Development and characterization of a SARS coronavirus replicon cell line

DEVELOPMENT AND CHARACTERIZATION OF A SARS-CORONAVIRUS REPLICON CELL LINE GE FENG A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2005 ACKNOWLEDGEMENTS I would like to express my sincere gratitude to my supervisor Dr. Hung Siu Chun for his supervision, guidance and stimulating discussions throughout the course of this study. I would like to thank Professor Zhang Xian-en for his continuous encouragement and support in these years. I would like to thank Mr. Li Bojun, Mdm. Nalini Srinivasan, Mdm. Soo Mei Yun for their excellent technical help. I would like to show my appreciation to all my friends (Xia Minzhong, Luo Yonghua, Yang Dongyue, Du Yanan, Pang Shyue Wei, Yu Hongxiang, Lee Yi Chuan, Toy Wei Yi, Wang Bei, Soo Chengli, and Leong Wing Hoe) who had provided me with constant encouragement and help. Last but not the least; I would like to thank my beloved family members (Father Ge Zongyu, Mother Yang Guirong, Brother Ge Hongzhong) for their continuous encouragement and support throughout this course. TABLE OF CONTENTS ACKNOWLEDGEMENTS i TABLE OF CONTENTS ii SUMMARY v LIST OF TABLES vi LIST OF FIGURES vii ABBREVIATIONS viii 1. INTRODUCTION & LITERATURE REVIEW 1 1.1 Introduction 2 1.2 Classification of SARS-CoV 3 1.3 Structure of SARS-CoV 4 1.4 Molecular biology of SARS-CoV 7 1.4.1 Genome organization 7 1.4.2 Viral RNA Synthesis & Translation 9 1.4.3 ORFs 1a and 1b 10 1.4.4 Structural proteins (S, E, M and N) 13 1.5 Life cycle of coronavirus 17 1.6 Transmission of SARS-CoV 18 1.7 Epidemiology of SARS 20 1.8 Diagnosis of SARS 21 1.9 Pathogenesis of SARS-CoV 23 1.10 Antiviral treatment 23 1.11 Viral Replicon, anti-viral drug screening and the aim of this project 24 2. MATERIALS & METHODS 2.1 Design of SARS-CoV replicon 26 27 ii 2.2 Construction of SARS-CoV replicon 27 2.2.1 RT-PCR gene 1 and nucleocapsid (N) gene of SARS-CoV 27 2.2.2 Synthesis of SARS-CoV first-strand cDNA by reverse transcription 31 2.2.3 Synthesis of A DNA 32 2.2.4 Synthesis of B, C and N, and GFP-BlaR gene DNAs 33 2.2.5 Assembly and amplification of BCGbN DNA 34 2.2.6 Assembly of ABCGbN DNA 36 2.2.7 Synthesis of SARS-CoV replicon RNA 37 2.3 Development of SARS-CoV replicon-carrying cell lines 38 2.3.1 Maintenance of BHK-21 Cell Line 38 2.3.2 Transfection of BHK-21 cells with SARS-CoV replicon RNA 38 2.3.3 Selection for and continuous culturing of SARS-CoV replicon-carrying cells 39 2.4 Analysis of SARS-CoV replicon-carrying BHK-21 cell line 2.4.1 Detection of GFP-BlaR protein 40 40 2.4.1.1 Fluorescence microscopy 41 2.4.1.2 Flow cytometry 41 2.4.2 Detection of SARS-CoV replicon and sub-replicon RNAs by Northern blot analysis 41 2.4.2.1 Probe preparation 42 2.4.2.2 Preparation of RNA 43 2.4.2.3 Electrophoresis and capillary-transfer of RNA 43 2.4.2.4 Probe hybridization and signal generation 44 2.4.3 Analysis of SARS-CoV sub-replicon RNAs by RT-PCR 46 2.4.4 Detection of GFP-BlaR gene in total cell DNA 47 2.4.4.1 Extraction of total cell DNA 47 2.4.4.2 PCRs for the detection of GFP-BlaR and GAPDH genes 47 iii 2.4.5 Sequencing of SARS-CoV replicon and sub-replicon RNAs 3. RESULTS 48 50 3.1 Generation of SARS-CoV replicon RNA 51 3.2 Generation and analysis of SARS-CoV replicon-carrying cells 55 4. DISCUSSION 68 REFERENCES 78 APPENDICES 90 Appendix 1 Primer Names & Sequences 90 Appendix 2 Reagents for Northern Blotting 91 iv SUMMARY The goal of this thesis project was to construct a cell line carrying a SARS coronavirus (SARS-CoV) replicon, which is incapable of producing viral particles. First, partial SARS-CoV cDNAs and antibiotic resistance/reporter gene DNA were generated and assembled in vitro to produce the replicon transcription template, which was then transcribed in vitro to generate the replicon RNA. The latter was introduced into a mammalian cell line and the transfected cells were selected for by antibiotic application. For the antibiotic-resistant cell lines thus generated, the expression of reporter gene was monitored repeatedly using fluorescent microscopy and flow cytometry. Replicon and sub-replicon RNAs were detected by northern blot analysis, RT-PCR and DNA sequencing. The results of these analyses showed that the SARS-CoV replicon RNA replicated and persisted in the cells for at least six weeks. The replicon cell lines thus developed could be useful for anti-SARS drug screening. v LIST OF TABLES Table 1. World Health Organization case definitions of SARS patients. Table 2. Thermal cycling program optimized for the amplification of SARS-CoV cDNA fragment A. Table 3. Thermal cycling program optimized for the amplification of BCGbN DNA Table 4. SARS-CoV Replicon sequencing strategy vi LIST OF FIGURES Figure 1. Electron micrographs of SARS-CoV Particles Propagated in Vero E6 Cells. Figure 2. Typical Structure of Coronavirus Virion. Figure 3. SARS-CoV genome organization and expression. Figure 4. Overview of the domain organization and proteolytic processing of SARSCoV replicase polyproteins, pp1a (486 kDa) and pp1ab (790 kDa). Figure 5. The life cycle of Coronavirus. Figure 6. SARS-CoV replicon and the strategy for its construction. Figure 7. Generation of sub-replicon RNAs through discontinuous transcription of SARS-CoV replicon RNA in the replicon-carrying cells. Figure 8. The capillary transfer apparatus. Figure 9. Generation of SARS-CoV replicon transcription template DNA. Figure 10. Generation of SARS-CoV replicon RNA. Figure 11. Green fluorescence from BHK-21 cells transfected by SARS-CoV replicon RNA. Figure 12. Confirmation of sub-genomic gene expression from SCR replicon cell line. Figure 13. Presence of SARS-CoV replicon and sub-replicon RNAs in replicon-carrying cells at detected by northern blot analysis. Figure 14. Amplification of sub-replicon RNA regions encompassing leader-body joints by RT-PCRs. Figure 15. Sequences of leader-body joints in SARS-CoV sub-replicon RNAs. Figure 16. Green fluorescence levels of SARS-CoV replicon-carrying cells at different culture times as detected by flow cytometry. vii ABBREVIATIONS ATCC BCoV BHK bp BSA cDNA 3CLpro CO2 CoV CS Da DMEM DNA DNase dNTP DTT E EtBr EDTA ExoN FCS GAPDH GFP HCl IBV kb kDa LiCl M M MHV mM MOPS mRNA MW N NaAC ng nmol ns nsp nt ORF PBS American Type Culture Collection Bovine coronavirus Baby Hamster Kidney Base pair Bovine Serum Albumin Complementary DNA Chymotrypsin- like protease Carbon Dioxide Coronavirus Core sequence Dalton(s), the unit of molecular mass Dulbecco’s minimal essential medium Deoxyribonucleic Acid Deoxyribonuclease 2’-deoxyribonucleoside-5’-triphosphate Dithiothreitol Envelope Ethiduim bromide Ethylene diaminetetraacetic acid 3’-to-5’ exonuclease Fatal calf serum Glyceraldehyde-3-phosphate dehydrogenase Green Fluorescence Protein Hydrochloric acid Infectious bronchitis virus Kilo base pair Kilodalton Lithium chloride Molar Membrane Mouse hepatitis virus Millimolar 3-(N-Morpholino) Propane Sulfonic Acid Message RNA Molecular weight Nucleocapsid Sodium Acetate Nanogram Nanomolar Nonstructural Nonstructural protein Nucleotide Open reading frame Phosphate buffered saline viii PCR Poly (A) RdRp RER RNA RNase RT RT-PCR S SARS SARS-CoV SDS SWV TBE TGEV Tris TRS µg µl µM v/v w/v VLP WHO Polymerase chain reaction Polyadenylic acid RNA dependant RNA polymerase Rough endoplasmic reticulum Ribonucleic acid Ribonuclease Reverse transcription Reverse-transcription PCR Spike Severe acute respiratory syndrome SARS-associated coronavirus Sodium dodecylsulfate Smooth-walled vesicles Tris-borate/EDTA Transmittable gastroenteritis virus N-tris (hydroxymethyl) aminomethane Transcription-regulating sequences Microgram Microlitre Micromolar Volume per unit volume Weight per unit volume Virus-like particles World health organization ix CHAPTER 1 INTRODUCTION & LITERATURE REVIEW 1.1 Introduction Severe acute respiratory syndrome (SARS) is a potentially fatal atypical pneumonia that arose in Guangdong Province of the People’s Republic of China in November 2002 and spread to 26 countries on five continents, causing large scale outbreaks in Hong Kong, Singapore and Toronto in early 2003 (Peiris et al., 2003b). SARS was recognized in late 2002, and by the end of the outbreak in July 2003 more than 8000 cases and 774 deaths were attributed to SARS worldwide (Kuiken et al., 2003). This outbreak has had a profound impact on public health and economies worldwide and reminded the danger of emerging infectious diseases in densely populated societies. The etiologic agent of SARS was identified as a novel coronavirus (SARS-CoV) (Peiris et al., 2003a; Drosten et al., 2003; Ksiazek et al., 2003; Poutanen et al., 2003; Rota et al., 2003; Marra et al., 2003). The genome sequence of SARS-CoV does not resemble more closely any of the three recognized groups of coronaviruses. Soon after the disease was recognized, the ability to experimentally infect and induce interstitial pneumonitis in Cynomolgus macaques with SARS-CoV was demonstrated, thus fulfilling Koch’s postulates and confirming that SARS-CoV was the causative agent of SARS (Fouchier et al., 2003; Kuiken et al., 2003) The origin of the SARS-CoV has been the subject of intense speculation despite closely related coronaviruses that were recovered from civet cats and other animals in Guangdong Province, suggesting the SARS-CoV could have originated from such animals and implicating SARS as a zoonosis disease (Guan et al., 2003). Most likely, this newly recognized pathogen has crossed the species barrier from small animals, such as masked palm civets, to humans (Guan et al., 2003; Martina et al., 2003). Despite the 2002 /2003 SARS epidemic being eventually controlled by case isolation, there is still neither an effective treatment for SARS nor an efficacious vaccine to prevent infection (Peiris et al., 2003b). The significant morbidity and mortality, and potential for 2 reemergence, make it necessary to develop effective methods to treat and prevent the disease. One important aspect in the fight against SARS is to develop antiviral agents that can specifically inhibit the RNA synthesis of SARS-CoV. 1.2 Classification of SARS-CoV The severe acute respiratory syndrome (SARS) is due to an infection with a novel coronavirus which was first identified by researchers in Hong Kong, the United States, and Germany (Peiris et al., 2003a; Drosten et al., 2003; Ksiazek et al., 2003; Poutanen et al., 2003; Rota et al., 2003; Marra et al., 2003). The virus was then termed SARS-associated coronavirus and acronymized as SARS-CoV. Coronaviruses (order Nidovirales, family Coronaviridae, genus Coronavirus) are a group of viruses with large, enveloped and crown-like virions, and positive-sense singlestranded RNA genomes (Siddell et al., 1983). The genomes of coronaviruses range in length from 27 to 32 kb, the largest of any of the known RNA viruses. The virions measure between about 100 and 140 nanometers in diameter. Most but not all viral particles display the characteristic appearance of surface projections, giving rise to the virus family’s name (corona, Latin = crown). Coronaviruses share the characteristic 3’ co-terminal, nested-set structure of the sub-genomic RNAs, unique RNA synthesis strategy, genome organization, nucleotide sequence homology, and the properties of their structural proteins (Cavanagh et al., 1995). The coronaviruses are classified into three groups based on genetic and serological relationships. Group 1 contains the porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), canine coronavirus (CCoV), feline infectious peritonitis virus (FIPV), human coronavirus 229E (HCoV-229E), and the recently identified human coronavirus NL63 (HCoV-NL63). Group 2 contains the murine hepatitis virus (MHV), bovine coronavirus (BCoV), human coronavirus OC43 (HCoV-OC43), rat sialodacryoadenitis virus (SDAV), porcine hemagglutinating encephalomyelitis virus (PHEV), canine respiratory 3 coronavirus (CRCoV), and equine coronavirus (ECoV). Group 3 contains the avian infectious bronchitis virus (IBV) and turkey coronavirus (TCoV). There are more than a dozen known coronaviruses affecting different animal species; while group I and II coronaviruses affect various mammals, those in group III infect birds. SARS-CoV seems to be the first coronavirus that causes severe disease in humans (Berger et al., 2004). The genome sequence reveals that SARS-CoV is only moderately related to other known coronaviruses, including two human coronaviruses, HCoV-OC43 and HCoV-229E. (Drosten et al., 2003; Peiris et al., 2003a; Marra et al., 2003; Rota et al., 2003). The SARSCoV appears to be neither a mutant of a known coronavirus nor a recombinant between known coronaviruses (Holmes et al., 2003a). Some proposed that SARS-CoV defines a fourth lineage of coronavirus (Group IV) (Marra et al., 2003) while others suggested that it may be an early split-off from the group 2 lineage (Snijder et al., 2003). The sequence analysis of SARS-CoV seems to be consistent with the hypothesis that it is an animal virus for which the normal host is still unknown and that has recently either developed the ability to infect humans or has been able to cross the species barrier (Ludwig et al., 2003). As the virus passes through human beings, SARS-CoV is apparently maintaining its consensus genotype and thus seems welladapted to the human host (Ruan et al., 2003). 1.3 Structure of SARS-CoV Electron micrographs of SARS-CoV particles propagated in Vero E6 cells are shown in Figure 1. The virions appear as spherical, enveloped particles with club shaped surface projections and diameters between 60 and 130 nm. A general structural model of coronavirus virions is shown in Figure 2. The virions are spherical enveloped particles about 100 to 120 nm in diameter. Inside the virion is a singlestranded, positive-sense genomic RNA 27 to 32 kb in size (Boursnell et al., 1987; Eleouet et al., 1995; Herold et al., 1993). The viral nucleocapsid phosphoprotein interacts with the positive 4 sense RNA genome and form a helical nucleocapsid (Macnaughton et al., 1978; Sturman et al., 1980). A corona of large, distinctive spikes in the envelope makes possible the identification of coronaviruses by electron microscopy. The virus core is enclosed by a lipoprotein envelope, which is formed during virus budding from intracellular membranes (Griffiths et al., 1992; Oshiro et al., 1971; Tooze et al., 1985). Two types of prominent spikes line the outside of the virion. The long spikes (20 nm), which consist of the spike glycoprotein, are present on all coronaviruses, the short spikes, which consist of the hemagglutinin-esterase glycoprotein, are present in only some coronaviruses. The envelope also contains the membrane glycoprotein, which spans the lipid bilayer three times (Machamer et al., 1993; Machamer et al., 1990; Machamer et al., 1987). The spike glycoprotein, bind to receptors on host cells and fuse the viral envelope with host cell membranes (Luo et al., 1998). 5 Figure 1. Electron micrographs of SARS- CoV Particles Propagated in Vero E6 Cells. (A) A thin-section view of viral nucleocapsids aligned along the membrane of the rough endoplasmic reticulum (arrow) as particles bud into the cisternae. Enveloped virions have surface projections (arrowhead) and an electron-lucent center. Directly under the viral envelope lies a characteristic ring formed by the helical nucleocapsid, often seen in cross section. (B) A stainpenetrated coronavirus particle with an internal helical nucleocapsid-like structure and club shaped surface projections surrounding the periphery of the particle. The bars represent 100 nm. (Source: Ksiazek et al., 2003) 6 Figure 2. Typical Structure of Coronavirus Virion. (Source: Drazen et al., 2003) 1.4 Molecular biology of SARS-CoV 1.4.1 Genome organization The SARS-CoV genome is 29727 nt in length (excluding the 30 poly-A tail). Some isolates may have a 5’-end deletion up to 16 nt. The genome organization is similar to that of other coronaviruses. Fourteen open reading frames have been identified (Figure 3) (Thiel et al., 2003a; Marra et al., 2003; Rota et al., 2003) and are believed to encode as many as 28 separate proteins. 7 Figure 3. SARS-CoV genome organization and expression. The putative functional ORFs in the genome of SARS-CoV are indicated. The black box represents the 72-nt leader RNA sequence, derived from the 5’ end of the genome, located at the 5’ end of each viral mRNA. The 14 ORFs are expressed from the genome mRNA (mRNA 1) and a nested set of subgenomic RNAs (mRNAs 2–9). (Source: Thiel et al., 2003a) The two large 5’-terminal ORFs, 1a and 1b, which extend over two-thirds of the viral genome, encode for two huge polyproteins which are processed into 16 mature non-structural proteins, including proteases, RNA-dependent RNA polymerase, helicase, additional proteins necessary for viral RNA synthesis and other proteins with unknown functions. The remaining twelve ORFs encode the four structural proteins – spike protein (S), small membrane protein (E), membrane protein (M) and nucleocapsid protein (N), and eight additional non-structural 8 proteins with unknown functions. These non-structural proteins are not likely to be essential in tissue culture but may provide a selective advantage in the infected host (Thiel et al., 2003a). 1.4.2 Viral RNA synthesis & translation Coronavirus RNA synthesis is carried out by the viral RNA-dependent RNA polymerase activity. Besides the full-length positive-sense genomic RNA, a nested set of positive-sense sub-genomic RNAs is also present in the infected cell (see Figure 3). Furthermore, for every positive-sense viral RNA, a complementary (negative-sense) RNA can also be found. As shown in Figure 3, each of the sub-genomic RNAs contains a short (50-100 nt) leader sequence from the 5’-end of the genome and a body sequence which is comprised of a characteristic length of sequence from the 3’-end of the genome (Thiel et al., 2003a). Early studies have clearly shown that the formation of sub-genomic RNAs is not done through the RNA splicing mechanisms commonly occurring in eukaryotes. Instead, various lines of evidence suggest that sub-genomic RNAs are generated by a unique polymerase “jumping” mechanism (reviewed in Lai & Holmes, 2001). This mechanism is dependent on cis-acting elements, known as ‘transcription-regulating signal’ (TRS), which include a stretch of a highly conserved core sequence(CS), 5’-ACGAAC-3’ for SARS-CoV or a highly related sequence for other coronaviruses. The TRS for each sub-genomic RNA encompasses genomic regions upstream of and at the 5’ end of the body sequence, although the exact boundaries of the TRS for any sub-genomic RNA have not been clearly defined. A TRS includes a CS of 6-7 nt, which is present at the 5’ end of the body sequence of each sub-genomic RNA as well as 3’end of the leader sequence. A TRS also includes a transcription attenuation signal which occurs upstream of the CS in the viral genome. The current most popular model of coronavirus sub-genomic RNA synthesis suggests that the polymerase switches template during the negative-sense RNA synthesis (Zuniga et al., 2004; Sawicki et al., 1998). Thus, after 9 synthesizing the sequence complementary to the CS in a TRS, the polymerase stalls as it encounters the attenuation signal. Then, through the base-pairing between the CS in the leader and the complementary CS in the nascent negative-sense RNA, and a series of protein–protein interactions in the transcription complex, the polymerase continues the negative-sense RNA synthesis using the leader RNA as the template (Zuniga et al., 2004). Thus, through continuous and discontinuous polymerization with the positive-sense genomic RNA as the template, all (genomic and various sub-genomic) negative sense-RNAs can be generated. The resulting negative-sense RNAs are in turn used as the templates to synthesize positive-sense genomic and sub-genomic RNAs. It is not known if the syntheses of genomic and sub-genomic, positive- and negative-sense RNAs use the same or different polymerase complexes. The presence in infected cells of all the sub-genomic RNAs as shown in Figure 3 has been confirmed experimentally (Thiel et al., 2003a). Coronavirus positive-sense genomic and sub-genomic RNAs are used as the templates for translation. On the genomic RNA, translation is initiated only at the 5’-most ORF 1a. ORF 1a encodes a polypeptide of 4382 amino acid residues and is designated as polyprotein 1a (pp1a). In 25% to 30% of ORF 1a translation, ribosomal frameshifting into the –1 reading frame occurs just upstream of the stop codon, extending the translation into ORF 1b and thus yielding the 7073-residue polyprotein 1ab (pp1ab). The signals mediating the frameshift include a ‘slippery’ sequence, UUUAAAC, and a downstream RNA pseudo-knot structure (Thiel et al., 2003a). The sub-genomic RNAs 2, 4, 5 and 6 are functionally monocistronic in that only the 5’-most ORF on each RNA is translated. Sub-genomic RNAs 3, 7, 8 and 9, on the other hand, are functionally bicistronic in that two 5’-most ORFs can be translated (Figure 3) (Thiel et al., 2003a; Snijder et al., 2003). 