter A2 ; Koken, Tokyo, Japan) and a ... consent for the publication of this case report and any accompanying images was obtained from Page of (page number not for citation purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency ... nomenclature, classification, and significance of traumatic EHs in 2000 [1], most authors refer to such hematomas as "extrapleural hematomas." EH can be defined as the accumulation of blood in the extrapleural...
- 5
- 199
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... ‘chemotherapy and radiotherapy’ are indicated in the branch of the ‘fishbone’ that shows the cause of ovarian failure, a potential cause for secondary amenorrhea/oligomenorrhea (Figure 1) The cited references ... Reports has published the case of a 22-year-old lactating woman who presented with four months of amenorrhea associated with signs of virilization The patient was diagnosed as having an androgen ... references for the relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for...
- 3
- 381
- 0
Biological properties and the nutrition value of an Isochrysis strain as a live food for geo-duck larvae
... galbana The suitable medium for strain was f/ 2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA ... [12] DHA and EPA play an important role in the membrane lipids 3.4 Application of Isochrysis galbana H5 for feeding geo-duck at Vandon, Quangninh Isochrysis galbana H5 was cultured in F/ 2 medium, ... nutritional effects of algae in marine fish larvae Aquaculture, Vol 155, (1997), pp 207-221 M shirai, Katsumi Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989),...
- 5
- 404
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of ... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... Sickness absence can be viewed as an integrated measure of physical, psychosocial, and social function and wellbeing [5-7] As such, sickness absence levels can reflect an increased risk of developing...
- 6
- 578
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... infects mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza ... between fowls, pigs and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human ... on the transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the...
- 4
- 520
- 0
Exposing an Existing Application As a Portlet
... we obtain an object that we can use to retrieve information from the forum software about the forums and the messages they contain:
- 32
- 289
- 0
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia Lioness (Noun): a female lion 15 g/ The suffix “-y” / “-ie” These suffixes ... are the forms which cannot stand by themselves but as part of words b/ Affixational morphemes Affixational morphemes are further divided into inflectional grammatical morpheme and derivational ... of plants and animals) “GRAM” – (It means “written”): telegram (a message sent by telegraph and then printed and given to somebody), grammar (the rules in a language for changing the form of...
- 63
- 988
- 3
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... of Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the ... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... England, the Bank of Canada, and Norges Bank The remaining central banks— the Reserve Bank of Australia, the Reserve Bank of New Zealand, and the Riksbank—appear to be operating more conventional...
- 49
- 653
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... ald gene as follows A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) ... analysis of the las operon B Koebmann et al Fig Modulation of PFK activity and the effects on growth and fluxes (A) Library of strains with modulated PFK activities The PFK activities were measured ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢)...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: "Using an Annotated Corpus as a Stochastic Grammar" ppt
... ,derivation, does not accommodate all statistical properties of a language corpus Instead, we will defme the probability of a parse as the sum of the probabilities of all its derivations Finally, the ... of the parses of the strings a and ab The parse of siring a can be generated by exactly one derivation: by applying subtree t3 The probability of this parse is hence equal to 1/3 The parse of ... -o ab may not be added Our problem is now whether we can assign probabilities to these rules such that the probability of the parse of a equals 1/3, and the probability of the parse of ab equals...
- 8
- 393
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... cesareans per yr *1.5 ) / 365 (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per ... allocated for the provision of obstetric anesthesia services The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants of obstetric anesthesia...
- 14
- 610
- 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
... CONCLUSION 14 Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF and is associated with very ... consolidation was experimentally induced by intratracheal injection of acid-fast organisms into rabbits8 and the importance of a hypersensitivity reaction associated with tuberculoprotein was confirmed ... with a bacterial pneumonia of equal extent with less pleuritic pain, toxemia, and dyspnea It is difficult to differentiate radiologically between TBP and severe bacterial pneumonia as causes of ARF,...
- 7
- 352
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization ... investigation What is the biological function of nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of ... analysis, and the percentage of CD95 downregulation was calculated for the GFP+ and GFP) populations (B) Apoptosis in GFP+ (red) cells was assessed by annexin V staining and FACS analysis Nonstimulated...
- 10
- 483
- 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf
... needed for basal synaptic transmission and maintenance of LTD in the hippocampus, whereas other members of the NF-jB family might be responsible for the induction of LTD and the late phase of long-term ... intracellular pathways activate NF-jB, namely the ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB ... NF-jB [7] The canonical pathway of NF-jB 28 activation passes through the activation of an IjB kinase (IKK) complex, composed of two catalytic subunits (IKK1 ⁄ a and IKK2 ⁄ b) and a regulatory subunit...
- 9
- 527
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008