a tan bkh some observations on tumor growth in estradiol primed oophorectomized nude mice berries in cancer prevention from experimental findings to humans lahti finland 10 11 july 2004
Regulation and functional analysis of the tumor suppressor gene product, p53
... Tyrosinase-Forward: 5’- TAAGAACCTGATGGAGAAGGAATGCTGTCCA -3’ Tyrosinase-Reverse: 5’- TCGGCTACAGACAATCTGCCAAGAGGAGAAG -3’ Hdm2- Forward: 5’- ATGTGCAATACCAACATGTCTGTACCT -3’ Hdm2- Reverse: 5’- AGGGGAAATAAGTTAGCACAATCATTTGA ... phosphorylation domains are the N and the C terminus The N-terminal part (aa1 to aa91) contains the transcription-regulatory domain of p53, while the C-terminal domain (aa300 to aa393) controls ... that the basic domain is a regulatory domain (aa363aa393) This regulatory domain may have a role in DNA damage recognition (Lee et al., 1995; Reed et al., 1995) and it can regulate the DNA binding...
- 183
- 589
- 0
Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx
... determined after days Statistical methods Data was analyzed in the Prism software package (GraphPad Software, Inc) An unpaired two-tailed t-test was used to analyze in vitro neutralization assays while ... to a bivalent analyte binding model, using BiaEvaluation 4.1 software (Biacore, Inc.), as no mass transfer effects were obvious in control experiments A steady-state binding constant (KD1) was ... it has the potential to be weaponized and used as an incapacitating or lethal agent, the National Institute of Allergy and Infectious Diseases (NIAID) and the Centers for Disease Control and Prevention...
- 9
- 392
- 0
GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS
... islands and Australia All strains from the Americas, West Africa and limited number from Asia Asian Genotype from Malaysia and Thailand, Asian Genotype from Vietnam, China, Taiwan, Sri Lanka and ... isolates from South Pacific islands Thailand, Vietnam and Bangladesh Sri Lanka, India, Africa, Samoa and 1962 strain from Thailand Puerto Rico, Latin and central America and 1965 strain from Tahiti ... Philippines Australia, East and West Africa, the Pacific and Indian ocean islands, Indian subcontinent and the Middle East Latin America, the Caribbean, Indian subcontinent and Pacific Islands Thailand...
- 201
- 643
- 0
Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka
... functional domains, including an N-terminal domain, a coiledcoil domain, a DNA binding domain (DBD), a linker domain, an Src-homology (SH2) domain and a C-terminal transactivation domain (TAD) (Darnell, ... responses to environmental changes Signal transducers and activators of transcription proteins (STATs) are a family of latent cytoplasmic transcription factors that are activated in response to ... Phosphatidyl Inositol (PI3) kinase and Ras/Raf/ERK pathway, and some of these pathways are known to engage in crosstalk with each other (Okita and Yamanaka, 2006) The signaling pathways and potential...
- 170
- 340
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA ... CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG ... dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG...
- 20
- 689
- 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx
... Hepes was incubated with or without organic selenium compound for at 37 °C in 35 mm glass-bottomed dishes (Matsunami, Osaka, Japan) After incubation, PMA was added to a final concentration of 100 ... as an imbalance between cellular production of ROS and antioxidant defense mechanisms [1] It is a key component of in ammation and in ammatory disorders The processes associated with in ammatory ... applicable as an anti -in ammatory drug for the treatment of various in ammatory diseases [24–28] It is possible that other organic selenium compounds may also become candidates as anti -in ammatory ⁄ antioxidative...
- 9
- 331
- 0
Báo cáo Y học: Purification and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures ppt
... (http://www.arabidopsis.org/cgi-bin/ patmatch/nph-patmatch.pl) Fig PAGE analyses of purified SAP1 and SAP2 (A) Non-denaturing PAGE on a 10% (w/v) separating gel of AP from the media of tomato suspension ... coefficient) against log Mr using the following protein standards: catalase (232 kDa), aldolase (158 kDa), alcohol dehydrogenase (150 kDa), BSA (67 kDa), ovalalbumin (43 kDa), carbonic anhydrase (29 kDa), ... the protein standard Peroxidase assay A chemiluminescence assay was employed to determine the capacity of the purified tomato APs to catalyze the peroxidation of 5-aminophthalhydrazide (luminol)...
- 9
- 534
- 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot
... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢-T ... Pallesen et al (Eur J Biochem 269) mass ranging from 95 to over 100 kDa in polyacrylamide gels Antibody staining of sections from bovine prelactating and lactating mammary gland using monoclonal ... leukocytea Prostatea Small intestinea Spleena Testisa Thymusa Bone marrowa Fetal livera Lymph nodea Tonsila Breastb Lungb Milk cellsa Bovine Mammary glandc Mammary glandc Lungc Lymph nodec a Template...