1.4.3 ORFs 1a and 1b 10 ORFs 1a and 1b encode two large polyproteins, pp1a (486 kDa) and pp1ab (790 kDa) (Thiel et al., 2003a). As described in Section 1.4.2, the expression of ORF 1b-encoded region of pp1ab involves ribosomal frameshifting into the −1 frame just upstream of the ORF 1a translation termination codon (Thiel et al., 2003a). The 5’-proximal region of ORF 1a of a typical coronavirus encodes two papain-like cysteine proteases, PL1pro and PL2pro. By contrast, SARS-CoV encodes only one papain-like protease. The activity of this protease has been demonstrated recently and it processes the Nproximal region of pp1a at three sites (Thiel et al., 2003a). ORF 1a of SARS-CoV, like those of other coronaviruses, also encodes a 3C-like proteinase (3CLpro), which plays a critical role in coronavirus polyprotein processing. It produces the key replicative enzymes of the virus, such as RdRp and helicase. Therefore, it is also called the coronavirus main protease, Mpro (Ziebuhr et al., 2000; 2004). The activity of SARS-CoV 3CLpro has also been experimentally demonstrated (Fan et al., 2004; Hegyi et al., 2002; Thiel et al., 2003a). It has a substrate specificity [(A,V,T,P)-X-(L,I,F,V,M)Q↓(S,A,G,N)] that is very similar to previously characterized coronavirus 3CLpros (Rota et al., 2003; Gao et al., 2003a; Snijder et al., 2003; Thiel et al., 2003a). It cleaves pp1ab at all the 11 predicted cleavage sites. The three-dimensional structure of 3CLpro was solved by both crystallography and NMR spectroscopy (Yang et al., 2003; Shi et al., 2004). Both studies reported that 3CLpro exists as a dimer and the conformational details of its interaction with substrates have been revealed, thus providing a basis for the anti-SARS drug design. As a result of the self-processing of pplab by the proteinase activities of PL2pro and 3CLpro, 16 mature non-structural proteins (nsp) are produced (Figure 4) (Thiel et al., 2003a; Ziebuhr et al., 2000; Anand et al., 2003). The 106-kDa SARS-CoV RdRp (nsp12) plays a pivotal role in viral RNA synthesis and is an attractive target for anti-SARS therapy. However, till now little is known about the structure and biochemical activity of any coronavirus RdRp. Recently, a structure model was 11 proposed for the catalytic domain of the SARS-CoV RdRp (Xu et al., 2003). The model gave a reasonable prediction about the active site of the protein and thus provided a useful platform for the rational design of effective inhibitors of this key enzyme. Figure 4. Overview of the domain organization and proteolytic processing of SARS-CoV replicase polyproteins, pp1a (486 kDa) and pp1ab (790 kDa). The processing end-products of pp1a are designated nonstructural proteins (nsp) 1 to nsp11 and those of pp1ab are designated nsp1 to nsp10 and nsp12 to nsp16. Cleavage sites that are predicted to be processed by the viral main protease, 3CLpro, are indicated by grey arrowheads, and sites that are processed by the papain-like protease, PL2pro, are indicated by black arrowheads. TM stands for transmembrane domain; C/H stands for domain containing conserved Cys and His residues. (Source: Ziebuhr et al., 2004) Another important protein for viral replication is the SARS-CoV helicase (nsp13 in Snijder et al., 2003, or nsp10 in Gao et al., 2003a, and Tanner et al., 2003). The SARS-CoV helicase is a multifunctional protein. Its functions include: (i) single-stranded and doublestranded RNA and DNA binding activities, (ii) nucleic acid-stimulated NTPase and dNTPase activities, (iii) RNA and DNA duplex unwinding activities, and (iv) RNA 5’-triphosphatase 12 activity, which is proposed to mediate the first step of 5’-cap synthesis on coronavirus RNAs (Tanner et al., 2003; Thiel et al., 2003a; Ivanov et al., 2004). SARS-CoV nsp9 can bind to RNA as well as another non-structural protein, nsp8 (Sutton et al., 2004), but the importance of these activities is still unknown. Its crystal structure has been solved (Campanacci et al., 2003). It is deduced that the SARS-CoV nsp9 may have a similar function as the nsp9 protein of mouse hepatitis virus, a Group 2 coronavirus, which colocalized and interacted with other proteins of the replication complex (Bost et al., 2000; Brockway et al., 2003). For the remaining non-structural proteins produced from pp1a or pp1ab, possible functions have been predicted based on their functional domains or by their structural similarities to other proteins (Gao et al., 2003a; Snijder et al., 2003; Von Grotthuss et al., 2003). As many as five novel coronaviral RNA processing activities were predicted recently (Snijder et al., 2003). These include a 3’-to-5’ exonuclease (ExoN), an uridylatespecific endoribonuclease (XendoU), a S-adenosylmethionine-dependent 2’-O-ribose methyltransferase (2’-O-MT), an ADP-ribose 1’’-phosphatase (ADRP), and a cyclic phosphodiesterase (CPD). Four of the activities are conserved in all coronaviruses, including SARS-CoV, suggesting their essential role in the coronaviral life cycle (Snijder et al., 2003). The fact that ExoN (nsp14), XendoU (nsp15) and 2’-O-MT (nsp16) are arranged in pp1ab as a single protein block downstream of the RdRp and helicase domains (Figure 4) suggests a cooperation of these activities in the same metabolic pathway (Snijder et al., 2003). The activities of the predicted coronavirus enzymes and their viral and/or cellular substrates still need to be revealed further. 1.4.4 Structural proteins (S, E, M and N) Coronavirus S protein is a type I membrane glycoprotein, which is translated on membrane-bound polysomes, inserted into rough endoplasmic reticulum (RER), cotranslationally glycosylated, and transported to the Golgi complex. During the transport, S 13 protein is incorporated onto maturing virus particles, which assemble and bud into a compartment that lies between the RER and Golgi (Lai & Holmes, 2001). The S protein, which is thought to function as a trimer (Delmas et al., 1990), is important for binding to cellular receptor and for mediating the fusion of viral and host membranes and thus is critical for virus entry into host cells (Collins et al., 1982; Godet et al., 1994; Kubo et al., 1993). S protein of SARS-CoV is 1255 amino acids long. It is predicted to have a 13 amino acid signal peptide at the amino-terminus, a single ectodomain (1182 amino acids) and a transmembrane region followed by a short cytoplasmic tail (28 residues) at the carboxy-terminus (Marra et al., 2003; Rota et al., 2003). Coronavirus S protein contains two regions with a 4, 3 hydrophobic (heptad) repeat (De Groot et al., 1987; Bosch et al., 2003). These domains (termed as HR1 and HR2) are thought to play an important role in defining the oligomeric structure of S and mediating the fusion between viral and cellular membranes (Eckert et al., 2001). For the SARS-CoV, HR2 is located close to the transmembrane anchor (1148–1193 amino acids) and HR1 is ~140 amino acids upstream of it (900–1005 amino acids) (Ingallinella et al., 2004). Biochemical studies have shown that peptides corresponding to the HR1 and HR2 of SARS- CoV S protein can associate into an anti-parallel six-helix bundles with structural features typical of class I fusion proteins. It is believed that SARS-CoV uses the same membrane fusion and cell entry mechanisms as other coronaviruses (Bosch et al., 2004; Ingallinella et al., 2004; Liu et al., 2004; Tripet et al., 2004; Yuan et al., 2004; Zhu et al., 2004). Based on previous studies, S protein is an important target of virus-neutralizing antibodies (Chang et al., 2002; Collins et al., 1982; Fleming et al., 1983; Godet et al., 1994; Kant et al., 1992; Kubo et al., 1993, 1994; Takase-Yoden et al., 1991). It is reported that mice immunized with a recombinant S-protein, or a peptide derived from it, are protected from murine hepatitis virus (Daniel et al., 1990; Koo et al., 1999). 14 For SARS-CoV, a DNA vaccine encoding the S protein alone induced T cell and neutralizing antibody responses and protected mice from SARS-CoV infection (Yang et al., 2004). It is quite possible that the S is the primary target for viral neutralization in SARS-CoV infection. This finding was also confirmed by several studies that use surrogate/carrier viruses to express S in mice or primates (Gao et al., 2003b; Bisht et al., 2004; Buchholz et al., 2004; Bukreyev et al., 2004). From these studies, it is clear that humoral response against S plays an important role in controlling and clearing SARS-CoV infection. SARS-CoV does not utilize any previously identified coronavirus receptors to infect cells and the cellular receptor for SARS-CoV has been identified to be angiotensin-converting enzyme 2 (ACE2) (Li et al., 2003a). Furthermore, syncytia formation/membrane fusion and viral replication can be specifically inhibited by an anti-ACE-2 antibody (Li et al., 2003a). But the molecular interactions between the S protein and ACE2 are not yet known. Coronavirus E and M proteins are important for viral assembly. E protein is a small, 9– 12 kDa integral membrane protein (Siddell, 1995). The amino-terminus consists of a short 7–9 amino acid hydrophilic region and a 21–29 amino acid hydrophobic region, followed by a hydrophilic carboxyl-terminal region (Shen et al., 2003). E protein also plays a part in viral morphogenesis. Co-expression of E and M proteins, from mouse hepatitis virus (MHV) (Bos et al., 1996; Vennema et al., 1996), transmittable gastroenteritis virus (TGEV), Bovine coronavirus (BCoV) (Baudoux et al., 1998), infectious bronchitis virus (IBV) (Corse et al., 2000), and SARS-CoV (Ho et al., 2004) results in nucleocapsid independent formation of virus-like particles (VLPs). It is also reported that MHV and IBV E protein expressed alone results in assembly of E-protein-containing vesicles, with a density similar to that of VLPs (Corse et al., 2000; Maeda et al., 1999). The M glycoprotein is among the most abundant coronavius structural proteins, spanning the membrane bilayer three times, with a long carboxyl-terminal cytoplasmic domain inside the virion and a short amino-terminal domain outside (Holmes et al., 2001; Locker et al., 1992; Narayanan et al., 2000). By using a 15 proteomic approach, a novel phosphorylated site of M was also identified (Zeng et al., 2004), but the importance of this for the function of M has not been defined. Studies on the profile of antibodies in SARS patients showed that antibodies against M and E are generally low or not present in SARS patients’ sera (Wang et al., 2003; Guo et al., 2004; Leung et al., 2004; Tan et al., 2004). This is probably because these proteins are embedded in the viral envelope. The nucleocapsid protein N of SARS-CoV is a highly charged, basic protein of 422 amino acids with seven successive hydrophobic residues near the middle of the protein (Marra et al., 2003; Rota et al., 2003). It undergoes self-dimerization (He et al., 2004; Surjit et al., 2004a). It binds to viral RNA and the three-dimensional structure of its amino-terminal portion is similar to those of other RNA-binding proteins (Huang et al., 2004). It also interacts with M protein and cell membranes through its hydrophobic domain and may thus participate in viral assembly (Sturman et al., 1980). The N proteins of many coronaviruses, including IBV, TGEV and MHV, have been shown to localize in both cytoplasm and nucleolus (Hiscox et al., 2001; Wurm et al., 2001). The presence of N protein in the nucleolus suggests a role of N protein in the synthesis of viral RNA. In fact, it has been demonstrated that N protein is required for efficient coronavirus genome synthesis (Thiel et al., 2003b). However, it has also been shown that N protein is not required for sub-genomic RNA synthesis (Thiel et al., 2001). Therefore, the role played by N protein in viral RNA synthesis is still disputable. For SARS-CoV N protein, it has been reported to be found in the cytoplasm and nucleus of SARS-CoV infected cells (Chang et al., 2004; Zeng et al., 2004). Many effects of SARS-CoV N protein on cell function have been reported. It activates signal transduction pathways, interferes with cellcycle processes, induces apoptosis and reorganizes actin under stressed conditions (Parker et al., 1990; Kuo et al., 2002; He et al., 2003; Surjit et al., 2004b). It is cleaved by caspase 3 (Ying et al., 2004). N proteins of many coronaviruses are highly immunogenic and expressed abundantly during infection (Liu et al., 2001; Narayanan et al., 2003). Several groups have shown that >90% of sera obtained from convalescent SARS patients have antibodies against N 16 (Shi et al., 2003; Wang et al., 2003; Guo et al., 2004; Leung et al., 2004; Tan et al., 2004). In addition, it was reported that the SARS-CoV N can induce specific T-cell responses (Gao et al., 2003b; Kim et al., 2004), the same responses as have been observed with other coronaviruses (Siddell, 1995), but how important is this for protective immunity remains to be determined. 1.5 Life cycle of coronavirus Coronavirus infection starts with the binding of the S protein on the surface of coronavirus binds to the receptor on the surface of human cell. Then, the nucleocapsid enters the cell through the fusion of the viral envelope with either the plasma membrane or endosomal membranes (Lai & Holmes, 2001). In the cytoplasm, uncoating proceeds through an unknown mechanism to release the viral RNA genome. The subsequent steps in coronavirus replication occur entirely in the cytoplasm of the host cells (Siddell et al., 1983). Once released into the cytoplasm, the positive sense RNA genome is used as an mRNA for translation to produce the RNA-dependent RNA polymerase. The resulting polymerase uses the genomic RNA as the template to synthesize the negative sense genomic and sub-genomic RNAs. The negative sense RNAs in turn are used as the templates by the viral polymerase to synthesize new positive sense genomic and sub-genomic RNAs (Lai & Holmes, 2001). The newly synthesized positive sense RNAs will be used as mRNAs for translation to produce all viral structural and non-structural proteins. The N protein is synthesized by free ribosomes in the cytoplasm, while M, E and S protein are synthesized by the ribosomes on the rough endoplasmic reticulum (RER) and then transported into Golgi apparatus (Lai & Holmes, 2001). Assembly of new virions begins when substantial structural proteins have been synthesized. First, N protein binds to positive sense genomic RNA to form nucleocapsid. Then, through the interactions between N and M proteins and between M and S proteins, the virion is assembled in a compartment between RER and Golgi apparatus. The virion will undergo maturation as it is transported from Golgi apparatus to smooth-walled 17 vesicle along the secretory pathway and finally released as the vesicle fuses with the plasma membrane (Lai & Holmes, 2001). Cytoplasm Genomic RNA(+) Polymerase Translation Smooth-walled vesicle 3’ (+)5’ Transcription 5’ (-) 3’ Transcription Replicatrion S E M RER Golgi N Sub-genomic RNAs(+) 5’ 3’ Genomic RNA(+) Nucleocapsid Nucleus Figure 5. The life cycle of Coronavirus. 1.6 Transmission of SARS-CoV The transmission pattern of SARS was similar in all affected areas. Normally, a patient with SARS was not identified when hospitalized and then infected health care workers, other patients and hospital visitors. These then infected their close contacts, and then the disease spread into the larger population (Hawkey et al., 2003). SARS Co-V is predominantly spread 18 in droplets that are shed from the respiratory secretions of infected persons (Dwosh et al., 2003). Although fecal or airborne transmission seem to be less frequent, faeces or animal vectors may also lead to transmission under certain circumstances (Ng et al., 2003). Shedding of SARS-CoV in urine also occurs but its outcome is unknown. The duration of infectivity is still unclear. Faecal shedding can last for several weeks; but no evidence showed that there is sufficient excretion of infectious viral particles to cause infection (Peiris et al., 2003a). It seems that SARS-CoV spreads more efficiently in hospital settings. Evidence suggests that certain procedures, such as intubation under difficult circumstances and the use of nebulizers, increase the risk of infection (Chan et al., 2003a). A few cases of laboratory-acquired SARSCoV transmission were occurred in Singapore, Taiwan and China. Although subsequent investigation showed inappropriate laboratory standards and no secondary transmission arose from these cases, they demonstrate the need for appropriate biosafety precautions in laboratories working with SARS-CoV. These labs are the only places on earth where SARSCoV is currently known to still exist and might be at the source of re-emergence. The good news is that the SARS-CoV is only moderately transmissible rather than highly transmissible. A single infectious case will infect about three secondary cases (Lipsitch et al., 2003; Riley et al., 2003). Nevertheless, the clusters of cases in hotel and apartment buildings in Hong Kong show that transmission of the SARS-CoV can be extremely efficient and fast under certain circumstances. Attack rates in excess of 50% have been reported. In some instances, so-called "superspreader" patients are able to transmit the SARS-CoV to a large number of individuals (World Health Organization, 2003b). So far there is no evidence that differences in virus strains may be responsible for the “super-spreader” phenomenon. There is also no strong evidence suggesting that subsequent transmissions led clinically less severe illness, possibly through attenuation of the virus. It is also unclear why children are relatively under-represented amongst SARS cases, and why on average they seem to suffer less severe SARS illness. The virus has been shown to survive for up to hours on plastic surfaces and up to 4 days in stools. 19 Nevertheless the virus loses infectivity after exposure to some disinfectants and fixatives. Heat exposure at 56°C quickly reduces infectivity (World Health Organization, 2003c). In a word, SARS-CoV is not easily transmissible outside of certain environment. This suggests that SARS will not spread in a totally uncontrolled manner in the community. 1.7 Epidemiology of SARS The SARS coronavirus is believed to originate from Guangdong province of southern China (Breiman et al., 2003). The worldwide spread of SARS-CoV was triggered by a single infected teacher from Guangdong province who spent some time in Hong Kong before he died because of SARS (Chan et al., 2003b). During that time he infected several others that in turn caused a series of outbreaks (Centers for Disease Control and Prevention, 2003). During a few months, the virus spread to different Hong Kong hospitals and communities as well as to Vietnam, Singapore, Canada, the United States of America, and beyond to a total of 30 countries and areas of the world (World Health Organization, 2003d). The incubation period of SARS ranges from 2 to 16 days. Large studies demonstrated a median incubation period of 6 days (Booth et al., 2003; Lee et al., 2003; Tsang et al., 2003). However, the time from exposure to the onset of symptoms may vary considerably (Donnelly et al., 2003). The WHO recommends that the current best estimate of the maximum incubation period is 10 days (WHO Update 49, 2003). Based on the latest data, the case fatality ratio is estimated to be 38°C), plus cough or breathing difficulty, and has been in contact with a person believed to have had SARS, or has a history of travel to or stay in a geographic area where documented transmission of the illness has occurred, during the 10 days prior to onset of symptoms (“suspect case”). A suspect case with infiltrates consistent with pneumonia or respiratory distress syndrome (RDS) by chest X-ray is reclassified as a probable case. The revised case definition as of 1 May 2003 (http://www.who.int/csr/sars/casedefinition/en/) includes virus-specific laboratory results: a suspect case that tests positive for SARS-CoV in one or more assays should also be reclassified as probable. The latest WHO case definitions are summarized in Table 1. While recommendations have been issued for the use of laboratory methods for SARSCoV identification (http://www.who.int/csr/sars/labmethods/en/), there are, however, at present no defined criteria for negative SARS-CoV test results to reject a diagnosis of SARS. Given the facts that virus excretion is comparatively low during the initial phase of SARS (Drosten et 21 Table 1. World Health Organization case definitions of SARS patients. (Source: http://www.who.int/csr/sars/postoutbreak/en/) Clinical case definition of SARS A person with a history of: Fever (≥ 38°C) AND one or more symptoms of lower respiratory tract illness (cough, difficulty breathing, shortness of breath) AND radiographic evidence of lung infiltrates consistent with pneumonia or RDS OR autopsy findings consistent with the pathology of pneumonia OR RDS without an identifiable cause. AND No alternative diagnosis can fully explain the illness. Laboratory case definition of SARS A person with symptoms and signs that are clinically suggestive of SARS AND with positive laboratory findings for SARS-CoV based on one or more of the following diagnostic criteria: a) PCR positive for SARS-CoV PCR positive using a validated method from: At least two different clinical specimens (eg nasopharyngeal and stool) OR the same clinical specimen collected on two or more occasions during the course of the illness (eg sequential nasopharyngeal aspirates) OR Two different assays or repeat PCR using a new RNA extract from the original clinical sample on each occasion of testing. b) Seroconversion by ELISA or IFA Negative antibody test on acute serum followed by positive antibody test on convalescent phase serum tested in parallel OR fourfold or greater rise in antibody titre between acute and convalescent phase sera tested in parallel. c) Virus isolation Isolation in cell culture of SARS-CoV from any specimen AND PCR confirmation using a validated method *ELISA = enzyme-linked immunosorbent assay; IFA = immunofluorescence assay; RDS = respiratory distress syndrome. al., 2003), and the insufficient sensitivity of presently available laboratory methods, premature exclusion on the basis of negative test results may lead to tragic consequences. Positive laboratory test results for other agents able to cause atypical pneumonia may serve as exclusion criteria; according to the case definition, a case should be excluded if an alternative diagnosis 22 can fully explain the illness. Nevertheless, the possibility of dual infection must not be ruled out completely (http://www.who.int/csr/sars/sampling/en/). 1.9 Pathogenesis of SARS-CoV The fatal pneumonia caused by SARS-CoV has the following distinct features (Nicholls et al., 2003): • epithelial cell proliferation • diffuse alveolar damage • macrophage infiltration of the lungs • haemophagocytosis (a feature attributed to cytokine dysregulation). These pathological features of SARS-CoV pneumonia are similar to H5N1 influenza pneumonia (To et al., 2001). Experimental studies in which macrophages are infected in vitro suggest that the H5N1 influenza viruses are hyper-inducers of pro-inflammatory Cytokines (Cheung et al., 2002). Human coronavirus can replicate in human macrophages in vitro (Li et al., 2003b; Collins et al., 1998). Based on these knowledge, it has been suggested that, in SARS-CoV pneumonia, pro-inflammatory cytokines released by stimulated macrophages in the alveoli have a prominent role in the pathogenesis of SARS leading to cytokine dysregulation. This idea has applications for the management of coronaviral pneumonia, as interventions with steroids might modulate this cytokine response and prevent fatal outcome (Collins et al., 1998). 1.10 Antiviral treatment At present, an efficacious treatment regimen for SARS is still unavailable. Primary methods include isolation and the implementation of stringent infection control measures to effectively prevent further transmissions. When making the treatment choices, the severity of the illness is a major factor to be considered. Ribavirin and steroids are the drugs which were 23 administered most frequently over the first months of the epidemic. The combination was initially thought to be responsible for some clinical improvement in SARS patients (Lee et al., 2003; Poutanen et al., 2003; Tsang et al., 2003). Recently glycyrrhizin, a compound found in liquorice roots (Glycyrrhiza glabra), was reported to have in vitro anti-SARS activity (Cinatl et al., 2003a). Furthermore, interferons inhibit SARS-CoV in vitro and interferon ß was more potent than interferon α or γ (Cinatl et al., 2003b). Therefore, it could be a promising candidate against SARS-CoV, alone or in combination with other antiviral drugs. Many research institutions around the world have been working on finding the potential anti-SARS agents in vitro. Based on previous studies, some steps unique to SARSCoV could be targeted for the development of antiviral drugs. Possible antiviral drugs (Holmes et al., 2003a) are: • Inhibitors of the SARS virus entry and membrane fusion: They could block the binding of the S protein on the viral envelope to a specific receptor on the cell membrane or inhibit receptorinduced conformational change in the S protein on the viral envelope; • Protease inhibitors: They could inhibit the cleavage of the large polyprotein encoded by the ORF 1a and b; • Inhibitors of SARS-CoV RNA synthesis (such as nucleoside analogs): They might interfere specifically with SARS-CoV replication without damaging the cell; • Assembly inhibitors: They could prevent coronavirus structural proteins and newly synthesized RNA genomes from assembling into new virions. 1.11 Viral Replicon, anti-viral drug screening and the aim of this project The causative agent of SARS has been identified to be a novel coronavirus. Although the initial SARS outbreak has been over, the likelihood of human and animal reservoirs suggest that this virus will continue to pose a worldwide public health threat. To better control 24 or prevent future SARS epidemics, anti-SARS vaccines and drugs need to be developed. To maximize the chance of finding efficacious anti-SARS drugs, high-throughput screening of large chemical libraries for compounds that can block SARS-CoV replication should be carried out. However, the high infectivity and virulence of SARS-CoV render this kind of research very dangerous. Therefore, there is a need for an anti-viral agent identification system which does not involve the use of live virus. For all families of human-infecting positive-sense single-stranded RNA viruses, partial viral RNA genomes have been constructed such that they replicate and persist in dividing cells without producing viral particles (Kaplan et al., 1988; Liljestrom et al., 1991; Khromykh et al., 1997; Behrens et al., 1998; Lohmann et al., 1999; Pang et al., 2001; Shi et al., 2002; Thumfart et al., 2002; Hertzig et al., 2004). These viral replicons were derived from viral genomes through the deletion of all or some structural genes. Because of the absence of viral structural genes, virion proteins were not synthesized in the cells and therefore no infectious viral particle could be produced by the cells. However, since all trans- and cis-acting components required for viral RNA synthesis were retained, these partial viral RNAs could replicate autonomously in the cells. In fact, hepatitis C virus repliconcarrying cell lines have been widely used to identify specific antiviral agents (Carroll et al., 2003; Kapadia et al., 2003). With these positive precedents, it seemed likely that a replicon cell line could be developed for SARS-CoV and such a cell line would be a much safer system for anti-SARS drug screening. The development of a SARS-CoV replicon cell line was the very goal of this thesis project. 25 CHAPTER 2 MATERIALS & METHODS 26 2.1 Design of SARS-CoV replicon The SARS-CoV genome and the desired replicon derived from it are shown in Figure 6 top and bottom respectively. As shown, the viral envelope-protein coding genes S, E and M were excluded from the replicon so as to disable virion synthesis. The nucleocapsid gene, N, was retained because the nucleocapsid protein had been shown to be required for viral RNA synthesis (Almazan et al., 2004; Hertzig et al., 2004). It was shown that the sequence involved in the regulation of expression of a coronavirus 3’-proximal gene includes more than 100 nt upstream of the gene (Alonso et al., 2002; Jeong et al., 1996). Therefore, in order to achieve relatively native expression of N gene from the replicon, a region of ~300 nt upstream of N ORF was included in the replicon. This region actually encompassed the non-structural ORFs 8a and 8b of SARS-CoV and the transcription regulatory core sequence for mRNA 8 (Figure 3). The green fluorescent protein-blasticidin deaminase fusion (GFP-BlaR) gene was included into the replicon to enable easy selection and detection of replicon-containing cells. It was inserted between ORFs 1 and 8-N, not at the 5’ or 3’ end of the replicon, in order to minimize any possible deleterious effect on the synthesis of replicon RNA. It was known that the cisacting elements for efficient coronavirus genome replication occur at both the 5’ and 3’ ends of the genome covering parts of ORFs 1 and N (Lai & Holmes, 2001). The expression of GFPBlaR was driven by the transcription regulatory sequence of ORF S, which was included in the replicon and occurring at a position right upstream of the GFP-BlaR gene. 2.2 Construction of SARS-CoV replicon 2.2.1 Overview of replicon construction strategy The reverse genetic strategy for constructing the desired SARS-CoV replicon is illustrated in Figure 6. In brief, cDNAs for the SARS-CoV genomic regions to be included in the replicon were first generated from the virus genomic RNA by RT-PCR. GFP-BlaR gene DNA flanked by the appropriate restriction sites was generated by PCR from the commercial 27 0kb 5kb 10kb 15kb 20kb 25kb 30kb 7a 8a 9b 3a 1a L 1b S RT-PCR pTracer 16385 12192 RT-PCR E M RT-PCR PCR 16200 27705 29711 21477 Gb (1.2kb) C (5.28kb) N (2kb) Cut by BsaI 13046 T7 promoter 6 7b 8b RT-PCR Gb B (4.19kb) 1 3b N Ligation A (13kb) 21477 12192 27705 29711 BCGbN(12.6kb) Cut by PshAI Ligation 1 L 27705 21477 T7 promoter 29711 ABCGbN (24,766bp) 1 In Vitro Transcription Gb 8 N Full length SARS-CoV Replicon RNA Figure 6. SARS-CoV replicon and the strategy for its construction. Each SARS-CoV sequence-containing DNA intermediates is identified with a name, and its virus-derived regions are delimited by the genomic coordinates SARS-CoV strain SIN2774. The 5’-caps and 3’-polyadenine tails of the SARS-CoV genome and replicon RNAs are omitted. Gb stands for green fluorescent protein-blasticidin deaminase fusion gene, L stands for leader sequence. plasmid pTracer™-CMV/Bsd (Invitrogen). The SARS-CoV cDNAs and GFP-BlaR gene DNA were then cleaved by restriction endonucleases and assembled together through ligation to form the SARS-CoV replicon transcription template. Finally, this template was transcribed in vitro to generate the desired SARS-CoV replicon RNA. As shown in Figure 6 and described in Section 2.1, the desired SARS-CoV replicon consisted of the GFP-BlaR gene sandwiched between two SARS-CoV regions: the 5’ region that contained ORF 1 and the 3’ region that contained ORFs 8 and N. Because of its enormous 28 size (21 kb), the 5’ region had to be separated into a few sub-regions in cDNA synthesis. Therefore, the desired replicon had to be assembled from multiple DNA fragments. Yount et al. (2000) have devised an elegant approach to assemble multiple DNA fragments in vitro. This approach uses restriction endocleases recognizing specific DNA sequences but cleaving DNA at nearby sites with no specific sequence requirement (non-palindromic restriction endocleases). Such enzymes are used to prepare DNA fragments to be assembled in such a way that each end of each fragment is complementary only to one end of another specific DNA fragment. As such, multiple DNA fragments can then be assembled in the desired order in one simple ligation in vitro. We adopted this approach to construct our SARS-CoV replicon transcription template. Two major difficulties were encountered in the generation of our SARS-CoV replicon transcription template. First, even though in principle a lot of DNA fragments can be assembled orderly all at once using the aforementioned approach, the efficiency of getting the desired full-length assembly product decreases as the number of fragments to be assembled increases. Therefore, the initial number of DNA fragments has to be minimized. However, for most non-palindromic restriction endonucleases, the SARS-CoV genetic sequences to be included into the replicon contain too many recognition sites. No restriction endonuclease could be used singly to prepare all the cDNAs for the assembly of the entire replicon. Therefore, combinations of different restriction endonucleases were tried. The second major difficulty was in the cDNA amplification by PCR. Certain regions of SARS-CoV genome were particularly difficult to amplify efficiently and/or faithfully. Very small amounts of products or aberrant products (mostly having internal deletions) were obtained when certain priming sites and thermophilic DNA polymerase preparations were used in the PCRs. Therefore, many different priming sites and DNA polymerase preparations were tried. After extensive optimization of individual reactions, a satisfactory strategy for the assembly of SARS-CoV replicon transcription template was developed (Figure 6). In this 29 strategy, the SARS-CoV 5’ region was amplified into three cDNAs (designated as A, B, and C). The non-palindromic restriction endonuclease Bsa I was used in the assembly of B, C, Gb (GFP-BlaR gene-containing) and N (SARS-CoV 3’ region-containing) cDNAs. The Bsa I recognition site at the junction between B and C is endogenous of SARS-CoV genomic sequence. Other Bsa I recognition sites were introduced into the cDNAs from the PCR primers. The Bsa I-cleaved B, C, Gb and N cDNAs were first assembled to form the BCGbN DNA. Finally, the BCGbN DNA and A cDNA were ligated together at the restriction endonuclease PshA I recognition site endogenous of SARS-CoV genome to generate the ABCGbN DNA. ABCGbN DNA contains a primer-introduced T7 transcription promoter upstream to the replicon sequence. It could thus be used as the template for the synthesis of the replicon RNA through T7 RNA polymerase-mediated in vitro transcription. 30 Notes for Sections 2.2.2-2.4.5: In these sections, reactions were described with reference to certain volumes. However, different reaction volumes could actually be used according to the needs. In such cases, the actual amounts or volumes of individual reaction components used were changed proportionally. All the primers used were synthesized by Research Biolab Singapore Pte Ltd and their sequences are listed in Appendix 1. 2.2.2 Synthesis of SARS-CoV first-strand cDNA by reverse transcription SARS-CoV strain SIN2774 virion RNA (a gift of Prof. T. K. Chow, Department of Microbiology, National University of Singapore) was used as the template for cDNA synthesis. The reverse transcription reaction was performed using the SuperScript III First Strand Kit (Invitrogen) as described in the manufacturer’s manual with some modifications. Thus, the following components were first added to an RNase-free microcentrifuge tube: Gene-specific primer 9R or 09R (10 µM) 0.5 µl SARS-CoV virion RNA (unknown concentration) 1.0 µl dNTP Mix (10 mM each) 1.0 µl RNAase-free water 7.5 µl The reaction mix was heated to 65°C for 5 minutes and chilled on ice for at least 1 minute. The tube was then spun briefly and the following components were thoroughly mixed in: 10X First-Strand Buffer 2 µl MgCl2 (25 mM) 4 µl DTT (0.1 M) 2 µl RNaseOUT (40 units/µl) 1 µl SuperScript III RT (200 units/µl) 1 µl 31 The reaction mix was incubated at 50°C for 2 hours followed by heating at 85℃ for 5 minutes and chilling on ice. One microliter of E. coli RNase H was then added and incubated at 37°C for 20 minutes. The reaction mix was chilled on ice and stored in -20℃ until use. 2.2.3 Synthesis of A DNA The TripleMaster PCR System (Eppendorf) was used to synthesize the SARS-CoV sequence-containing A DNA. The PCR was performed as described in the manufacturer’s manual with certain modifications. Thus, two master mixes with the following components were first prepared on ice: Master Mix 1 20 µl Molecular biology grade water 15 µl Forward primer T71+F (10 µM) 2 µl Reverse primer 09R (10 µM) 2 µl SARS-CoV first-strand cDNA from Section 2.2.1 1 µl Master Mix 2 30 µl Molecular biology grade water 22.1 µl 10x Tuning Buffer with Mg2+ 5.0 µl dNTP mix (10 mM each) 2.5 µl TripleMaster Polymerase Mix (5 units/µl) 0.4 µl Master Mixes 1 and 2 were then mixed together on ice in a 0.2 ml PCR tube, which was immediately placed into a GeneAmp® 9700 thermal cycler (Applied Biosystems) preheated at 93°C. It was followed by the running of the thermal cycling program as detailed in Table 2. 32 Table 2. Thermal cycling program optimized for the amplification of SARS-CoV cDNA fragment A. Cycle no 1-10 11-35 Cycle 10× 25× Step Temp. Time Description 1 93 1 min Initial template denaturation 2 93 10 sec Template denaturation 3 55 20 sec Primer annealing 4 68 9 min Primer extension/elongation 5 93 10 sec Template denaturation 6 55 20 sec Primer annealing 7 68 9min+20sec* Primer extension/elongation *Time increment of 20 seconds; for each elongation step the time was extended by 20 seconds 2.2.4 Synthesis of B, C and N, and GFP-BlaR gene DNAs The SARS-CoV sequence-containing B, C and N DNAs were synthesized by PCR using the Elongase Amplification System (Invitrogen). For the synthesis of each DNA, a 50-µl reaction was set up by mixing on ice the following components: Molecular biology grade water 35 µl Forward primer (see below) (10 µM) 1 µl Reverse primer (see below) (10 µM) 1 µl SARS-CoV first-strand cDNA from Section 2.2.1 1 µl 5X Buffer A 4 µl 5X Buffer B 6 µl dNTP mix (10 mM each) 1 µl Elongase Enzyme Mix 1 µl 33 The reaction tubes were immediately placed into GeneAmp® 9700 thermal cycler preheated at 94°C. After incubation at 94℃ for 30 seconds, the following cycling program was started: 35 cycles with each cycle consisting of 94℃ for 30 seconds, 55℃ for 30 seconds, and 68℃ for 2 to 5 minutes (~1 minute per kb of target fragment). Finally, the reaction mixes were heated to 72℃ for 10 minutes, cooled to 4℃ and then stored at -20℃. The gene-specific primers used were 09F and 11R for the amplification of B, 12F and 14R2 for C, NFX and 9R for N. The GFP-BlaR gene DNA was amplified as described above, except that the template was pTracer™-CMV/Bsd vector DNA (1 ng) and the primers were BGBF and BGBR. 2.2.5 Assembly and amplification of BCGbN DNA The B, C, N and GFP-BlaR gene DNAs were first purified using the QIAquick PCR Purification Kit (Qiagen) as described in the manufacturer’s manual. The purified DNAs were then digested with restriction endonuclease Bsa I (New England Biolabs). Each 50-µl reaction was composed on ice with 20 µl of purified DNA (~100 ng/µl), 2 µl of Bsa I (10 units/µl), 5 µl of 10 × NEBuffer 3 and 23 µl of molecular biology grade water. The reaction mixes were incubated at 50°C for 2 hours. The restriction products were then electrophoresced on 0.8% agarose gels in TBE. The gel portions containing the desired DNAs were excised. The DNAs were then extracted from the gel slices using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. To assemble the BCGbN DNA, the Bsa I-digested and gel purified B, C, N, and GFPBlaR gene DNAs were ligated together using T4 DNA ligase (New England Biolabs). A 50-µl ligation reaction was composed on ice with 10 µl of each of the four DNAs (~100 ng/µl), 2 µl of T4 DNA Ligase (400 cohesive end units/µl), 5 µl of 10 x T4 DNA Ligase Reaction Buffer and 3 µl of molecular biology grade water. The ligation was carried out at 16°C for 14 hours. 34 The ligation product was then electrophoresced on a 0.5% agarose gel in TBE. The gel portion containing the desired BCGbN DNA was excised. The DNA was extracted from the gel using the QIAquick Gel Extraction Kit according to the manufacturer’s instructions. Due to the inefficiency of multiple DNA ligation, the yield of full-length BCGbN DNA was very low. Therefore, it was necessary to amplify BCGbN DNA to produce sufficient quantities for the downstream reactions. The Elongase Amplification System was used to achieve this purpose. To set up a 50-µl reaction, the following components were mixed on ice: Molecular biology grade water 35 µl Forward primer 6F (10 µM) 1 µl Reverse primer 9R (10 µM) 1 µl Gel-purified first-round BCGbN DNA (~2 ng/µl) 1 µl 5X Buffer A 4 µl 5X Buffer B 6 µl dNTP mix (10 mM each) 1 µl Elongase Enzyme Mix 1 µl The reaction mix was immediately placed into GeneAmp® 9700 thermal cycler preheated at 94°C and the thermal cycling program as shown in Table 3 was run. 35 Table 3. Thermal cycling program optimized for the amplification of BCGbN DNA. Cycle no 1-5 6-35 Cycle Step Temp. Time Description 1 1 94 20 sec Initial template denaturation 2 94 5 sec Template denaturation 3 55 20 sec Primer annealing 4 68 13 min Primer extension/elongation 5 94 10 sec Template denaturation 6 68 13min+20sec* Primer annealing/extension 5× 30× *Time increment of 20 seconds; for each elongation step the time was extended by 20 seconds 2.2.6 Assembly of ABCGbN DNA The SARS-CoV sequence-containing A and BCGbN DNAs were first purified using the QIAquick PCR Purification Kit according to the manufacturer’s instructions. They were then digested with restriction endonuclease PshA I (New England Biolabs). A 50-µl reaction was composed on ice with 42.5µl of A or BCGbN DNA (~200 ng/µl), 2µl of PshA I (10 units/µl), 5 µl of 10 × NEBuffer 4 and 0.5 µl of BSA (10 µg/µl). The reaction mixes were incubated at 37°C for 3 hours. The restriction products were then electrophoresced on a 0.5% agarose gel in TBE. The gel portions containing the desired DNAs were excised. The DNAs were then extracted from the gel slices using the QIAquick Gel Extraction Kit according to the manufacturer’s instructions. To assemble the ABCGbN DNA, the PshA I-digested and gel purified A and BCGbN DNAs were ligated using T4 DNA ligase. A 100-µl ligation reaction was composed on ice with 43 µl of each DNA (~60 ng/µl), 4 µl of T4 DNA Ligase (400 cohesive end units/µl), 10 µl of 10 x T4 DNA Ligase Reaction Buffer. The ligation was carried out at 12°C for 14 hours. The resulting DNA was extracted first by phenol-chloroform-isoamyl alcohol (25:24:1), then 36 by chloroform, and precipitated in the presence of 67% ethanol and 0.1 M sodium acetate (pH5.2). Shortly before the performance of in vitro transcription (see below), the extracted DNA was pelleted by centrifugation, washed with 70% ethanol, air-dried and finally dissolved in 10 µl of RNase-free water. 2.2.7 Synthesis of SARS-CoV replicon RNA The assembled ABCGbN DNA contained a primer-introduced T7 transcription promoter. It could thus be used as the template for the synthesis of SARS-CoV replicon RNA through T7 RNA polymerase-mediated in vitro transcription. The T7 in vitro transcription system mMessage mMachine Kit (Ambion), which also includes the RNA 5’-capping function, was used to generate the replicon RNA. A 30-µl reaction mix was composed on ice with 2.5 µl of RNase-free water, 15 µl of 2 × NTP/CAP, 3 µl of 10× Reaction Buffer, 2 µl of ABCGbN DNA preparation from Section 2.2.6 (~0.5 µg/µl), 4.5 µl of GTP (30 mM) and 3 µl of Enzyme Mix. The reaction mix was incubated at 37°C for 2 hours. To remove the DNA template, 1 µl of DNase I (2 units/µl) was then added and the reaction mix was incubated at 37°C for 15 minutes. To polyadenylate the RNA synthesized, the reaction mixture was treated further by the reagents from the Poly (A) Tailing Kit (Ambion). Thus, 26 µl of RNase-free water, 20 µl of 5 × E-PAP Buffer, 10 µl of MnCl2 (5 mM), 10 µl of ATP (10 mM) and 4 µl of E –PAP were added in the given order. The reaction mix was incubated further at 37°C for 1 hour. The final product was purified by adding 30 µl of LiCl precipitation solution (Ambion) and incubating at –20°C for 30 minutes, followed by centrifugation at maximum speed for 15 minutes at 4°C to pellet the RNA. The RNA was washed once with 1 ml of 70% ethanol, air-dried, and finally dissolved in 20 µl of RNase-free Water. 