- 9
- 614
- 0
Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc
... and contains two in- frame initiation codons (84 nt in distance, Lab/Lb), that cleaves itself from the viral polyprotein [22] acting as a trans-proteinase and initiation factor eIF4G at G479/R480 ... region, is associated with the porcinophilic properties that caused a catastrophic outbreak of FMD in Taiwan [12-14] The O/AS/SKR/2002 strain, a member of the PanAsia lineages, contains an intact ... occurred in the countries and districts of East Asia (EA) and the Far East [11] The O/ YUN/TAW/97 strain, a member of the Cathay topotype, containing the deletion of codons 93 to 102 in 3A coding...
- 11
- 383
- 0
Báo cáo y học: "Physiological properties of astroglial cell lines derived from mice with high (SAMP8) and low (SAMR1, ICR) levels of endogenous retrovirus" ppsx
... 5-GGCAGGTCTACTTTGGAGTCATTGC-3 5-ACATTCGAGGCTCCAGTGAATTC-3 5-TGGCTGGGAACAGGGGAAGGTTGAC-3 5-GTGCTTTCTTCTAGAACCCCTTGG-3 5-CTCTAGAGCACCATGCTACAGAC-3 5-TGGAATCCAGGGGAAACACTG-3 5-TTGACGGACCCCAAAAGATG-3 5-AGAAGGTGCTCATGTAATCA-3 ... http://www.retrovirology.com/content/5/1 /104 GCTACTGCTGACTCT-3'; antisense: 5'-GCATGACTCAAAAAACTTAGCAATTCTG-3'; Akv, sense: 5'ATGGAGAGTACAACGCT CTCA-3'; antisense: 5'-GAGGTTAGATTGTTGCTTACTG-3' As a cellular marker GAPDH ... Immunofluorescence analysis of CAgag in ICR -A, R 1A and P 8A cell lines Expression of CAgag in R 1A, P 8A and ICR -A cell lines was analyzed using anti-GFAP (green) and anti-CAgag (red) antibodies DAPI staining...
- 18
- 260
- 0
Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx
... Tm AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC GATATCGCCGCGCTCGTCGTC GGCTGGGGTGTTGAAGGTCTC TGTGCTGTGAAATCCCTGAATAGAATC CCAAGAGTGAGAGTACGTTTGGATGAC AGATGTTAGTGACAATGAACCT GTGATTTGTGTGTGCTGATC CGGAGGGACGCCAAACAGG ... CGGAGGGACGCCAAACAGG GTCCCGGGTCAACTCTTCGTG TGGAGAGCGTCAACCGGGAGATGT AGGTGTGCAGATGCCGGTTCAGGT ATGGGTAGGGCAAATCAGTAAGAGGT AAGCATCGTATCACAGCAGGTTAC CCGCCTTGGTGGTGGTCTCC AGGGCGCTGGGCTTCTCGT ACACCAGCCTGCGCCTCAAGACCT ... TATTCTCTTCTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TATTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TCTTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCTACTTATGTGAACGTA * ****** **********************************...
- 10
- 336
- 0
Báo cáo sinh học: " Establishment of stable Huh-7 cell lines expressing various hepatitis C virus genotype 3a protein: an in-vitro testing system for novel anti-HCV drugs" potx
... Clin Gastroenterol 2000, 14: 211- 228 Kato T, Furusaka A, Miyamoto M, Date T, Yasui K, Hiramoto J, Nagayama K, Tanaka T, Wakita T: Sequence analysis of hepatitis C virus isolated from a fulminant ... washed times with PBS-T A secondary antibody, rabbit anti-mouse IgG, conjugated to alkaline phosphatase (Sigma), was added at a dilution of 1 /100 0 in PBS-T, incubated at room temperature for one ... down-regulation of cyclin A expression [24] Nonstructural protein 4A (NS 4A) is a multifunctional protein with 54 amino acid residues It acts as a cofactor of NS3 serine protease and plays an essential...
- 6
- 321
- 0
Characterization of MP2 cell division and pins function on spindle asymmetry of drosophila central nervous system
... was shown that N-terminal regions of Mira can physically interact with the apical protein Insc in vitro, which indicates that Mira might act as a multidomain adaptor linking apical protein Insc ... function of Baz as these localizations are abolished in baz mutants Like PAR-3 in C elegans, Baz localization also requires DaPKC function In DaPKC mutants, Baz no longer localizes asymmetrically to ... contains an intact apical complex consisting of Inscuteable, Bazooka and Pins Only Baz (primarily) and Pins (to a small extent) are required to ensure the selective partitioning of Numb to one...