37 2.3 Development of SARS-CoV replicon-carrying cell lines The baby hamster kidney (BHK)-21 cell line was purchased from ATCC. It was used to develop the SARS-CoV replicon-carrying cell lines as described below. 2.3.1 Maintenance of BHK-21 Cell Line BHK-21 cell line was maintained in 5 ml of DMEM medium (Gibco) supplemented with 10% foetal calf serum (Gibco) (D10) in 25-cm² tissue culture flasks at 37°C in a humidified CO2 tissue culture incubator (Jouan). Whenever confluence was reached, the cells were detached from the flask by first washing with 5 ml of PBS and then incubating in 0.5 ml of 0.05% trypsin solution (Gibco). When the majority of cells were detached, the flask was tapped gently to complete the cell detachment. Then, 4.5 ml of D10 was added to stop trypsinization and the cell suspension was pipetted up and down a few times to maximize the separation of cells from each other. A 0.5-ml aliquot of cell suspension was transferred into a new flask. Finally, 4.5 ml of fresh D10 was added to the flask before the cells were put into the tissue culture incubator for further growth. 2.3.2 Transfection of BHK-21 cells with SARS-CoV replicon RNA On the day before the transfection was to be carried out, BHK-21 cells were plated onto a 6-well plate using D10 (2 ml/well) such that the cells would be 40-50% confluent the next day. For the transfection of cells in one well, 10 µl of the transfection agent Lipofectamine 2000 (Invitrogen) was first diluted into 250 µl of Opti-MEM medium (Invitrogen) in a 1.5-ml eppendorf tube. In a separate tube, 10 µl (~10 µg) of SARS-CoV replicon RNA preparation from Section 2.2.7 was diluted into 250 µl of Opti-MEM medium. Both tubes were left at room temperature for 5 minutes. The contents of the two tubes were then mixed together and left at room temperature for 20 minutes to allow the formation of RNA-Lipofectamine 2000 complex. During this time, the original D10 was removed from the 38 cells to be transfected and replaced with Opti-MEM medium (0.5 ml/well) after a PBS wash of the cells. Then, the RNA-Lipofectamine complex preparation (0.5 ml /well) was added into the cells. The treated cells were incubated in the tissue culture incubator for 4-6 hours. Finally, DMEM medium supplemented with 20% fetal calf serum (1 ml/well) was added to the treated cells and the cells were incubated further in a tissue culture incubator. 2.3.3 Selection for and continuous culturing of SARS-CoV replicon-carrying cells The SARS-CoV replicon contained the GFP-BlaR gene under the control of the viral transcription regulatory sequence. The cells carrying the replicon should express the GFP-BlaR gene and therefore be resistant to blasticidin. Accordingly, one day after tranfection, blasticidin (Invitrogen) was added to a final concentration of 10 µg /ml to the culture medium to select for the replicon-carrying cells. Two days after the introduction of blasticidin, the transfected cells were distributed into several wells in 6-well plates and incubated further in D10 with 10 µg/ml of blasticidin (D10B). The blasticidin-sensitive cells died and detached from the growth surface within one week. They were removed together with the culture medium. After two PBS washes, fresh D10B was added to the wells and the blasticidin-resistant cells were allowed to grown further. Blasticidin-resistant cell colonies appeared in two weeks. Several colonies with diameters over 1 mm were isolated and grew further in the presence of blasticidin in separate 25-cm² tissue culture flasks. The isolates that continued to grow were designated as BHK-SCR cell lines. They were maintained using the same procedure as described in Section 2.3.1 for maintaining the parent BHK-21 cells, except that D10B was used. Although the SARS-CoV replicon-carrying cells do not produce infectious viral particles, they are still associated with some biological risks. If a replicon-carrying cell is infected by a circulating field coronavirus, there is a chance of producing a novel replicationcompetent recombinant coronavirus through the recombination between the SARS-CoV 39 replicon and the genome of the circulating field coronavirus. The pathogenicity of such a recombinant coronavirus cannot be assessed. In view of this risk, a special standard operating procedure (SOP) for handling the SARS-CoV replicon cell line was set up by my thesis supervisor Dr. Hung Siu Chun. This SOP was approved by the Institutional Biosafety Committee of our University with the acknowledgement of notification from the Genetic Modification Advisory Committee, Singapore. The fundamental principle behind this SOP is to take utmost care to prevent the cross-contamination between the replicon cell line and the environment. Accordingly, the replicon cell line is basically handled using BSL2 facilities and BSL2 work practices. Additional precautions include, first, the decontamination in the earliest possible instant inside the BSL2 cabinet of any surface having come into contact with the replicon cell culture, including the inner surface of a pipette, and, second, the use of double containers to carry the replicon cell culture outside of the BSL2 cabinet with their outer surfaces decontaminated before being taken out of the BSL2 cabinet. The SOP was strictly followed throughout the course of this work. 2.4 Analysis of SARS-CoV replicon-carrying BHK-21 cell line Two blasticidin-resistant cell lines generated as described in Section 2.3.3 were designated as BHK-SCR1 and BHK-SCR2 and subjected to analyses pertinent to the SARSCoV replicon that they carried. The parent cell line BHK-21 was used as the negative control in these analyses. 2.4.1 Detection of GFP-BlaR protein Fluorescence microscopy and flow cytometry were used to observe the green fluorescence of GFP-BlaR protein expressed from the SARS-CoV replicon. They were done at various time points to monitor the presence of the replicon in the cells. 40 2.4.1.1 Fluorescence microscopy The cells to be observed were grown to near confluence on a 6-well plate. They were first washed once with PBS and then fixed with 4% formaldehyde in PBS for 15 minutes and finally washed twice with PBS. The treated cells were observed under an Olympus IX70 inverted fluorescence microscope. The images were recorded using Image-Pro Plus (Media Cybernetics). 2.4.1.2 Flow cytometry The cells were first detached from the growth surface by trypsinization as described in Section 2.3.1 and then transferred to a 15-ml centrifuge tube. They were pelleted by centrifugation at 300×g for 5 minutes, rinsed once with PBS, fixed with 4% formaldehyde in PBS, washed twice with PBS and finally resuspended in PBS at a cell density of about 106 per ml. The cells were then scanned for green fluorescence and light scattering using a Beckman Coulter Epics Altra flow cytometer. The data collected were analyzed using the WIN-MDI 2.7 data analysis program (The Scripps Research Institute). 2.4.2 Detection of SARS-CoV replicon and sub-replicon RNAs by Northern blot analysis In the cells carrying the SARS-CoV replicon, coronavirus-specific discontinuous transcription (Section 1.4.2) should take place on the replicon leading to the production of subreplicon RNAs, L-Gb-8-N, L-8-N and L-N, as depicted in Figure 7. Northern blot analysis was carried out to detect for these SARS-CoV replicon and sub-replicon RNAs extracted from the replicon-carrying cells. It was done using a non-radioactive DNA probe labeling and detection system. 41 Full length SARS-CoV Replicon RNA L Gb 8 ORF 1 of SARS-CoV N Transcription 8 3.2 kb L-Gb-8-N 8 L-8-N Nucleus L-N 2.0 kb 1.6 kb Cytoplasm SCR replicon cell Figure 7. Generation of sub-replicon RNAs through discontinuous transcription of SARS-CoV replicon RNA in the replicon-carrying cells. The black box represents the 72-nt leader RNA sequence, derived from the 5’ end of the replicon, located at the 5’ end of each sub-replicon RNA. The size of each RNA shown is exclusive of the poly-A tail. 2.4.2.1 Probe preparation The Gene Images Random Prime Labeling Module (Amersham) was used to prepare fluorescein-labelled probes. Since SARS-CoV N gene sequence should be found in all replicon and sub-replicon RNAs (Figure 7), this sequence was the target for detection. Accordingly, the template for probe preparation was the 2-kb SARS-CoV N DNA (Figure 6), which was synthesized and gel-purified as described in Sections 2.2.4 and 2.2.5 respectively. It was denatured by heating for 5 minutes in a boiling water bath and was rapidly chilled on ice. A 50 µl labeling reaction was set up on ice with 31 µl of nuclease-free water, 10 µl of labeled nucleotide mix, 5 µl of random nonamer primer mix, 3 µl (~50 ng) of denatured SARS-CoV N DNA, and 1 µl of Klenow enzyme solution (5 units/µl). The reaction mix was incubated at 42 37°C for 1 hour. The reaction was then terminated by the addition of EDTA to a final concentration of 20 mM. The probe preparation was stored at -20°C until use. 2.4.2.2 Preparation of RNA To extract total RNA from SARS-CoV replicon-carrying cells or the parent BHK-21 cells, about 4 × 106 cells were first detached from the growth surface by trypsinization as described in Section 2.3.1. They were transferred to a 15-ml centrifuge tube and pelleted by centrifugation at 300 × g for 5 minutes. After the removal of the supernatant, the cell pellet was then subjected to RNA extraction using the RNeasy Mini Kit (QIAGEN) according to the Animal Cell Protocol supplied by the manufacturer. A SARS-CoV N sequence-containing RNA was used as a positive control for the detection of SARS-CoV replicon and sub-replicon RNAs. To generate this RNA, SARS-CoV N DNA, which was synthesized and gel-purified as described in Sections 2.2.4 and 2.2.5 respectively, was first inserted into the vector pCR2.1-TOPO (Invitrogen), which has a T7 promoter at one side of the cloning site. A clone was selected with the insert in the orientation such that T7-transcription of which would produce RNA containing the direct SARS-CoV N sequence. DNA from this clone was linearized at a vector location at the side opposite to the T7 promoter with respect to the SARS-CoV N insert. One-microgram of this linear DNA was used as the template for in vitro transcription using the mMessage mMachine Kit performed according to the manufacturer’s instructions. The 2150-nt SARS-CoV N sequence-containing RNA thus synthesized was used as the positive control. 2.4.2.3 Electrophoresis and capillary-transfer of RNA The RNAs were electrophoresed under denaturing conditions. They were first denatured by mixing individually with 9 volumes of denaturing sample buffer (see Appendix 2) 43 followed by heating at 85°C for 5 minutes. RNA electrophoresis was carried out using a gel with 0.8% agarose, 1 × MOPS (see Appendix 2) and 6.6% formaldehyde, and a buffer containing 1 × MOPS and 6.6% formaldehyde. It continued until the bromophenol blue sample dye nearly reached the far end of the gel. The gel was then washed in 10 volumes of water for 15 minutes. The RNAs in the gel were partially cleaved by soaking the gel in 5 volumes of alkaline solution (see Appendix 2) at room temperature for 30 minutes with gentle agitation. Afterwards, the gel was washed once in 5 volumes of neutralization solution (see Appendix 2) and twice in 5 volumes of 10 × SSC, each for 30 minutes. A capillary transfer apparatus was then assembled as shown in Figure 8 to transfer the RNAs from the gel onto a Hybond-N+ positively charged nylon membrane (Ambion). The capillary transfer was allowed to proceed for 20-24 hours. Finally, the RNAs were fixed onto the nylon membrane by UV irradiation using an automatic UV cross-linker (Vilber Lourmat). 2.4.2.4 Probe hybridization and signal generation The hybridization of probes to the immobilized RNAs on the nylon membrane and the subsequent signal generation were done using the reagents from the Gene Images CDP-Star Detection Module (Amersham). The nylon membrane with immobilized RNAs (blot) was first pre-hybridized in the hybridization buffer (see Appendix 2) for 2-4 hours at 65° in a hybridization incubator (FinePCR) in the way that there was a constant, even and slow flow of hybridization buffer over the blot surface. One-fifth milliliter of hybridization buffer was used per cm² of blot. For hybridization, 1.5 µl of probes (prepared as described in Section 2.4.2.1) was used per ml of hybridization buffer. The appropriate volume of probes was first diluted with RNase-free water to 20 µl and then denatured by boiling for 5 minutes. The denatured probes were then carefully mixed into the buffer for pre-hybridizing the blot. The hybridization was allowed to proceed for 16 hours in the hybridization incubator with the same settings as 44 weight Glass plate Paper towels 1 kg Whatman Gel 3MM paper Whatman 3MM paper Hybond-N+ membrane Plastic wrap 10XSSC Glass plate Support Figure 8. The capillary transfer apparatus those used in pre-hybridization. After hybridization, the blot was washed twice in the low stringency wash buffer (1 × SSC, 0.1% SDS) and then twice in the high stringency wash buffer (0.1 × SSC, 0.1 % SDS). Each wash was done at 65°C for 15 minutes using 1.25 ml of buffer per cm² of blot. Following the stringency washes, the blot was incubated in blocking buffer (see Appendix 2; 1 ml per cm² of blot) and then in anti-fluorescein-AP conjugate solution (see Appendix 2; 0.3 ml per cm² of blot), each for 1 hour at room temperature with gentle agitation. Afterwards, the blot was washed thrice with AP wash buffer (see Appendix 2; 5 ml per cm² of blot), each for 10 minutes, at room temperature. After draining off excess wash buffer from the blot, CDP-Star detection reagent was added evenly onto the blot at 30-40 µl per cm² of blot. After incubation at room temperature for five minutes, excess detection reagent was drained off and the blot was sealed inside a clean transparent plastic bag. Chemiluminescent signals emitted from the blot were detected by exposing a Hyperfilm-MP X-ray film (Amersham) to the blot for various durations between 1 to 30 minutes, followed by the photographic development of the exposed film. 45 2.4.3 Analysis of SARS-CoV sub-replicon RNAs by RT-PCR As depicted in Figure 7, sub-replicon RNAs having the 5’-proximal leader joined to 3’-proximal genes should be produced in the SARS-CoV replicon-carrying cells. The region of a sub-replicon RNA encompassing the junction between the 5’-proximal leader and 3’proximal gene (leader-body junction) can be amplified by RT-PCR using a forward primer specific to the leader and a reverse primer specific to the 3’-proximal gene. Besides providing evidence for the specific discontinuous transcription, this RT-PCR also produces a product which can be sequenced to locate the leader-body junction precisely. To amplify the leader-body junction of the L-Gb-8-N or L-N sub-replicon RNA (Figure 7), total RNA was first extracted from SARS-CoV replicon-carrying cells as described in Section 2.4.2.2. Two micrograms of total RNA was used as the template for RT-PCR, which was performed using the OneStep RT-PCR Kit (QIAGEN). Besides the RNA template, the 50 µl reaction also contained 1 × QIAGEN OneStep RT-PCR buffer, 400µM of each dNTP, 0.6 µM of each of the forward and reverse primers, 2.0 µl QIAGEN OneStep RT-PCR Enzyme Mix and 10 units of RNase inhibitor. The leader-specific forward primer was SCVLF. The reverse primers for the amplification of L-Gb-8-N and L-N sub-replicon RNAs were GFPBLAR and NR respectively. The reaction mix was placed into a GeneAmp® 9700 thermal cycler. It was first maintained at 50°C for 30 minutes for reverse transcription to take place. Afterwards, it was heated to 95°C for 15 minutes to inactivate the reverse transcriptase as well as to activate the HotStar DNA polymerase in the Enzyme Mix. This was followed by 35 thermal cycles, each consisting of three steps: first, 94℃ for 40 seconds; second, 55℃ for 40 seconds; and third, 72℃ for 20 or 30 seconds for the detection of L-Gb-8-N or L-N sub-replicon RNA respectively. Finally, the reaction mixes were maintained at 72℃ for 10 minutes and then cooled to 4℃. 46 2.4.4 Detection of GFP-BlaR gene in total cell DNA GFP-BlaR gene DNA was not expected to occur in the SARS-CoV replicon-carrying cells. The following procedures were done to confirm its absence. 2.4.4.1 Extraction of total cell DNA To extract total DNA from SARS-CoV replicon-carrying cells or the parent BHK-21 cells, about 4 × 106 cells were first detached from the growth surface by trypsinization as described in Section 2.3.1. They were transferred to a 15-ml centrifuge tube and pelleted by centrifugation at 300 × g for 5 minutes. After the removal of the supernatant, the cell pellet was then subjected to DNA extraction using the QIAamp DNA Mini Kit (QIAGEN) according to the Protocol for Cultured Cells supplied by the manufacturer. 2.4.4.2 PCRs for the detection of GFP-BlaR and GAPDH genes PCRs were performed using HotStarTaq DNA polymerase (Qiagen) and the accompanying reagents. Each 30-µl PCR was composed on ice such that it contained ~0.2 µg of total cell DNA prepared as described in Section 2.4.4.1, 1 × PCR buffer, 200 µM of each dNTP, 0.2 µM of each primer and 0.75 units of HotStarTaq DNA polymerase. The primers used for detecting GFP-BlaR gene were BGBF and BGBR, and those for detecting GAPDH gene were GAPDHF and GAPDHR. The reaction mix was placed into GeneAmp® 9700 thermal cycler pre-heated at 95°C. After incubating at 95℃ for 15 minutes to activate the polymerase, 35 thermal cycles were run with each cycle consisting of 94℃ for 45 seconds, 55℃ for 5 seconds, and 72℃ for 70 seconds for amplifying GFP-BlaR gene or 30 seconds for amplifying GAPDH gene. Finally, the reaction mix was maintained at 72℃ for 10 minutes and then cooled to 4℃. The GFP-BlaR and GAPDH PCR products were expected to be 1.2 kb and 0.45 kb in size respectively. 47 2.4.5 Sequencing of SARS-CoV replicon and sub-replicon RNAs To obtain the complete sequence of the SARS-CoV replicon persisting in the BHKSCR2 cells, total RNA was extracted from these cells using the same method as described in 2.4.2.2. A set of 13 overlapping SARS-CoV replicon cDNAs of about 2 kb in size encompassing the entire replicon was generated from the total RNA as described in 2.4.3, except that the duration of the third step in each thermal cycle was 2.5 minutes and that the primers used were shown in Table 4. The cDNAs were purified using QIAquick Purification Kit according to the manufacturer’s instruction and then subjected to DNA sequencing using Big Dye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Each sequencing reaction mix was composed on ice with 4 µl of 2.5 × Big Dye Terminator Ready Reaction Mix, 2 µl of 5 × sequencing buffer, 50 ng of purified cDNA and 3.2 µl of 1 µM sequencing primer, topped up to 20 µl with molecular biology grade water. The sequencing reactions were performed in a GeneAmp® 2400 Thermal Cycler. The thermal cycle program used and the subsequent purification and drying of the sequencing reaction products were done according to the instructions from the manufacturer of the cycle sequencing kit. The purified products were sent to the NUS Microbiology Department DNA Sequencing Facility for electrophoresis and sequence read-out using an ABI PRISM 3100 Genetic Analyser (Applied Biosystems). The sequencing data thus obtained were compared with the published sequence of SARS-CoV strain SIN2774 (GenBank Accession Number AY283798) using the MegAlign module of the sequence analysis software Lasergene (DNASTAR). Thirty-nine sequencing reactions were first done aiming to cover the entire SARS-CoV replicon. Regions with ambiguities, apparent base changes, or gaps were then re-sequenced with the same or new primers until the sequence of the entire replicon could be read with confidence. Altogether 47 sequencing primers were employed. They are listed in Table 4. To locate the leader-body junction in the leader-GFP-BlaR-N or leader-N sub-replicon RNAs, the cDNA obtained from each sub-replicon RNA as described in Section 2.4.3 was 48 subjected to the same cycle sequencing analysis as described above with GFPBLAR or NR as the sequencing primer respectively. Table 4. SARS-CoV Replicon sequencing strategy RT-PCR Products 1 2 3 4 5 6 7 8 9 10 11 12 13 RT-PCR Primers Sequencing Primers* T71+F, 2R 3F, SP4251R 04F, A1R 4FX, SAR1R 06F, 06R 5F, 4RX 5FX, SAP2R 6F, 10R SP13639F, 11R 12F, 12R SP17970F, 13R SP19400F, 14R2 BBIBlF, 16R2 T71+F3, 1R, 2R 3R, 02R, SAP1R2, SP4251R 04F, 4F 4FX, SP6081F, SAP1R 06F, SCVD555RP, 06R, SAP2F 5F, 07F, 4RX 5FX, SCVD3709RP, SAP2R, 08R 6F, SP12918F, SP13639F, 09R, 10F, 10R SP15762R, 6R, 11R 12f, SP16769f, 12R SP17970F, SP18680F, 13F,13R SP19400F, 8F, 14F BBIBlF, NFX, SP28384F, 16R2, NR *Refer to Appendix 1 for primer sequences 49 CHAPTER 3 RESULTS 50 3.1 Generation of SARS-CoV replicon RNA The goal of this thesis project was to develop a SARS-CoV replicon-carrying cell line. To achieve this goal, the viral replicon RNA had to be generated first. The design of the viral replicon has been described in Section 2.1. The strategy for the construction of the replicon has been described in Section 2.2.1 and illustrated in Figure 6. Following this strategy, the initial task to accomplish was to assemble the replicon transcription template DNA, ABCGbN. To this end, the B, C and N cDNAs were first generated from the SARS-CoV virion RNA using RT-PCR and Gb DNA was amplified from the plasmid pTracer™-CMV/Bsd using PCR as described in Section 2.2.4. They are shown in Figure 9A lanes 2 to 4. To obtain the assembly intermediate BCGbN DNA, B, C, N and Gb DNAs were digested by the restriction endonuclease Bsa I, gel-purified and ligated together. The result is shown in Figure 9A lane 5. A ligation product with the size close to that expected of BCGbN (12.6 kb) was obtained, but in a small amount. The multi-component ligation was apparently inefficient. One possible contributing factor to the inefficiency of this ligation could be the incomplete Bsa I digestion of the reactant DNAs. Being primer-introduced, most Bsa I recognition sites were occurring very close to the ends of the reactant DNAs. The direct confirmation of digestion at such sites is very tedious and therefore was not done. Even though the Bsa I digestion of the reactant DNAs was carried out for a time much longer than that required to completely digest internal Bsa I sites, the digestion close to the DNA ends could be less efficient and therefore be incomplete. Since the BCGbN DNA obtainable directly from the multicomponent ligation was too small in amount to be used for further DNA assembly, it was amplified to a much larger amount using PCR as described in Section 2.2.5. The result is shown in Figure 9B lane 2. The other component for the assembly of the replicon transcription template was the 13-kb SARS-CoV A cDNA. It was synthesized using RT-PCR as described in Section 2.2.3. As shown in Figure 9B lane 1, its synthesis was quite quantitative. 