- 187
- 300
- 0
Development and characterization of a SARS coronavirus replicon cell line
... SARSCoV transmission were occurred in Singapore, Taiwan and China Although subsequent investigation showed inappropriate laboratory standards and no secondary transmission arose from these cases, ... stimulated macrophages in the alveoli have a prominent role in the pathogenesis of SARS leading to cytokine dysregulation This idea has applications for the management of coronaviral pneumonia, as interventions ... Kong examined 25 animals belonging to seven wild and one domestic animal species in a live animal market in southern China that supplies restaurants in Guangdong province Some of these animals...
- 103
- 347
- 0
Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma
... the largest among cadherins Apart from this, it contains five epidermal growth factor (EGF) repeats followed by two lamin A- G binding domain, a putative transmembrane region and an intracellular ... ear According to Strutt (2005) the genes in this pathway can be phenotypically classified as: a) Upstream factors, including non-classical atypical cadherins like Fat, Daschous and Flamingo, are ... EXPRESSION AND CHARACTERIZATION OF FAT1AND ATROPHIN PROTEINS REGULATING PLANAR CELL POLARITY AND MBD1 PROTEIN INVOLVED IN LYMPHOMA ANUPAMA VAASUDEVAN (B.E.) A THESIS SUBMITTED FOR THE DEGREE OF MASTER...
- 92
- 1,330
- 0
Isolation and characterization of an extracellular polymer closely related to flocculation of activated sludge
... pollution From this viewpoint, biodegradable and nonhazardous flocculating agents obtained from natural sources are needed Takagi and Kadowaki (198 5a, b) obtained a flocculant that aggregated several ... solution was not added, in the acidic region both kaolin clay and activated charcoal flocculated satisfactorily (the flocculation values at pH 2.5 of kaolin clay and activated charcoal were 79.6% and ... Chemicals Bio-Gel P -100 was the product of Bio Rad Laboratories Blue Dextran was the product of Pharmacia Fine Chemicals Pronase was obtained from E Merck, Dramstadt ECNSS-M was obtained from Gas-Chro...
- 12
- 510
- 1
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells
... Zhihui Zhang: a post graduate majoring in environmental engineering in Yanshan University situated in Qinhuangdao, China Wastewater treatment is his current study field E-mail address: jeasonhui@163.com ... bath at 313 K for h The PVDF-based composite membrane was prepared by a phase inversion process, and deionized water used as the non-solvent The cast solution was cast onto a clean glass plate, ... using a combination technique of thermally induced polymerization and phase inversion, and all of the other reagents were analytical grade 2.2 Preparation of the PVDF-based composite membrane The...
- 14
- 596
- 1
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 101 1 101 5 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... low carbon TATA A grade steel The jacket was fabricated in five parts consisting of two side plates and three cylindrical shapes, of diameter equal to the Figure The optimized axial flux along ... nitrogen, argon, and hydrogen gases The plasma was characterized using a Langmuir probe (Jain et al 2006) A total ion beam current of 2·5 mA was extracted, with two-electrode extraction geometry, at 15...
- 8
- 650
- 0
Tài liệu Báo cáo "Preparation and characterization of nanocomposite TiO2/SnO2 films " pdf
... self-doping semiconductor Due to the stoichiometric deviation, some Sn atoms were formed and played a role of the dopant These dopant atoms at high temperature and for a long time annealing experienced ... RD/RL was considered as a photoconductivity of obtained materials The results of measurements show that all values RL, RD, and RD/RL strongly depend on the temperature and time of annealing as presented ... Proceedings of the 9th APPC, Hanoi (2004) 348 Wen-Deng Wang, Fu-Qiang Huang, Cun-Ming Liu, Xin-Ping Lin, Jian-Lin Shi, Preparation, electronic structure and photocatalytic activity of the In2 TiO5,...
- 5
- 614
- 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... 5¢-GAG GAGAAGCCCGGTCTATAACTCATCTTTGAGTAC-3¢ for GmPDIL- 3a, and 5¢-GACGACGACAAGATGGAGG TTGAGGATGAGTTGG-3¢ and 5¢-GAGGAGAAGCCCG GTTCATAACTCATCTTTGACGAC-3¢ for GmPDIL-3b Amplified DNA fragments were ... S, Wadahama H, Iwasaki K, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones ... motifs within the a- domain and a -domain Instead, they both contain the sequence CPRS in the 4132 a- domain and CMNC or CINC in the a -domain GmPDIL- 3a and GmPDIL-3b contain a C-terminal KDEL sequence...
- 12
- 622
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008