51 BCGbN Ligation 4 5 10.0kb 8.0kb 6.0kb 5.0kb 4.0kb 3.0kb λ Hind III Markers B, C 3 ABCGbN Ligation N 2 BCGbN Gb 1 A 1kb Ladder A 1 2 3 4 B 23,130 bp C B 9,416 bp 2.5kb 2.0kb 1.5kb 6,557 bp 1.0kb Figure 9. Generation of SARS-CoV replicon transcription template DNA. (A) Multicomponent ligation for the assembly of BCGbN DNA. The DNAs to be ligated (B, C, Gb and N) and the ligation products (BCGbN Ligation) are as indicated. The white arrow indicates the assembled BCGbN DNA (lane 5). A 1-kb DNA ladder (Promega) is shown on lane 1, and the sizes of selected marker bands are indicated on the left. (B) The assembly of ABCGbN DNA. The DNAs to be ligated (A and BCGbN) and the ligation products (ABCGbN Ligation) are as indicated. The arrow indicates the assembled ABCGbN DNA. A λ phage DNA Hind III-digest is shown on lane 4, and the sizes of selected fragments are indicated on the right. The DNAs shown in panels A and B were electrophoresed on 0.8% and 0.5% agarose gels in TBE respectively, stained with 0.5 µg/ml of EtBr and visualized by irradiation with ultraviolet light of 300 nm. 52 To obtain the complete replicon transcription template DNA ABCGbN, A and BCGbN DNAs were digested with the blunt-end-generating restriction endonuclease PshA I, gelpurified, and ligated together. The result is shown in Figure 9B (lane 3). A ligation product with the size expected of ABCGbN (25.6 kb) was obtained, although in a small amount. The inefficiency of this ligation could be due to the fact that it was a blunt-end ligation. Also because of the fact that this was a blunt-end ligation, the desired ABCGbN was not the only ligation product. The undesired A dimers and BCGbN dimers should also be generated through, respectively, the self-ligation of two A DNA molecules at the downstream ends and selfligation of two BCGbN DNA molecules at the B-proximal ends. In the PshA I digestion, only the downstream end of A and the B-proximal end of BCGbN were digested, whereas the other two ends, i.e. the upstream end of A and the N-proximal end of CDGbN, were not. The latter two ends should have 3’-protruding adenosines because they were generated by PCRs using polymerase mixes that contained relatively high levels of non-proof-reading polymerases. Because of this, these two ends should not be involved in ligation and thus other undesired dimers or higher-order ligation products should not be generated. For an in vitro transcription to be successful, the DNA template has to be free from imperfection. If the DNA template has undergone degradative changes, such as nicking and thymidine dimer formation, the transcription on this template will not be able to proceed over the entire length. A large piece of DNA, such as ABCGbN (25.6 kb), is very liable to undergo such degradative changes when it is subjected to manipulations, such as ultraviolet irradiation, centrifugation, and vortexing. Therefore, attempt was not made to remove the unligated DNAs and undesired ligation products from ABCGbN DNA. The total DNA from the above ligation reaction, after an extraction using phenol-chloroform, was used directly as the template in the in vitro transcription for the synthesis of SARS-CoV replicon RNA as described in Section 2.2.7. For a rough quality inspection, an aliquot of the post-transcription mixture was analyzed on a regular (non-denaturing) agarose gel. The result is shown in Figure 10 lane 2. As shown, a 53 1 2 bp 21, 226 5,148 4,268 3,530 2,027 1,904 Figure 10. Generation of SARS-CoV replicon RNA. The products of in vitro transcription for the generation of the replicon RNA is shown on lane 2. Lane 1 shows a λ phage DNA EcoR I and Hind III-digest with the sizes of selected fragments indicated on the left. These nucleic acids were electrophoresed on a 0.5% agarose gels in TBE, stained with 0.5 µg/ml of EtBr and visualized by irradiation with ultraviolet light of 300 nm. large amount of high molecular weight nucleic acid was observed, which formed an intense slow migrating smear on the gel. Since the post-transcription mixture was treated with DNase I and the nucleic acid observed did not have the same electrophoretic mobilities as the input DNA (Figure 9B lane 3), the nucleic acid observed should be the product of transcription – RNA. RNase digestion could be used to confirm the identity of the nucleic acid. It was not used because of the fear of apparatus contamination. The smeary appearance of the RNA could be explained by two reasons. First, the reaction sample was analyzed after the poly-A-tailing 54 reaction, which added variable numbers of adenosine nucleotides to different RNA molecules. The RNA molecules observed should thus indeed have variable sizes. Second, the RNA molecules might form alternative secondary structures with different mobilities on the gel. Although this non-denaturing agarose gel analysis could not show precisely the sizes of the RNA products, it was good enough to show that the RNA products are in a molecular weight range high enough to include the full-length SARS-CoV replicon RNA. Therefore, these RNA products should be good enough to be used to transfect BHK-21 cells for the generation of the desired SARS-CoV replicon cell line. It was expected that only a very small percentage of these RNA products could be full-length functionally active SARS-CoV replicon RNA. The main reason was that the reverse-transcription and PCRs for the generation of the transcription template and the in vitro transcription for the generation of SARS-CoV replicon RNA were relatively error-prone, and therefore only a very low percentage of replicon RNA would not be inactivated by the base substitutions acquired during these processes. Another reason was the presence of significant amount of unwanted DNA in the transcription template preparation as described above. 3.2 Generation and analysis of SARS-CoV replicon-carrying cells To generate SARS-CoV replicon-carrying cells, the in vitro transcription products obtained as described in Section 3.1 was first purified by LiCl precipitation as described in Section 2.2.7 and then used to transfect BHK-21 cells as described in Section 2.3.2. Because of the expectedly low percentage of functionally active replicon RNA, the percentage of cells acquiring functionally active replicon RNA was also expected to be very low. Therefore, the transfected cells were not analyzed for the presence of the replicon immediately. Instead, the transfected cells were first subjected to blasticidin selection as described in Section 2.3.3 to enrich for the replicon-carrying cells. The expression of GFP-BlaR gene from the replicon would render the replicon-carrying cells resistant to blasticidin. After 5 days of blasticidin 55 treatment, a lot of cells had died. Transfected cells in some wells were processed for fluorescence microscopic observation as described in Section 2.4.1.1. In these wells, clusters of green-fluorescent cells could be found. A typical green-fluorescent cell cluster is shown in Figure 11A. As shown, the morphology of the green-fluorescent cells was typical of BHK-21 cells. There was no sign for any cytotoxicity of the SARS-CoV replicon. The transfected cultures were maintained further under blasticidin selection in order to obtain the cells that carried the SARS-CoV replicon consistently. After two weeks of blasticidin selection, practically all non-resistant cells had died and been removed, leaving behind colonies of blasticidin-resistant cells in the wells. A few blasticidin-resistant Figure 11. Green fluorescence from BHK-21 cells transfected by SARS-CoV replicon RNA. (A) Combined green fluorescence and phase-contrast microscopic images of a portion of transfected cell culture after five days of blasticidin treatment, showing a cluster of greenfluorescent cells among non-fluorescent cells. (B) Green fluorescence images of the cells expanded from a blasticidin-resistant cell colony isolated after two weeks of selection and passaged under selection for one additional week. 56 colonies emerged in each of the two transfections done. Several colonies were isolated and expanded in the presence of blasticidin. After one further week of growth, a portion of cells from each colony was examined using fluorescence microscopy. Figure 11B shows the images of cells expanded from one such colony. As can be seen, almost all the cells were fluorescing in green with similar intensities. Thus, it was likely that they were originated from one cell transfected with functional SARS-CoV replicon RNA. The same observation was obtained from and therefore the same conclusion could be drawn for each of the other colonies (data not shown). In Figure 11B, a lot of cells appeared to round up. This was due to the fact that the cells were left in PBS for a prolonged period of time before they were processed for fluorescence microscopy. In culture, they actually showed the typical morphology of BHK-21 cells (data not shown). When the green fluorescence intensities of the cells from different colonies were compared, however, obvious differences could be noticed (data not shown). This could be due to the possibility that different original transfected cells had acquired different copy numbers of functional replicon RNA and thus produced different amounts of GFP-BlaR protein. Two isolates with the highest levels of green fluorescence were selected for further analyses and they were designed BHK-SCR1 and BHK-SCR2 cell lines. The blasticidin resistant and green fluorescent cell lines were first tested for the absence of GFP-BlaR gene DNA. In the in vitro transcription for the synthesis of SARS-CoV replicon RNA, the transcription product was treated with DNase I to remove the template DNA (Section 2.2.7). Despite that, there could still be DNA contamination in the replicon RNA preparation. Should GFP-BlaR gene DNA be present in the RNA preparation, it could entered cells through transfection, integrated into cell chromosomes and was expressed from the integration sites. This would render the cells blasticidin resistant and green fluorescent, just as if they were carrying the replicon RNA. Therefore, to exclude this possibility, the absence of GFP-BlaR gene DNA from the blasticidin-resistant and green fluorescent cells had to be 57 SCR2 4 SCR1 3 IVT SCR2 Ctrl SCR1 2 IVT pGFPblaR 1 Ctrl GAPDH GFP-BlaR 5 6 1.5kb 1.0kb 0.9kb 0.8kb 0.7kb 0.6kb 0.5kb 0.4kb 0.3kb Figure 12. Absence of GFP-BlaR gene DNA in SARS-CoV replicon-carrying cells. As indicated, PCR was carried out to amplify GFP-BlaR or GAPDH gene DNA using GFP-BlaR sequence-containing plasmid DNA (pGFPblaR), BHK-SCR1 (SCR1) or BHK-SCR2 (SCR2) cells as the template. A 100-bp DNA ladder (Promega) is shown on lane 1, and the sizes of selected marker bands are indicated on the left. These DNAs were electrophoresed on a 1% agarose gels in TBE, stained with 0.5 µg/ml of EtBr and visualized by irradiation with ultraviolet light of 300 nm. confirmed. Accordingly, total DNA was isolated from BHK-SCR1 and BHK-SCR2 cells as described in Section 2.4.4.1 after four weeks of growth under blasticidin selection and detected for GFP-BlaR gene DNA using PCR as described in Section 2.4.4.2. As shown in Figure 12 lanes 3 and 4, no GFP-BlaR gene DNA could be amplified from these two cell lines. To check 58 if the lack of product in these reactions was due to inappropriate reaction conditions, a PCR was performed simultaneously using the same reagents except that 1 ng of plasmid DNA containing the GFP-BlaR sequence was used as the template. As shown in Figure 12 lane 2, a large amount of product of the expected size was obtained. This showed that the PCR conditions were appropriate. To check if the degradation of total DNA or the presence of PCR inhibitors in the total DNA preparations was the cause of the failure to amplify GFP-BlaR sequence, these total DNA preparations were used as the templates to amplify the housekeeping gene GAPDH as described in Section 2.4.4.2. As shown in Figure 12 lanes 5 and 6, PCR products of the expected size could be obtained from these DNA preparations, thus ruling out the existence of such problems in the total DNA preparations. Taken together, these PCR results confirmed the absence of GFP-BlaR gene DNA in BHK-SCR1 and BHK-SCR2 cells. Therefore, the most probable explanation for the blasticidin-resistance and green fluorescence of these cells was the expression of GFP-BlaR protein from the SARS-CoV replicon in these cells. This would imply that the replicon RNA had persisted in the cells for three weeks. BHK-SCR1 and -SCR2 cells underwent cell division once every 20 hours. Therefore, they had divided for more than 25 times and their numbers had increased more than 30 million folds in three weeks. The persistence of SARS-CoV replicon in these cells for this duration underlines the capability of the replicon to replicate in these cells. Next, the presence of the SARS-CoV replicon in BHK-SCR1 and -SCR2 cells was studied directly by the use of Northern blot analysis. Thus, total RNA was isolated from these cells after four weeks of growth under blasticidin selection and then analyzed as described in Section 2.4.2. The SARS-CoV replicon, if functional, should undergo coronavirus-specific discontinuous transcription inside the cells and lead to the production of three sub-replicon RNAs, namely L-Gb-8-N, L-8-N and L-N, as depicted in Figure 7. The results of the Northern blot analysis are shown in Figure 13. As expected, the replicon and all the three sub-replicon 59 ) ) 1) ) 1) 10 0) 10 (1 -1 ( -2 ( (1 - 1 ( -2 ( A K N K R R R CR R BH S C S C B H SC N S 0) 0) 1) ) 1) 0) (1 2 (1 A (1 -1 ( -2 ( 1 ( 1 K N R R K R CR R BH SC SC N S BH SC RNA(kb) 24.6kb replicon 28S rRNA 3.2kb L-Gb-8-N 2.0kb L-8-N 18S rRNA 1.6kb L-N Long expo. Short expo. Figure 13. Presence of SARS-CoV replicon and sub-replicon RNAs in replicon-carrying cells at detected by northern blot analysis. Total RNA preparations from BHK-21 (BHK), BHKSCR1 (SCR1) and BHK-SCR2 (SCR2) cells, and an RNA containing SARS-CoV N gene sequence generated in vitro as described in Section 2.4.2.2 (N RNA) were analyzed as indicated. Each total RNA preparation was analyzed in two amounts, 10µg and 1µg, as indicated. Images from two durations of blot exposure, 15 minutes (long expo) and 1 minute (short expo), are shown. The positions of 28S and 18S rRNAs from the total cell RNA preparation, noted from the gel after electrophoresis and EtBr-staining, are indicated on the right. The bands corresponding to the replicon and the expected sub-replicon RNAs (L-Gb-8-N, L-8-N & L-N), are identified based on their electrophoretic mobility relative to those of N RNA, 28S and 18S rRNAs. The bands corresponding to unexpected sub-replicon RNAs, observable on 15-minute blot exposure, are indicated with asterisks. 60 RNAs could be identified from the blot. In cells infected by SARS-CoV or any other coronaviruses, the sub-genomic RNA for N gene translation is much more abundant than the genomic RNA (Thiel et al., 2003a). Accordingly, in the SARS-CoV replicon-carrying cells, the abundance of the sub-replicon RNA for N gene translation (L-N) was much higher than that of the replicon RNA (Figure 13). The abundance of the sub-replicon RNA for GFP-BlaR gene translation (L-Gb-8-N) was higher than that of the replicon RNA but much lower than that of L-N (Figure 13). This intermediate abundance of L-Gb-8-N was also expected because the production of L-Gb-8-N was controlled by the transcription regulatory signal for the production of SARS-CoV S gene-translating sub-genomic RNA, and it was known that, in SARS-CoV-infected cells, the abundance of this sub-genomic RNA is intermediate between that of the genomic RNA and that of the N gene-translating sub-genomic RNA (Thiel et al., 2003a). The abundance of the sub-replicon RNA for ORF 8 translation (L-8-N), however, was unexpected high, even higher than that of L-N (Figure 13). In SARS-CoV-infected cells, the sub-genomic RNA for ORF 8 translation is much lower than that of the sub-genomic RNA for N gene translation (Thiel et al., 2003a). The reason for this unexpectedly high abundance of L8-N was not known at this point. It was shown that the abundance of a sub-genomic RNA could be affected by the genomic sequence more than 100-nt upstream of the body sequence of the sub-genomic RNA (Alonso et al., 2002; Jeong et al., 1996). In the SARS-CoV replicon, the GFP-BlaR gene sequence was inserted at about 50-nt upstream of the transcription regulatory core sequence for ORF 8. Therefore, it was likely that a part of GFP-BlaR gene sequence somehow enhanced the abundance of L-8-N. Two additional sub-replicon RNAs with sizes larger than that of L-Gb-8-N could be observed on long exposure to the blot (Figure 13, indicated by asterisks). They were of very low levels and unknown origin. Overall, this Northern blot analysis showed that the SARS-CoV replicon and sub-replicon RNAs were present in the cells four weeks after the initial introduction of the replicon RNA into the cells. During this period of time, the cells had divided for more than 33 times. Thus, it was clear that 61 the SARS-CoV replicon could replicate efficiently in the cells and it did not show negative effect on cell growth. Together with the data presented above showing the absence of GFPBlaR DNA in these replicon-carrying cells, it can be concluded that the blasticidin-resistance and green fluorescence of these cells were caused by the presence of the replicon in these cells. The SARS-CoV replicon RNA was initially generated from the virus genomic RNA through reverse transcription, repeated PCRs, followed by in vitro transcription using T7 RNA polymerase. All these reactions are quite error-prone. The viral sequences included in the replicon were very large – altogether about 23.5 kb. Therefore, it was likely that most of the replicon RNA molecules generated in this way carried some base alterations from the wildtype virus genomic RNA. During the intracellular propagation of the replicon, base alterations that are inhibitory to replicon RNA replication should be selected against. On the other hand, it is possible that some base alterations from the wild-type viral sequence enable better adaptation to persistent RNA replication in growing cells and they are selected for. Therefore, the sequence of the replicon obtained after prolonged intracellular propagation could reveal base alterations that are permissible for or promoting replicon RNA replication and persistence. To obtain the sequence of the persistent SARS-CoV replicon, overlapping cDNAs encompassing the entire replicon were generated from the total RNA of BHK-SCR2 cells after one month of cell growth and their sequences were obtained as described in Section 2.4.5. The sequences thus obtained were compared with the wild-type SARS-CoV SIN2774 strain sequence. It was found that the persistent replicon contained no base alteration from the wildtype virus sequence (data not shown). Since most of the replicon RNA molecules initially introduced into the cells were expected to contain base alterations whereas base alteration was absent from the persisting replicon, it is likely that all the wild-type viral sequences included in the replicon are essential for replicon RNA replication and persistence. However, since it has not been directly shown that the replicon RNA initially introduced into the cells actually carried base alterations, firm conclusion cannot be drawn. 62 The essential sub-replicon RNAs, L-Gb-8-N and L-N, that are translated to produce GFP-BlaR and N proteins respectively, were shown to be present in the BHK-SCR1 and SCR2 cells using Northern blot analysis as described above. They were identified based on their electrophoretic mobilities relative to those of RNAs with known sizes. Another way to show the presence of a SARS-CoV sub-replicon RNA is to detect for the joint between the viral 5’-leader and the corresponding body gene in the sub-replicon RNA. Thus, to show the presence of L-Gb-8-N and L-N in BHK-SCR12 cells using this approach, RT-PCRs were first performed as described in Section 2.4.3 to obtain the cDNAs containing the corresponding leader-body joints. As shown in Figure 14, these cDNAs were amplified from the total RNA of BHK-SCR2 cells but not from that of BHK-21 cells, as expected. From the same amount of BHK-SCR2 total RNA, the amount of L-N joint-containing cDNA obtained was much higher than that of L-Gb joint-containing cDNA. This was in keeping with the relative abundance of L-N and L-Gb-8-N sub-replicon RNAs as detected using Northern blot analysis described above. To reveal the precise locations of the leader-body joints, the cDNAs thus obtained were then sequenced as described in Section 2.4.5. As shown in Figure 15, the core sequence of SARS-CoV transcription regulatory signal occurred at the junction between the leader and the body in each sub-replicon RNA. This strongly suggests that the sub-replicon RNAs are generated through the coronavirus-specific discontinuous transcription mechanism and implies that the SARS-CoV RNA replication machinery is fully functional in the replicon-carrying cells. When a replicon-carrying cell is allowed to grow continuously, the average replicon copy number per cell as well as the percentage of cells carrying the replicon will decrease with increasing generation number if the multiplication rate of the replicon is lower than that of the cell. However, if the cells are kept in a medium selective for the presence of replicon, there will be an apparent gradual decrease in cell growth rate because the cells having lost the replicon will cease to grow. Therefore, the growth rate of a replicon-carrying cell line in the 63 SCR Ctrl SCR 1 2 3 4 Ctrl L N L G 5 1.5kb 1.0kb 0.9kb 0.8kb 0.7kb 0.6kb 0.5kb 0.4kb Figure 14. Amplification of sub-replicon RNA regions encompassing leader-body joints by RT-PCRs. As indicated, the joint between the leader and GFP-BlaR gene (L-Gb) or that between the leader and N gene (L-N) was to be amplified from the total RNA of BHK-21 (Ctrl) or BHK-SCR2 (SCR) cells. A 100-bp DNA ladder (Promega) is shown on lane 1, and the sizes of selected marker bands are indicated on the left. These DNAs were electrophoresed on a 1% agarose gels in TBE, stained with 0.5 µg/ml of EtBr and visualized by irradiation with ultraviolet light of 300 nm. The expected sizes of L-Gb- and L-N-containing RT-PCR products are approximately 300 bp and 600 bp respectively. The appropriate products are indicated with arrows. 64 A GFP-BlaR TRS Leader Reverse complement sequences B N TRS Leader Reverse complement sequences Figure 15. Sequences of leader-body joints in SARS-CoV sub-replicon RNAs. (A) L-Gb-8-N. (B) L-N. Shown are the sequences of the reverse complement of (or negative-sense) subreplicon RNAs. The core sequence of SARS-CoV transcription regulatory signal (GTTCGT in reverse complement) is boxed as indicated as TRS. The sequences of the SARS-CoV 5’-leader (Leader), N and GFP-BlaR genes are also identified. 65 selective medium is an indication of how efficiently the replicon can persist in the cells. Throughout the 6 weeks for which the BHK-SCR1 and -SCR2 cultures were maintained under blasticidin selection, their growth rates were consistent and practically identical. Their doubling time was about 20 hours, which was slightly longer than the doubling time (18 hours) of the parent BHK-21 culture. Thus, the SARS-CoV replicon appeared to persist efficiently in the cells and the replicon-carrying cell lines were quite stable. The persistence efficiency of SARS-CoV replicon in the cells was also studied by monitoring the GFP-BlaR gene expression levels in these cells using flow cytometry. As shown in Figure 16, the average green fluorescence intensity value of BHK-SCR2 culture was about 60 at the end of the third week of cell growth but dropped substantially to about 15 by the end of the sixth week. The average green fluorescence intensity value of BHK-SCR2 culture at the end of the sixth week were in excess of that of the parent BHK-21 culture (about 4, Figure 16B), indicating that there was still GFP-BlaR gene expression in BHK-SCR2 cells. The green fluorescence of the SARS-CoV replicon-carrying cells was also observed at different culture times using fluorescence microscopy. Consistent with the flow cytometry data, the green fluorescence of the BHK-SCR2 cells noticeably decreased from week 3 to week 6 (data not shown). At week 6, it was difficult to record the green fluorescent cell images because of the low fluorescence intensity. The substantial decrease in green fluorescence intensity of BHK-SCR2 cells in three weeks of cell growth indicates the corresponding change in the intracellular replicon copy number. Thus, this analysis shows that the SARS-CoV replicon does not persist very efficiently in the cells, in contrast to the conclusion drawn from the observation of cell growth rate under selection. The ability of BHK-SCR2 cells to grow consistently under selection for 6 weeks was most likely due to the possibility that the levels of GFP-BlaR protein in most cells during this period of time were still high enough to confer blasticidin resistance on the cells, even though they were decreasing. From the flow cytometry analysis, it is expected that the cells will lose the SARS-CoV replicon eventually and therefore 66 the SARS-CoV replicon-carrying cell lines are not permanent. Nevertheless, they can persist for substantial periods of time and could be good enough to be used for the anti-SARS drug screening purpose. Figure 16. Green fluorescence levels of SARS-CoV replicon-carrying cells at different culture times as detected by flow cytometry. Samples of BHK-SCR2 (SCR2) cells were analyzed after 3 weeks (A) and 6 weeks (B) of growth under blasticidin selection. Samples of the parent BHK-21 (BHK) cells were co-analyzed. The results are presented as histograms with green fluorescence intensity in exponential scale (horizontal axis) against cell number in linear scale (vertical axis). 67 CHAPTER 4 DISCUSSION 68 In order to provide a convenient and safe system to test potential SARS-CoV inhibitors that display antiviral activity against cellular and viral targets involved in viral RNA synthesis, including proteases, RNA-dependent RNA polymerase, NTPase/helicase and various putative functions that have been identified recently (i.e. poly(U)-specific endonuclease, ExoN, S-adenosylmethionine-dependent ribose 2’-O-methyltransferase, adenosine diphosphate–ribose 1’’-phosphatase and cyclic phosphodiesterase) (Thiel V, et al., 2003a), we have established a new strategy that is based on the use of replicon generated by reverse genetic technique. The replicon has been designed by the introduction of the blasticidin-resistance and GFP fusion gene ownstream of ORF 1 and deletion of most structural genes. This strategy enabled us to select for cell lines containing SARS-CoV-derived, autonomously replicating RNAs that mediate the expression of GFP as a marker for SARSCoV replication. We report here the generation and analysis of the first selectable, SARS-CoV based replicon cell line. The SARS-CoV replicon cell line we described here will be a valuable tool for the development of anti-SARS therapeutics. Within the past fifteen years, the concept of autonomously replicating RNAs (replicon RNAs) has been applied in a number of positive-strand RNA virus systems and has led to the establishment of novel antiviral screening assays (Bartenschlager, 2002; Frolov et al., 1996; Khromykh, 2000; Lo et al., 2003; Randall et al., 2001). Stable cell lines containing noncytopathic, selectable replicon RNAs are currently used to assess the efficacy of candidate inhibitors of viruses that cannot be propagated efficiently in tissue culture, such as hepatitis C virus (Bartenschlager, 2002; Randall et al., 2001). Moreover, since no structural genes and, therefore, no infectious viruses are formed, replicon-based assays represent an attractive tool for the identification of antivirals if the biosafety of the virus, such as SARS-CoV, is a big concern. Our initial ideas to generate a selectable SARS-CoV replicon RNA were based on the reports that, as for many positive-strand RNA viruses, only the ORF 1 and the 5’- and 3’- 69 genomic termini are needed for autonomous synthesis of the viral genomic RNA. It was demonstrated that the ORF 1 products suffice for arterivirus RNA synthesis (Molenkamp et al., 2000) and sub-genomic RNA synthesis of human coronavirus 229E (Thiel et al., 2001). Also some studies (Thiel et al., 2001, 2003b; Almazan et al., 2004; Hertzig et al., 2004) demonstrated that the nucleocapsid (N) protein is required for efficient coronavirus genomic RNA synthesis. Therefore, this observation has been included in our strategy to establish selectable SARS-CoV replicon RNAs. In order to provide a selectable marker gene, we chose to use the blasticidin-resistance gene, which has been proven as a functional selection marker in screening the blasticidin-resistant stable mammalian cell lines. In addition, the viral gene expression in the replicon cell line should be made easily detectable in order to facilitate the identification of anti-viral agents. For this purpose, a reporter gene should be included into the viral replicon. Thus, the potency of an antiviral agent can be assessed based on its efficiency in inhibiting the reporter gene expression from the replicon cell line. The green fluorescence protein (GFP) gene has been used for this purpose for many years and should be applicable in our replicon. Taken together, a SARS-CoV replicon suitable for use in the identification of anti-viral agents should be a wild-type viral genome having the S, E and M genes replaced by an antibiotic-selectable gene and a reporter gene. To enable the formation of the sub-replicon RNA specific for the translation of each gene on the viral replicon, the TRS will be added or retained upstream of each gene and downstream of ORF 1. The overall structure of the SARSCoV derived replicon RNA is illustrated in Figure 6. The large size of SARS-CoV genome presented huge obstacles to constructing the replicon. First, long RNA sequences make the synthesis of a faithful cDNA molecule difficult, because the yield and fidelity of reverse transcriptase and thermophilic DNA polymerases for the amplification of cDNA inevitably decreases in proportion to the RNA length. For the SARS-CoV replicon to be functional, there cannot be even a single nucleotide deletion or insertion in the entire 21-kb ORF 1. Neither is base alteration tolerated in most positions in 70 ORF 1. Second, long RNA sequences are more likely to contain sequences toxic to bacterial cells, which make the cDNA sequence in plasmids unstable. It was reported that some sequences in ORF 1 of a typical coronavirus are very “toxic” to bacterial cells and therefore cannot be cloned at a high copy number (Lai & Holmes, 2001). Also it is difficult to find a suitable vector that can accommodate large foreign cDNA inserts. The first difficulty has been overcome largely by the appropriate choice of reagents and fine-tuning of RT-PCR procedures. The availability of high fidelity reverse transcriptase and thermophilic DNA polymerases has significantly decreased the error rate of RT-PCR. In our experiments, the high fidelity Superscript III reverse transcriptase and Elongase Polymerase or TripleMaster PCR System were used to minimize the mutations produced in the amplification. Our results showed that Superscript III reverse transcriptase can synthesize firststrand cDNAs of up to 21 kb in sufficient amounts and with good quality. These cDNAs can be used as the template to amplify 13 kb PCR products by Elongase Polymerase or TripleMaster PCR System. However, to achieve this goal, a number of critical parameters have to be kept in mind. First, the integrity of the RNA template is important. Depending on the source of the RNA template, a method of preparation should be chosen that minimizes degradation of the RNA. Second, the conditions of the reverse transcription reaction influence the outcome of the subsequent PCR. Previous studies have shown that amplification of long RNAs requires digestion of the RNA with RNaseH after the first-strand cDNA synthesis (Nathan et al., 1995). Therefore, this reaction was included in our procedure. Third, as is the case for all PCRs, the cycle conditions have to be optimized according to the amount of template, the PCR primers, and the cycle profile. Last but not the least, the polymerase plays critical role in our long range PCR reaction. In our experiments, we tested most of the longrange PCR polymerases which are commercial available, only TripleMaster PCR System could amplify the first half 13 kb of SARS-CoV genome efficiently and specifically. Also Elongase 71 Polymerase was used to amplify the remaining 12.6 kb recombinant BCGbN replicon cDNA because of its good yield and relatively cheap price. The second difficulty is that the viral cDNA contains sequences toxic to bacterial cells and thus prevents its cloning. Solutions to the poison sequence problems have been made previously. For example, the cDNA copy of yellow fever virus RNA could not be cloned in one piece; therefore, it was cloned in two segments and then ligated in vitro to make a fulllength cDNA for in vitro transcription (Rice et al., 1989). Thus, the passage of poison sequences in bacteria was avoided. This approach has been adopted for the rapid cloning of some important coronaviruses, for example, MHV, TGEV and SARS-CoV (Yount et al., 2000; Yount et al., 2002; Yount et al., 2003). We have been trying to use this method to assemble SARS-CoV replicon cDNA. A number of regions in SARS-CoV genome were found to be toxic to E. coli strains that are regularly used for DNA cloning (data not shown). This sequence toxicity was circumvented by disruption of toxic domains and the use of tolerant bacterial strains. We have got cDNA clones that cover the whole SARS-CoV genome. Inevitably, there are numerous base alterations in those clones. We are in the process of reverting the base alterations in these clones. Once this process is completed, the cloned cDNAs can be used to assemble the SARS-CoV replicon. Recently, the successful use of the single-copy bacterial artificial chromosome (BAC) vector to clone the entire coronavirus genomic cDNA has been reported (Almazan et al., 2000). We also tried this method but it did not work. All the clones that we have obtained had random deletions in different regions and none of them contained the full-length replicon cDNA. Realizing the potential difficulties and tardiness in cloning SARS-CoV sequences, we decided to simultaneously embark on a “quick and dirty” approach that avoids cloning altogether – assembling the SARS-CoV cDNAs directly. This method is “dirty” because a large proportion of replicon thus produced should carry base alterations. However, we reasoned that as long as there are a minute number of functional replicon molecules, the host cells carrying them can be selected for and amplified based on the 72 antibiotic-resistance conferred by the replicon. For this purpose, substantial amount (tens of micrograms) of SARS-CoV replicon cDNA was needed to generate the viral replicon cell line. To generate such a large amount of cDNA with as few mutations as possible, it is necessary to minimize the rounds of PCR and maximize the yield of PCR product. From our experiences, it is critical to use at least 10 µg of “dirty” replicon RNA preparation (Figure 10 and its description in the text) to transfect BHK-21 cells in one well of a standard 6-well plate. Otherwise no positive colonies could be selected out. After transfection and around two weeks’ selection, a few colonies grew up and SARS-CoV-derived replicon cell lines were created successfully. A weakness of our “quick and dirty” approach is that it is relatively expensive. Replicon cDNAs have to be synthesized in a large amount and are consumed with use. However, this strategy is the fastest way to assemble large genes and genomes of any RNA or DNA virus. For any newly emerging viral pathogens, effective biodefense and control requires rapid response. Time, rather than money, is the biggest concern. Therefore, our strategy is very suitable for combating newly emerging RNA or DNA viral pathogens. Another weakness of our replicon cell-based system is that the structural genes S, E and M are not included in the replicon RNA. Therefore, it cannot be used to screen for drugs that act on cellular and viral targets involved in receptor binding, virus entry, genome encapsulation and virus release. However, this weakness may not be significant because the structural genes of coronavirus change rapidly and therefore anti-viral agents that target these genes may have less consistent efficacy. On the other hand, ORF 1 is the most conserved region in coronavirus genome and therefore the most consistent and favorable targets of antiviral agents (Holmes et al., 2003a). Our established SARS-CoV replicon cell line could be used to test potential SARSCoV ORF 1 inhibitors. A biochemical agent that inhibits viral RNA synthesis, translation or proteolytic processing of viral proteins will suppress the expression of the reporter gene in the 73 replicon cells. With an easily detectable GFP expression and the absence of virion production, the viral replicon cell line represents a simpler and safer system for anti-viral agent identification than a live virus infection system. Thus, the efficacy of candidate inhibitors can be evaluated by measuring the fluorescence intensity of the replicon cells before and after the adding of the drugs. That means our cell-based system is easy to be automated and used in the large-scale screening of anti-SARS-CoV agents. Furthermore, the application of the viral replicon cell-based system can be used to test individual antiviral agents designed based on certain biochemical principles or the drugs targeting at multiple regions of the SARS-CoV ORF 1 or N gene. Since no infectious virus is formed, the assay represents a safe protocol that can be performed in biosafety level 2 laboratories. Compared to anti-viral agent identification systems based on purified proteins or nucleic acids, our SARS-CoV replicon cell line has two advantages: first, if a candidate inhibitor can inhibit the replication of our replicon RNA, which occurs inside the replicon cells, it also means that this agent can enter into the cell; second, the cytotoxicity of a candidate inhibitor can be observed simultaneously by viewing the cell morphology directly. Two critical indexes of a candidate inhibitor – the inhibitory effect and the cytotoxicity can therefore be observed all at once using our SARS-CoV replicon cell line. For an anti-viral agent identified using a purified-bimolecular-based system, further tests on cell delivery and cytotoxicity of the agent have to be done separately. Our SARS-CoV replicon could be used as a vector for heterologous gene expression. The unique transcriptional strategy of coronaviruses makes them promising candidates for the development of versatile multigene RNA vectors (Bredenbeek et al., 1992; Enjuanes et al., 2001). First, the expression of heterologous genes can be achieved in the context of the coronavirus genome, a helper-dependent minigenome or an autonomous replicating subgenomic RNA. In each case, it has been shown that it is possible to insert a transcriptional cassette (which is comprised of a TRS element located upstream of an ORF of interest) and 74 that transcriptional functions provided in trans are able to mediate the synthesis of a subgenomic RNA encoding the protein of interest (Alonso et al., 2002; Curtis et al., 2002; Fischer et al., 1997). We have constructed a SARS-CoV replicon RNA that simultaneously mediates the expression of one reporter protein and one structural protein. This indicates that our SARSCoV replicon should provide a vector system for the incorporation and expression of one or more foreign genes. Second, the size of the coronavirus RNA genome implies a large cloning capacity for the insertion of heterologous genes. In theory, about one-third of the SARS-CoV genome, or around 9 kb, could be replaced by one or more foreign genes. Third, although we do not yet fully understand the parameters that govern TRS element activity, it is clear that different TRS elements, or modified TRS elements, could be used to regulate the levels of heterologous gene expression. Thus, it appears that coronavirus-based vector systems might be useful for the simultaneous, differential expression of multiple genes. Our Northern blot results showed that the abundance of the sub-replicon RNA for ORF 8 translation (L-8-N) was unexpected high, even higher than that of L-N, in the replicon-carrying cells (Figure 13). The relative abundance of the sub-genomic RNA for ORF 8 translation is much lower in SARSCoV-infected cells (Thiel et al, 2003a). Thus, the deletion of SARS-CoV genomic sequence and/or the inclusion of GFP-BlaR gene sequence between ORFs 1 and 8 somehow induces the synthesis of L-8-N sub-replicon RNA. ORF 8 is not essential for replicon RNA synthesis. Our replicon may therefore be used as a high-level gene expression vector if a foreign gene is inserted in place of ORF 8. As shown in Figure 16, the expression levels of the GFP-BlaR reporter gene in the current replicon cell lines may be somewhat too low to be used for antiSARS drug identification. For such a drug identification purpose, an improved replicon can be constructed by the inclusion of an additional reporter gene in place of ORF 8 in the current replicon. Fourth, RNA replicon expression systems based on positive-strand RNA viruses have an advantage comparing with DNA vector: the synthesis of the RNA takes place in the 75 cytoplasm without a DNA intermediary, excluding the possibility of an inadvertent chromosomal integration of foreign genetic material. We have successfully inserted and expressed GFP-BlaR gene from the SARS-CoV associated replicon, demonstrating the feasibility of using SARS-CoV based replicon vectors for heterologous gene expression. Efficient synthesis of recombinant replicon RNA in the cell was demonstrated by GFP expression, the presence of leader-containing sub-replicon RNA, and the blasticidin resistance of the replicon cell lines. Our data demonstrated that BHK-21 cells carrying the replicon were able to survive and maintain expression of foreign genes for more than one month. Cell lines carrying the replicon underwent cell division at a rate similar to that of the parent cell line indicating that the replicon causes little disturbance of fundamental host cell functions. Thus the replicon might be considered for applications where long-term expression and prolonged survival of the host cells are required. Taken together, the efficient replicon RNA synthesis, absence of cytotoxicity, and expression of an antibiotic resistance gene allowing simple and efficient selection of replicon-expressing cells make our replicon a unique and useful addition to existing RNA virus expression systems. The study of replicons has greatly enhanced the understanding of RNA synthesis of members of the coronavirus family. The reporter gene activity of a coronavirus replicon is translated from both the RNA transfected into cells and the progeny molecules produced by RNA synthesis. Therefore, the use of replicons allows the study of both virus RNA synthesis and translation, two steps in the virus life-cycle tightly coordinated in vivo in space and time. Characterization of individual gene functions involved in coronavirus RNA synthesis is still at a very early stage. Therefore, our replicon design, replicon template synthesis and assembly protocols, and replicon-carrying cell line selection protocol enable us to study the involvement of individual trans-acting ORF 1 domains and cis-acting elements in RNA synthesis. Also the SARS-CoV replicon provides a tool for exploring the possible functions of some unknown genes by serially deleting certain genes or intentionally introducing mutations at certain 76 positions or introducing random mutations and finding out which occur in persisting replicons. It has been reported that the TRSs of TGEV genes are essential for mediating a 100- to 1,000fold increase in sub-genomic RNA synthesis when it is located in the appropriate context (Alonso et al., 2002). Our SARS-CoV replicon could be used in studying the extent of the TRSs in regulating the expression of sub-replicon RNAs. To this end, mutagenesis studies at the TRS region upstream of ORF 8 in the replicon could be performed to define the sequences that cause high expression of L-8-N sub-replicon RNA. Our SARS-CoV replicon cell line can also be used to study the development of drug resistance in the virus. Because of the low fidelity of viral RdRp, coronavirus replicon is undergoing mutation all the time in the cell, as reported recently (Hertzig et al., 2004). It is suggested that these observed nucleotide changes in the replicon may represent adaptive mutations necessary for continuous replication in selected cell lines (Hertzig et al., 2004). So, once an efficient inhibitor of replicon persistence is identified, the replicon cell line can be used further to select for rare cells that are resistant to the identified inhibitor. The replicon RNA can be isolated from the resistant cells and sequenced to identify the marker mutations related to drug resistance. The detection of such mutations would provide valuable information on the viral target protein(s) and the mechanism of inhibition. The functions of certain viral genomic domains can also be elucidated from this kind of analysis. In conclusion, this study describes the first replicon system for a highly pathogenic SARS-CoV and a rapid protocol for developing this system. The replicon system provides a convenient and safe assay for the identification of anti-SARS-CoV agents. The protocols and reagents developed in this study will be useful for gaining insights into the mechanisms of RNA synthesis of this pathogen. Potential additional applications include the development of RNA vaccines against SARS-CoV and RNA vectors for long-term gene expression. 77 REFERENCES Almazan F, Galan C, Enjuanes L. 2004. The nucleoprotein is required for efficient coronavirus genome replication. J. Virol. 78: 12683-12688. Almazan F, Gonzalez JM, Penzes Z, Izeta A, Calvo E, Plana-Duran J, Enjuanes L. 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 97: 5516-5521. Alonso S, Izeta A, Sola I, Enjuanes L. 2002. Transcription Regulatory sequences and mRNA expression levels in the coronavirus transmissible gastroenteritis virus. J. Virol. 76: 1293-1308. Anand K, Ziebuhr J, Wadhwani P, Mesters JR, Hilgenfeld R. 2003. Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs. Science 300: 1763-1767. Bartenschlager R. 2002. Hepatitis C virus replicons: potential role for drug development. Nat . Rev. Drug. Discov. 1: 911-916. Baudoux P, Carrat C, Besnardeau L, Charley B, Laude H. 1998. Coronavirus pseudoparticles formed with recombinant M and E proteins induce alpha interferon synthesis by leukocytes. J. Virol. 72: 8636– 8643. Behrens SE, Grassmann CW, Thiel HJ, Meyers G, Tautz N. 1998. Characterization of an autonomous subgenomic pestivirus RNA replicon. J. Virol. 72: 2364-2372. Berger A, Drosten HW, Doerr M, Stürmer W. 2004. Severe acute respiratory syndrome (SARS)—paradigm of an emerging viral infection. J. Clin. Virol. 29: 13-22 Bisht H, Roberts A, Vogel L, Bukreyev A, Collins PL, Murphy BR, Subbarao K, Moss B. 2004. Severe acute respiratory syndrome coronavirus spike protein expressed by attenuated vaccinia virus protectively immunizes mice. Proc. Natl. Acad. Sci. USA 101: 6641–6646. Booth CM, Matukas LM, Tomlinson GA, Rachlis AR, Rose DB, Dwosh HA. 2003. Clinical features and short-term outcomes of 144 patients with SARS in the greater Toronto area. J. A. M. A. 289: 2801–2809. Bos EC, Luytjes W, Van der Meulen HV, Koerten HK, Spaan WJ. 1996. The production of recombinant infectious DI-particles of a murine coronavirus in the absence of helper virus. Virology 218: 52–60. Bosch BJ, Martina BE, van Der Zee R, Lepault J, Haijema BJ, Versluis C, Heck AJ, De Groot R, Osterhaus AD, Rottier PJ. 2004. Severe acute respiratory syndrome coronavirus (SARSCoV) infection inhibition using spike protein heptad repeat-derived peptides. Proc. Natl. Acad. Sci. USA 101: 8455–8460. Bosch BJ, van der Zee R, de Haan CA, Rottier PJ. 2003. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J. Virol. 77: 8801–8811. 78 Bost AG, Carnahan RH, Lu XT, Denison MR. 2000. Four proteins processed from the replicase gene polyprotein of mouse hepatitis virus colocalize in the cell periphery and adjacent to sites of virion assembly. J. Virol. 74: 3379–3387. Boursnell MEG, Brown TDK, Foulds IJ. 1987. Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus. J. Gen. Virol. 68: 57-77 Bredenbeek PJ, Rice CM. 1992. Animal RNA virus expression systems. Semin. Virol. 3: 297-310. Breiman RF, Evans MR, Preiser W, Maguire J, Schnur A. 2003. Role of China in the Quest to Define and Control Severe Acute Respiratory Syndrome. Emerg. Infect. Dis. 9: 1037–1041. Brockway SM, Clay CT, Lu XT, Denison MR. 2003. Characterization of the expression, intracellular localization, and replication complex association of the putative mouse hepatitis virus RNA-dependent RNA polymerase. J. Virol. 77: 10515–10527. Buchholz UJ, Bukreyev A, Yang L, Lamirande EW, Murphy BR, Subbarao K, Collins PL, 2004. Contributions of the structural proteins of severe acute respiratory syndrome coronavirus to protective immunity. Proc. Natl. Acad. Sci. USA 101: 9804–9809. Bukreyev A, Lamirande EW, Buchholz UJ, Vogel LN, Elkins WR, St Claire M, Murphy BR, Subbarao K, Collins PL. 2004. Mucosal immunisation of African green monkeys (Cercopithecus aethiops) with an attenuated parainfluenza virus expressing the SARS coronavirus spike protein for the prevention of SARS. Lancet 363: 2122–2127. Campanacci V, Egloff MP, Longhi S, Ferron F, Rancurel C, Salomoni A, Durousseau C, Tocque F, Bremond N, Dobbe JC, Snijder EJ, Canard B, Cambillau C. 2003. Structural genomics of the SARS coronavirus: cloning, expression, crystallization and preliminary crystallographic study of the Nsp9 protein. Acta. Crystallogr. D. Biol. Crystallogr. 59: 1628– 1631. Carroll SS, Tomassini JE, Bosserman M, Getty K, Stahlhut MW, Eldrup AB, Bhat B, Hall D, Simcoe AL, LaFemina R, Rutkowski CA, Wolanski B, Yang Z, Migliaccio G, De Francesco R, Kuo LC, MacCoss M, Olsen DB. 2003. Inhibition of hepatitis C virus RNA replication by 2'modified nucleoside analogs. J. Biol. Chem. 278:11979-11984. Cavabagh D, Brian DA, Brinton MA. 1995. Virus taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses. Vienna: Springer-Verlag 1995: 407-411 Centers for Disease Control and Prevention. 2003. Update: Outbreak of severe acute respiratory syndrome–worldwide. 52: 241–248. Chan YM, Seto WH, Sung JJ. 2003a. Severe acute respiratory syndrome: patients were epidemiologically linked. B. M. J. 326: 1393. Chan YM, Yu WC. 2003b. Outbreak of severe acute respiratory syndrome in Hong Kong special administrative region: case report. B. M. J. 326: 850–852. Chang SH, Bae JL, Kang TJ, Kim J, Chung GH, Lim CW, Laude H, Yang MS, Jang YS. 2002. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol. Cells 14: 295– 299. 79 Chang MS, Lu YT, Ho ST, Wu CC, Wei TY, Chen CJ, Hsu YT, Chu PC, Chen CH, Chu JM, Jan YL, Hung CC, Fan CC, Yang YC. 2004. Antibody detection of SARS-CoV spike and nucleocapsid protein. Biochem. Biophys. Res. Commun. 314: 931–936. Cheung CY, Poon LL, Lau, AS, Luk W. 2002. Induction of proinflammatory cytokines in human macrophages by influenza A (H5N1) viruses: a mechanism for the unusual severity of human disease. Lancet 360: 1831–1837. Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. 2003a. Glycyrrhizin, an active component of liquorice roots, and replication of SARS-associated coronavirus. Lancet 361:2045–2046. Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. 2003b. Treatment of SARS with human interferons. Lancet 362:293–294. Collins AR. 1998. Human macrophages are susceptible to coronavirus OC43. Adv. Exp. Med. Biol. 440: 635–639. Collins AR, Knobler RL, Powell H, Buchmeier MJ. 1982. Monoclonal antibodies to murine hepatitis virus-4 (strain JHM) define the viral glycoprotein responsible for attachment and cell– cell fusion. Virology 119: 358–371. Corse E, Machamer CE. 2000. Infectious bronchitis virus E Protein is targeted to the Golgi complex and directs release of virus-like particles. J. Virol. 74: 4319–4326. Curtis KM, Yount B, Baric RS. 2002. Heterologous gene expression from transmissible gastroenteritis virus replicon particles. J. Virol. 76: 1422-1434. Daniel C, Talbot PJ. 1990. Protection from lethal coronavirus infection by affinity-purified spike glycoprotein of murine hepatitis virus, strain A59. Virology 174: 87–94. De Groot RJ, Luytjes W, Horzinek MC, van der Zeijst BA, Spaan WJ. 1987. Evidence for a coiled-coil structure in the spike proteins of coronaviruses. J. Mol. Biol. 196: 963–966. Delmas B, Laude H. 1990. Assembly of coronavirus spike protein into trimers and its role in epitope expression. J. Virol. 64: 5367–5375. Donnelly CA, Ghani AC, Leung GM, Hedley AJ, Fraser C, Riley S. 2003. Epidemiological determinants of spread of causal agent of severe acute respiratory syndrome in Hong Kong. Lancet 361: 1761–1766. Drazen JM. 2003. SARS — Looking Back over the First 100 Days. 2003. N. Engl. J. Med. 349:319-320. Drosten C, Gunther S, Preiser W, van der WS, Brodt HR, Becker S. 2003. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N. Engl. J. Med. 348: 1967–1976. Dwosh HA, Hong HH, Austgarden D, Herman S, Schabas R. 2003. Identification and containment of an outbreak of SARS in a community hospital. C. M. A. J. 168: 1415–1420. 80 Eckert DM, Kim PS. 2001. Mechanisms of viral membrane fusion and its inhibition. Annu. Rev. Biochemistry 70: 777–810 Eleouet JF, Rasschaert D, Lambert P. 1995. Complete swquence of the polypretein-encoding gene 1 of transmissible gastroenteritis virus. Virology 206: 817-822 Enjuanes L, Sola I, Almazan F, Izeta A, Gonzalez JM, Alonso S. 2001. Coronavirus derived expression systems. Progress and problems. Adv. Exp. Med. Biol. 494: 309-21. Fan K, Wei P, Feng Q, Chen S, Huang C, Ma L, Lai B, Pei J, Liu Y, Chen J. 2004. Biosynthesis, purification, and substrate specificity of severe acute respiratory syndrome coronavirus 3C-like proteinase. J. Biol. Chem. 279: 1637-1642. Fischer F, Stegen CF, Koetzner CA, Masters PS. 1997. Analysis of a recombinant mouse hepatitis virus expressing a foreign gene reveals a novel aspect of coronavirus transcription. J. Virol. 71: 5148-5160 Fleming JO, Stohlman SA, Harmon RC, Lai MM, Frelinger JA, Weiner LP. 1983. Antigenic relationships of murine coronaviruses: analysis using monoclonal antibodies to JHM (MHV-4) virus. Virology 131: 296–307. Fouchier RA, Kuiken T, Schutten M. 2003. Aetiology: Koch’s postulates fulfilled for SARS virus. Nature 423: 240. Frolov I, Hoffman TA, Pragai BM, Dryga SA, Huang HV, Schlesinger S, Rice CM. 1996. Alphavirus-based expression vectors: strategies and applications. Proc. Natl. Acad. Sci. USA 93: 11371-11377. Gao F, Ou HY, Chen LL, Zheng WX, Zhang CT. 2003a. Prediction of proteinase cleavage sites in polyproteins of coronaviruses and its applications in analyzing SARS-CoV genomes. FEBS Lett. 553: 451–456. Gao W, Tamin A, Soloff A, D’Aiuto L, Nwanegbo E, Robbins PD, Bellini WJ, Barratt-Boyes S, Gambotto A. 2003b. Effects of a SARS-associated coronavirus vaccine in monkeys. Lancet 362: 1895–1896. Godet M, Grosclaude J, Delmas B, Laude H. 1994. Major receptorbinding and neutralization determinants are located within the same domain of the transmissible gastroenteritis virus (coronavirus) spike protein. J. Virol. 68: 8008–8016. Griffiths G, Rottier PJM. 1992. Cell biology of viruses that assemble along the biosynthetic pathway. Semin. Cell Biol. 3: 367-381 Guan Y, Zheng BJ, He YQ. 2003. Isolation and characterization of viruses related to the SARS coronavirus from animals in Southern China. Science 302: 276–278. Guo JP, Petric M, Campbell W, McGeer PL. 2004. SARS corona virus peptides recognized by antibodies in the sera of convalescent cases. Virology 324: 251-256 Hawkey PM, Bhagani S, Gillespie SH. 2003. Severe acute respiratory syndrome (SARS): breath-taking progress. J. Med. Microbiol. 52: 609–613. 81 He R, Dobie F, Ballantine M, Leeson A, Li Y, Bastien N, Cutts T, Andonov A, Cao J, Booth TF, Plummer FA, Tyler S, Baker L, Li X. 2004. Analysis of multimerization of the SARS coronavirus nucleocapsid protein. Biochem. Biophys. Res. Commun. 316: 476–483 He R, Leeson A, Andonov A, Li Y, Bastien N, Cao J, Osiowy C, Dobie F, Cutts T, Ballantine M, Li X. 2003. Activation of AP-1 signal transduction pathway by SARS coronavirus nucleocapsid protein. Biochem. Biophys. Res. Commun. 311: 870–876. Hegyi A, Ziebuhr J. 2002. Conservation of substrate specificities among coronavirus main proteases. J. Gen. Virol. 83: 595-599. Herold J, Raabe T, Schelle-Rrinz B, Siddell SG. 1993. Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 195: 680-691 Hertzig T, Scandella E, Schelle B, Ziebuhr J, Siddell SG, Ludewig B, Thiel V. 2004. Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA. J. Gen. Virol. 85: 1717-1725. Hiscox JA, Wurm T, Wilson L, Britton P, Cavanagh D, Brooks G. 2001. The coronavirus infectious bronchitis virus nucleoprotein localizes to the nucleolus. J. Virol. 75: 506–512. Ho Y, Lin PH, Liu CY, Lee SP, Chao YC. 2004. Assembly of human severe acute respiratory syndrome coronavirus-like particles. Biochem. Biophys. Res. Commun. 318: 833–838. Holmes KV. 2001. Coronaviruses. In: Knipe DM, Howley PM, Griffin DE, Martin MA, Lamb RA, Roizman B, Straus SE. (Eds.). Fields virology. 4th ed. Lippincott-Raven, Philadelphia. pg. 1187–1203. Holmes KV. 2003a. SARS coronavirus: a new challenge for prevention and therapy. J. Clin. Invest. 111: 1605–1609. Hon KL, Leung CW, Cheng WT, Chan PK, Chu WC, Kwan YW. 2003. Clinical presentations and outcome of severe acute respiratory syndrome in children. Lancet 361: 1701–1703. Huang Q, Yu L, Petros AM, Gunasekera A, Liu Z, Xu N, Hajduk P, Mack J, Fesik SW, Olejniczak ET. 2004. Structure of the N-terminal RNA-binding domain of the SARS CoV nucleocapsid protein. Biochemistry 43: 6059–6063. Ingallinella P, Bianchi E, Finotto M, Cantoni G, Eckert DM, Supekar VM, Bruckmann C, Carfi A, Pessi A. 2004. Structural characterization of the fusion-active complex of severe acute respiratory syndrome (SARS) coronavirus. Proc. Natl. Acad. Sci. USA 101: 8709–8714. Ivanov KA, Thiel V, Dobbe JC, van der Meer Y, Snijder EJ, Ziebuhr J. 2004. Multiple enzymatic activities associated with severe acute respiratory syndrome coronavirus helicase. J. Virol. 78: 5619–5632. Jeong YS, Repass JF, Kim Y-N, Hwang S-M, Makino S. 1996. Coronavirus transcription mediated by sequences flanking the transcription consensus sequence. Virology 217: 311-322. 82 Kant A, Koch G, van Roozelaar DJ, Kusters JG, Poelwijk FA, van der Zeijst BA. 1992. Location of antigenic sites defined by neutralizing monoclonal antibodies on the S1 avian infectious bronchitis virus glycopolypeptide. J. Gen. Virol. 73: 591– 596. Kapadia SB, Brideau-Andersen A, Chisari FV. 2003. Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc. Natl. Acad. Sci. USA 100: 2014-2018. Kaplan G, Racaniello VR. 1998. Construction and characterization of poliovirus subgenomic replicons. J. Virol. 62: 1687-1696. Khromykh AA. 2000. Replicon-based vectors of positive strand RNA viruses. Curr. Opin. Mol. Ther. 2: 555-69 Khromykh AA, Westaway EG. 1997. Subgenomic replicons of the flavivirus Kunjin: construction and applications. J. Virol. 71: 1497-1505. Kim TW, Lee JH, Hung CF, Peng S, Roden R, Wang MC, Viscidi R, Tsai YC, He L, Chen PJ, Boyd DA, Wu TC. 2004. Generation and characterization of DNA vaccines targeting the nucleocapsid protein of severe acute respiratory syndrome coronavirus. J. Virol. 78: 4638– 4645. Koo M, Bendahmane M, Lettieri GA, Paoletti AD, Lane TE, Fitchen JH, Buchmeier MJ, Beachy RN. 1999. Protective immunity against murine hepatitis virus (MHV) induced by intranasal or subcutaneous administration of hybrids of tobacco mosaic virus that carries an MHV epitope. Proc. Natl. Acad. Sci. USA 96: 7774–7779. Ksiazek TG, Erdman D, Goldsmith CS. 2003. A novel coronavirus associated with severe acute respiratory syndrome. N. Engl. J. Med. 348: 1953–1966. Kubo H, Takase-Yoden S, Taguchi F. 1993. Neutralization and fusion inhibition activities of monoclonal antibodies specific for the S1 subunit of the spike protein of neurovirulent murine coronavirus JHMV c1-2 variant. J. Gen. Virol. 74: 1421–1425. Kubo H, Yamada YK, Taguchi F. 1994. Localization of neutralizing epitopes and the receptorbinding site within the amino-terminal 330 amino acids of the murine coronavirus spike protein. J. Virol. 68: 5403-5410. Kuiken T, Fouchier RAM, Schutten M, Rimmelzwaan GF, van Amerongen G, van Riel D, Laman JD, de Jong T, van Doornum G, LimW, Ling AE, Chan PKS, Tam JS, Zambon MC, Gopal R, Drosten C, van der Werf S, Escriou N, Manuguerra JC, Stohr K, Peiris JSM, Osterhaus A. 2003. Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. Lancet 362: 263–270. Kuo L, Masters PS. 2002. Genetic evidence for a structural interaction between the carboxy termini of the membrane and nucleocapsid proteins of mouse hepatitis virus. J. Virol. 76: 4987–4999. Lai MMC, Holmes KV. 2001. Coronviridae: the viruses and their replication. In: Knipe DM, Howley PM. (Eds.), Fields Virology. 4th ed. Lippincott-Raven, Philadelphia, pg. 1163– 1184. 83 Lee N, Hui D, Wu A. 2003. A Major Outbreak of Severe Acute Respiratory Syndrome in Hong Kong. N. Engl. J. Med. 348: 1986-1994. Leung DT, Tam FC, Ma CH, Chan PK, Cheung JL, Niu H, Tam JS, Lim PL. 2004. Antibody response of patients with severe acute respiratory syndrome (SARS) targets the viral nucleocapsid. J. Infect. Dis. 190: 379–386. Li W, Moore MJ, Vasilieva N, Sui J, Wong SK, Berne M., Somasundaran M, Sullivan JL, Luzuriaga K, Greenough TC, Choe H, Farzan M. 2003a. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426: 450–454. Li L, Wo J, Shao J, Zhu H. 2003b. SARS-coronavirus replicates in mononuclear cells of peripheral blood (PBMCs) from SARS patients. J. Clin. Virol. 28: 239–244. Liljestrom P, Garoff H. 1991. A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology 9: 1356-1361. Lipsitch M, Cohen T, Cooper B, Robins JM, Ma S, James L. 2003. Transmission dynamics and control of severe acute respiratory syndrome. Science 300: 1966–1970. Liu C, Kokuho T, Kubota T, Watanabe S, Inumaru S, Yokomizo Y, Onodera T. 2001. DNA mediated immunization with encoding the nucleoprotein gene of porcine transmissible gastroenteritis virus. Virus Res. 80: 75–82. Liu S, Xiao G, Chen Y, He Y, Niu J, Escalante CR, Xiong H, Farmar J, Debnath AK, Tien P, Jiang S. 2004. Interaction between heptad repeat 1 and 2 regions in spike protein of SARSassociated coronavirus: implications for virus fusogenic mechanism and identification of fusion inhibitors. Lancet 363: 938– 947. Lo MK, Tilgner M, Shi PY. 2003. Potential high-throughput assay for screening inhibitors of West Nile virus replication. J. Virol. 77: 12901-12906. Locker JK, Rose JK, Horzinek MC, Rottier PJ. 1992. Membrane assembly of the triple-spanning coronavirus M protein. Individual transmembrane domains show preferred orientation. J. Biol. Chem. 267: 21911-21918. Lohmann V, Korner F, Koch J, Herian U, Theilmann L, Bartenschlager R. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285: 110-113. Ludwig B, Kraus FB, Allwinn R, Doerr HW, Preiser W. 2003. Viral Zoonoses – A Threat under Control? Intervirology 46: 71- 78 Luo Z, Weiss S. 1998. Roles in cell-to-cell fusion of two conserved hydrophobic regions in the murine coronavirus spike protein. Virology 244: 483-494. Machamer CE, Grim MG, Esquela A. 1993. Retention of a cis Golgi protein requires polar residues on one face of a predicted a helix in the transmembrane domain. Mol. Biol. Cell 4: 695-704. 84 Machamer CE, Mentone SA, Rose JK, Farquhar MG. 1990. The E1 glycoprotein of an avian coronavirus is targeted to the cis Golgi complex. Proc. Natl. Acad. Sci. USA 87: 6944-6948. Machamer CE, Rose JK. 1987. A specific transmembrane domain of a coronavirus E1 glycoprotein is required for its retention in the Golgi region. J. Cell Biol. 105: 1205-1214 Macnaughton MR, Davies HA, Nermut MV. 1978. Ribonucleoprotein-like structures from coronavirus particles. J. Gen. Virol. 39: 545-549 Maeda J, Maeda A, Makino S. 1999. Release of coronavirus E protein in membrane vesicles from virus-infected cells and E protein-expressing cells. Virology 263: 265–272. Marra MA, Jones SJ, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YS, Khattra J, Asano JK, Barber SA, Chan SY. 2003. The Genome sequence of the SARS-associated coronavirus. Science 300: 1399-1404. Martina BE, Haagmans BL, Kuiken T, Fouchier RA, Rimmelzwaan GF, Van Amerongen G, Peiris JS, Lim W, Osterhaus AD. 2003. Virology: SARS virus infection of cats and ferrets. Nature 425: 915. Molenkamp R, van Tol H, Rozier BC, van der Meer Y, Spaan WJ, Snijder EJ. 2000. The arterivirus replicase is the only viral protein required for genome replication and subgenomic mRNA transcription. J. Gen. Virol. 81: 2491-2496. Narayanan K, Chen C-J, Maeda J, Makino S. 2003. Nucleocapsid-independent specific viral RNA packaging via viral envelope protein and viral RNA signal. J. Virol. 77: 2922–2927. Narayanan KA, Maeda J, Maeda S. 2000. Characterization of the coronavirus M protein and nucleocapsid interaction in infected cells. J. Virol. 74: 8127–8134. Nathan M, Mertz LM, Fox DK. 1995. Optimizing long RT-PCR. Focus 17: 78–80. Ng SKC. 2003. Possible role of an animal vector in the SARS outbreak at Amoy Gardens. Lancet 362: 570–572. Nicholls JM, Poon LL, Lee KC, Ng WF. 2003. Lung pathology of fatal severe acute respiratory syndrome. Lancet 361: 1773–1778. Oshiro LS. Coronaviruses. In: Dalton AJ, Haguenau F. (Eds). Ultra-structure of animal viruses and bacteriophages: An atlas. New York: Academic Press 1971: 331-343 Pang X, Zhang M, Dayton AI. 2001. Development of Dengue virus type 2 replicons capable of prolonged expression in host cells. BMC Microbiol. 1: 18. Parker MM, Masters PS. 1990. Sequence comparison of the N genes of five strains of the coronavirus mouse hepatitis virus suggests a three domain structure for the nucleocapsid protein. Virology 179: 463–468. Peiris JSM, Lai ST, Poon LLM. 2003a. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361: 1319–1325. 85 Peiris JSM, Yuen KY, Osterhaus ADM, Stohr K. 2003b. The severe acute respiratory syndrome. N. Engl. J. Med. 349: 2431–2441. Poutanen SM, Low DE, Henry B. 2003. Identification of severe acute respiratory syndrome in Canada. N. Engl. J. Med. 348: 1995-2005. Randall G, Rice CM. 2001. Hepatitis C virus cell culture replication systems: their potential use for the development of antiviral therapies. Curr. Opin. Infect. Dis. 14: 743-747. Rice CM, Grakoui A, Galler R, Chambers TJ. 1989. Transcription of infectious yellow fever virus RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1: 285– 296. Riley S, Fraser C, Donnelly CA, Ghani AC. 2003. Transmission dynamics of the etiological agent of SARS in Hong Kong: impact of public health interventions. Science 300: 1961–1966. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda S, Bankamp B, Maher K, Chen MH. 2003. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 300: 1394-1399. Ruan YJ, Wei CL, Ee AL. 2003. Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet 361: 1779-1785. Sawicki SG, Sawicki DL. 1998. A new model for coronavirus transcription. Adv. Exp. Med. Biol. 440: 215-219. Shen X, Xue JH, Yu CY, Luo HB, Qin L, Yu XJ, Chen J, Chen LL, Xiong B, Yue LD, Cai JH, Shen JH, Luo XM, Chen KX, Shi TL, Li YX, Hu GX, Jiang HL. 2003. Small envelope protein E of SARS: cloning, expression, purification, CD determination, and bioinformatics analysis. Acta. Pharmacol. Sin. 24: 505– 511. Shi PY, Tilgner M, Lo MK. 2002. Construction and characterization of subgenomic replicons of New York strain of West Nile virus. Virology 296: 219-233. Shi J, Wei Z, Song J. 2004. Dissection study on the severe acute respiratory syndrome 3C-like protease reveals the critical role of the extra domain in dimerization of the enzyme: defining the extra domain as a new target for design of highly specific protease inhibitors. J. Biol. Chem. 279: 24765–24773. Shi Y, Yi Y, Li P, Kuang T, Li L, Dong M, Ma Q, Cao C. 2003. Diagnosis of severe acute respiratory syndrome (SARS) by detection of SARS coronavirus nucleocapsid antibodies in an antigencapturing enzyme-linked immunosorbent assay. J. Clin. Microbiol. 41: 5781–5782. Siddell SG. 1995. The small-membrane protein. In: Siddell SG. (Ed.). The Coronaviridae. Plenum, New York, NY, pp. 181–189. Siddell SG, Wege H, ter Meulen V. 1983. The biology of coronaviruses. J. Gen. Virol. 64: 761-766. 86 Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LL, Guan Y, Rozanov M, Spaan WJ, Gorbalenya AE. 2003. Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J. Mol. Biol. 331: 991–1004. Sturman LS, Holmes KV, Behnke J. 1980. Isolation of coronavirus envelope glycoproteins and interaction with the viral nuclocapsid. J. Virol. 33: 449-462 Surjit M, Liu B, Kumar P, Chow VT, Lal SK. 2004a. The nucleocapsid protein of the SARS coronavirus is capable of self-association through a C-terminal 209 amino acid interaction domain. Biochem. Biophys. Res. Commun. 317: 1030–1036. Surjit M, Liu B, Jameel S, Chow VT, Lal SK. 2004b. The SARS coronavirus nucleocapsid (N) protein induces actin reorganization and apoptosis in COS-1 cells in the absence of growth factors. Biochemistry 383: 13-18 Sutton G, Fry E, Carter L, Sainsbury S, Walter T, Nettleship J, Berrow N, Owens R, Gilbert R, Davidson A, Siddell S, Poon LL, Diprose J, Alderton D, Walsh M, Grimes JM, Stuart DI. 2004. The nsp9 replicase protein of SARS-coronavirus, structure and functional insights. Structure 12: 341–353. Takase-Yoden S, Kikuchi T, Siddell SG, Taguchi F. 1991. Localization of major neutralizing epitopes on the S1 polypeptide of the murine coronavirus peplomer glycoprotein. Virus Res. 18: 99–107 Tan YJ, Teng E, Shen S, Tan THP, Goh PY, Fielding BC, Ooi EE, Tan HC, Lim SG, Hong W. 2004. A novel SARS coronavirus protein, U274, is transported to the cell surface and undergoes endocytosis. J. Virol. 78: 6723–6734. Tanner J A, Watt RM, Chai YB, Lu LY, Lin MC, Peiris JS, Poon LL, Kung HF, Huang JD. 2003. The severe acute respiratory syndrome (SARS) coronavirus NTPase/helicase belongs to a distinct class of 59 to 39 viral helicases. J. Biol. Chem. 278: 39578–39582. Thiel V, Herold J, Schelle B, Siddell SG. 2001. Viral replicase gene products suffice for coronavirus discontinuous transcription. J. Virol. 75: 6676–6681. Thiel V, Ivanov KA, Putics A, Hertzig T, Schelle B, Bayer S, Weissbrich B, Snijder EJ, Rabenau H, Doerr HW. 2003a. Mechanisms and enzymes involved in SARS coronavirus genome expression. J. Gen. Virol. 84: 2305-2315. Thiel V, Karl N, Schelle B, Disterer P, Klagge I, Siddell SG. 2003b. Multigene RNA vector based on coronavirus transcription. J. Virol. 77: 9790–9798. Thumfart JO, Meyers G. 2002. Feline calicivirus: recovery of wild-type and recombinant viruses after transfection of cRNA or cDNA constructs. J. Virol. 76: 6398-6407. To KF, Chan PK, Chan KF, Lee WK. 2001. Pathology of fatal human infection associated with avian influenza A H5N1 virus. J. Med. Virol. 63: 242–246. Tooze J, Tooze SA. 1985. Infection of AtT20 murine pituitary tumour cells by mouse hepatitis virus strain A59: Virus budding is restricted to the Golgi region. Eur. J. Cell Biol. 37: 203-205 87 Tripet B, Howard MW, Jobling M, Holmes RK, Holmes KV, Hodges RS. 2004. Structural characterization of the SARS coronavirus spike S fusion protein core. J. Biol. Chem. 279: 20836–20849 Tsang KW, Ho PL, Ooi GC, Yee WK, Wang T, Chan-Yeung M, Lam WK, Seto WH, Yam LY, Cheung TM, Wong PC, Lam B, Ip MS, Chan J, Yuen KY, Lai KN. 2003. A cluster of cases of severe acute respiratory syndrome in Hong Kong. N. Engl. J. Med. 348: 1977–1985. Vennema H, Godeke GJ, Rossen JW, Voorhout WF, Horzinek MC, Opstelten DJ, Rottier PJ. 1996. Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes. EMBO J. 15: 2020–2028. Von Grotthuss M, Wyrwicz LS, Rychlewski L. 2003. mRNA cap-1 methyltransferase in the SARS genome. Cell 113: 701–702. Wang J, Wen J, Li J, Yin J, Zhu Q, Wang H, Yang Y, Qin E, You B, Li W, Li X, Huang S, Yang R, Zhang X, Yang L, Zhang T, Yin Y, Cui X, Tang X, Wang L, He B. 2003. Assessment of immunoreactive synthetic peptides from the structural proteins of severe acute respiratory syndrome coronavirus. Clin. Chem. 49: 1989–1996. World Health Organization. 2003b. Severe acute respiratory syndrome—Singapore. Wkly. Epidemiol. Rec. 78: 157–162. World Health Organization. 2003c. Severe acute respiratory syndrome (SARS): over 100 days into the outbreak. Wkly. Epidemiol. Rec. 78: 217–220. World Health Organization. 2003d. Chronology of travel recommendations, areas with local transmission.Wkly. Epidemiol. Rec. 78: 258–259. World Health Organization Update 49. 2003. SARS case fatality ratio, incubation period: http://www.who.int/csr/sars/archive/2003 05 07a/en/ Wurm T, Chen H, Hodgson T, Britton P, Brooks G, Hiscox JA. 2001. Localization to the nucleolus is a common feature of coronavirus nucleoproteins, and the protein may disrupt host cell division. J. Virol. 75: 9345–9356. Xu X, Liu Y, Weiss S, Arnold E, Sarafianos SG, Ding J. 2003. Molecular model of SARS coronavirus polymerase: implications for biochemical functions and drug design. Nucleic Acids Res. 31: 7117-7130. Yang ZY, Kong WP, Huang Y, Roberts A, Murphy BR, Subbarao K, Nabel GJ. 2004. A DNA vaccine induces SARS coronavirus neutralization and protective immunity in mice. Nature 428: 561– 564 Yang H, Yang M, Ding Y, Liu Y, Lou Z, Zhou Z, Sun L, Mo L, Ye S, Pang H, Gao GF, Anand K, Bartlam M, Hilgenfeld R, Rao Z. 2003. The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. Proc. Natl. Acad. Sci. USA 100: 13190–13195 88 Ying W, Hao Y, Zhang Y, Peng W, Qin E, Cai Y, Wei K, Wang J, Chang G, Sun W, Dai S, Li X, Zhu Y, Li J, Wu S, Guo L, Dai J, Wang J, Wan P, Chen T, Du C, Li D, Wan J, Kuai X, Li W, Shi R, Wei H, Cao C, Yu M, Liu H, Dong F, Wang D, Zhang X, Qian X, Zhu Q, He F. 2004. Proteomic analysis on structural proteins of Severe Acute Respiratory Syndrome coronavirus. Proteomics 4: 492–504. Yount B, Kristopher M. Curtis, Elizabeth A. Fritz, Lisa E. Hensley, Peter B. Jahrling, Erik Prentice, Ralph S. Baric. 2003. Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus. Proc. Natl. Acad. Sci. USA 100: 12995–13000. Yount B, Denison MR, Weiss SR, Baric RS. 2002. Systematic assembly of a full-length infectious cDNA of mouse hepatitis virus strain A59. J. Virol. 76: 11065-11078. Yount B, Curtis C, Baric RS. 2000. Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. J. Virol. 74: 10600-10611. Yuan K, Yi L, Chen J, Qu X, Qing T, Rao X, Jiang P, Hu J, Xiong Z, Nie Y, Shi X, Wang, W, Ling C, Yin X, Fan K, Lai L, Ding M, Deng H. 2004. Suppression of SARS-CoV entry by peptides corresponding to heptad regions on spike glycoprotein. Biochem. Biophys. Res. Commun. 319: 746–752. Zeng R, Ruan HQ, Jiang XS, Zhou H, Shi L, Zhang L, Sheng QH. 2004. Proteomic analysis of SARS associated coronavirus using two-dimensional liquid chromatography mass spectrometry and one-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis followed by mass spectroemtric analysis. J. Proteome Res. 3: 549–555. Zhu J, Xiao G, Xu Y, Yuan F, Zheng C, Liu Y, Yan H, Cole DK, Bell JI, Rao Z, Tien P, Gao GF. 2004. Following the rule: formation of the 6-helix bundle of the fusion core from severe acute respiratory syndrome coronavirus spike protein and identification of potent peptide inhibitors. Biochemistry Biophys. Res. Commun. 319: 283–288. Ziebuhr J. 2004. Molecular biology of severe acute respiratory syndrome coronavirus. Curr. Opin. Microbiol. 7: 412–419. Ziebuhr J, Snijder EJ, Gorbalenya AE. 2000. Virus-encoded proteinases and proteolytic processing in the Nidovirales. J. Gen. Virol. 81: 853-879. Zuniga S, Sola I, Alonso S, Enjuanes L. 2004. Sequence motifs involved in the regulation of discontinuous coronavirus subgenomic RNA synthesis. J. Virol. 78: 980-994. 89 Appendix 1 Primer Names & Sequences Name Sequence (5’ to 3’) 02R 04F 06F 06R 07F 08R 09F 09R 10F 10R 11R 12F 12R 13F 13R 14F 14R2 16R2 1R 2R 3F 3R 4F 4FX 4RX 5F 5FX 6F 6R 8F 9R A1R BBIBlF BGBF BGBR GAPDHF GAPDHR GFPBLAR NFX NR SAP1R SAP1R2 SAP2F SAP2R SCVD3709RP SCVD555RP SCVLFOR SP12918F SP13639f SP17970F SP18680F SP19400F SP28384F SP4251R SP6081F T71+F T71+F3 GCTGAGGCACCAAATTCCAG GAATGAGGTCTCATCTCAAGAGCTTTGAAGAAAGTGC GAATGAGGTCTCACCCTTGATTCTTATCCAGCTCTTG GAATGAGGTCTCACGAAGCTCACTATAAGAAATAGAACCC CTATGAGGTCTCATTCGTCCAGACACTCGTTATGTG TGCCCACAATTTAGAAGATGACTC TTCTTAGGCTATTGTTGCTGCTGC GATTCAGGTCTCATTGTCCTCCACTTGCTAGGTAATCC GAATGAGGTCTCAACAACCAATCACCAACTGTGTGAAG GAATCAGGTCTCATCCTCTAGTGGCGGCTATTGAC TGGGAGGCTTATGTGACTTGC GTGCCTGTATTAGGAGACCATTCC GAATGAGGTCTCATGGTATGCCTGGTATGTCAACAC GAATGTGGTCTCAACCAAAGGACATGACCTACCGTAG GAATGTGGTCTCTACTGTTGAATAATGCCGTCTACTTTC GAATGAGGTCTCACAGTTGCCTGAAACCTACTTTACTCAG GTATCAGGTCTCAATGTTCGTTTAGTTGTTAACAAGAATATCAC GCCCCGCGGTCATTCTCCTAAGAAGCTATTAAAATCACATGG TGCGGAGTCGAGTTTCAATGTTTG GGTTTGCTGCATCAAGTGTGCG TACCAAGGGAAAGCCCGTAAAAGG CTTAACCTCCCGCAGGGATAAGAGAC GGCTGGCTCTTACAGAGATTGGTCC CTGCAAAGCGAGTTCTTAATGTGGTG GCAGAAAGACACGCAATCATAATCAATG CCATTCAGGATGGTGTCACTCGTG TTTGTCCGTATCCAACCTGGTCAAAC GCAGATCAGGCTATGACCCAAATGTAC AACTCAGGTTCCCAGTACCGTGAGG GCTCTGATAAAGGAGTTGCACCAGGTAC GTCATTCTCCTAAGAAGCTATTAAAATCACATGG GAATCAGCTCTTCATGGTAATGGTTGAGTTGGTACAAGG CCAGGATCCGGTCTCTGTAAACGAACATGCCTTTGTCTCAAGAAGAATCCACCCTC CGTGGATCCGGTCTCTACATGGCCTCCAAAGGAGAAGAAC CCAGAATTCGGTCTCACCAATTAGCCCTCCCACACATAACCAG ACGCCTGCTTCACCACCTTCTTG GGAGCCAAAAGGGTCATCATCTCTG CTGTACATAACCTTCGGGCATGGC CATTCAGGTCTCATTGGTTTTCACTCGAAATCCAGGATC CCGCCTCTGCTTCCCTCTGC CAACCATCCATGATATGAACATAGC GCCGACGCTCTTCAATATGCCTGCTGACAACAATGGTG CCGTTTCTGCAATGGTTAGGATG GGCTGCTGTAGTCAATGGTATGATG GAGAATGCTTTCTTGCCATTTACTC GCTTCTGTGTACTACAGTCAGCTGATG CCCAGGAAAAGCCAACCAACCTC ATGGTGCTGGGCAGTTTAG TGGTTAAAGATTGTCCAGCG ATTACAAGCAGAAAATGTAACTGG GACTATGTCTATAACCCATTTATGATTG ATGCAATTTAGGTGGTGCTG GAGTTCGTGGTGGTGACGGC TCTTCCTTAGCATTAGGTGCTTC CAGACTTGAATGGCGATGTAG CACGCTCTTCAGCATACTAATACGACTCACTATAGATATTAGGTTTTTACCTACCCAGGAAAAG TAATACGACTCACTATAGATATTAGGTTTTTACCTACCCAGGAAAAG 90 Appendix 2 Reagents for Northern Blotting All solutions were prepared using RNase-free water and fresh AnalaR grade reagents. 5 x MOPS To make 1 L: Item Amount Source MOPS 20.60 g Sigma NaAC 5.44 g Merck 0.5 M EDTA 10 ml NUMI, NUS 800 ml of water was added and pH was adjusted to 7.0 using sodium hydroxide. Solution was then topped to 1 L and sterilized by membrane filter through a 0.22 µm filter. Denaturing Sample Buffer Item Amount Source Ambion Sample Buffer II 75 µl Ambion 5 × MOPS Buffer (pH= 7.0) 30 µl Appendix 2 37% Formaldehyde 24 µl Merck Glycerol 6 µl Merck Alkaline solution To make 1 L: Item Amount Source NaOH 2g Merck NaCl 5.84 g Merck Solution was then topped to 1 L and sterilized by membrane filter through a 0.22 µm filter. 91 Neutralization solution 12.11 g Tris (Fisher Biotech) was dissolved in 800 ml water and pH was adjusted to 7.5 using HCl. The solution was then topped to 1 L and sterilized by membrane filter through a 0.22 µm filter. Hybridization buffer To make 100 ml: Item Amount Source 20× SSC Stock Solution 25 ml NUMI, NUS Liquid block 5 ml Amersham 10% (w/v) SDS 1 ml NUMI, NUS Dextran sulphate 5g Sigma All the components were combined and topped up to 100ml. The hybridization buffer was stored in suitable aliquots at -20°C. Buffer A 12.11 g Tris (Fisher Biotech) and 17.52g NaCl were dissolved in 800 ml water and pH was adjusted to 9.5 using NaOH. The solution was then topped to 1 L and sterilized by membrane filter through a 0.22 µm filter. Blocking buffer 2 ml of liquid block (Amersham) was diluted in 18 ml Buffer A (Appendix 2). Anti-fluorescein-AP conjugate solution 0.05 g bovine serum albumin fraction V (Amresco) was dissolved in 10 ml Buffer A and 2 µl anti-fluorescein-AP conjugate (Amersham) was then added. 92 AP Wash Buffer 3 ml of Tween 20 (DAKO) was diluted in 997 ml of Buffer A (Appendix 2) to make 1 L of AP wash buffer. 93 [...]... circumstances and the use of nebulizers, increase the risk of infection (Chan et al., 200 3a) A few cases of laboratory-acquired SARSCoV transmission were occurred in Singapore, Taiwan and China Although subsequent investigation showed inappropriate laboratory standards and no secondary transmission arose from these cases, they demonstrate the need for appropriate biosafety precautions in laboratories... postulates and confirming that SARS- CoV was the causative agent of SARS (Fouchier et al., 2003; Kuiken et al., 2003) The origin of the SARS- CoV has been the subject of intense speculation despite closely related coronaviruses that were recovered from civet cats and other animals in Guangdong Province, suggesting the SARS- CoV could have originated from such animals and implicating SARS as a zoonosis disease... Disease Control and Prevention, 2003) During a few months, the virus spread to different Hong Kong hospitals and communities as well as to Vietnam, Singapore, Canada, the United States of America, and beyond to a total of 30 countries and areas of the world (World Health Organization, 2003d) The incubation period of SARS ranges from 2 to 16 days Large studies demonstrated a median incubation period of. .. which was first identified by researchers in Hong Kong, the United States, and Germany (Peiris et al., 200 3a; Drosten et al., 2003; Ksiazek et al., 2003; Poutanen et al., 2003; Rota et al., 2003; Marra et al., 2003) The virus was then termed SARS- associated coronavirus and acronymized as SARS- CoV Coronaviruses (order Nidovirales, family Coronaviridae, genus Coronavirus) are a group of viruses with large,... breathing, shortness of breath) AND radiographic evidence of lung infiltrates consistent with pneumonia or RDS OR autopsy findings consistent with the pathology of pneumonia OR RDS without an identifiable cause AND No alternative diagnosis can fully explain the illness Laboratory case definition of SARS A person with symptoms and signs that are clinically suggestive of SARS AND with positive laboratory... fusion between viral and cellular membranes (Eckert et al., 2001) For the SARS- CoV, HR2 is located close to the transmembrane anchor (1148–1193 amino acids) and HR1 is ~140 amino acids upstream of it (900–1005 amino acids) (Ingallinella et al., 2004) Biochemical studies have shown that peptides corresponding to the HR1 and HR2 of SARS- CoV S protein can associate into an anti-parallel six-helix bundles... significant morbidity and mortality, and potential for 2 reemergence, make it necessary to develop effective methods to treat and prevent the disease One important aspect in the fight against SARS is to develop antiviral agents that can specifically inhibit the RNA synthesis of SARS- CoV 1.2 Classification of SARS- CoV The severe acute respiratory syndrome (SARS) is due to an infection with a novel coronavirus. .. proteinase activities of PL2pro and 3CLpro, 16 mature non-structural proteins (nsp) are produced (Figure 4) (Thiel et al., 200 3a; Ziebuhr et al., 2000; Anand et al., 2003) The 106-kDa SARS- CoV RdRp (nsp12) plays a pivotal role in viral RNA synthesis and is an attractive target for anti -SARS therapy However, till now little is known about the structure and biochemical activity of any coronavirus RdRp... activities, (ii) nucleic acid-stimulated NTPase and dNTPase activities, (iii) RNA and DNA duplex unwinding activities, and (iv) RNA 5’-triphosphatase 12 activity, which is proposed to mediate the first step of 5’-cap synthesis on coronavirus RNAs (Tanner et al., 2003; Thiel et al., 200 3a; Ivanov et al., 2004) SARS- CoV nsp9 can bind to RNA as well as another non-structural protein, nsp8 (Sutton et al.,... first coronavirus that causes severe disease in humans (Berger et al., 2004) The genome sequence reveals that SARS- CoV is only moderately related to other known coronaviruses, including two human coronaviruses, HCoV-OC43 and HCoV-229E (Drosten et al., 2003; Peiris et al., 200 3a; Marra et al., 2003; Rota et al., 2003) The SARSCoV appears to be neither a mutant of a known coronavirus nor a recombinant ... virus spread to different Hong Kong hospitals and communities as well as to Vietnam, Singapore, Canada, the United States of America, and beyond to a total of 30 countries and areas of the world... protease, 3CLpro, are indicated by grey arrowheads, and sites that are processed by the papain-like protease, PL2pro, are indicated by black arrowheads TM stands for transmembrane domain; C/H stands... detection of GFP-BlaR and GAPDH genes 47 iii 2.4.5 Sequencing of SARS-CoV replicon and sub -replicon RNAs RESULTS 48 50 3.1 Generation of SARS-CoV replicon RNA 51 3.2 Generation and analysis of SARS-CoV