Development and characterization of a SARS coronavirus replicon cell line

... detection of GFP-BlaR and GAPDH genes 47 iii 2.4.5 Sequencing of SARS- CoV replicon and sub -replicon RNAs RESULTS 48 50 3.1 Generation of SARS- CoV replicon RNA 51 3.2 Generation and analysis of SARS- CoV ... project was to construct a cell line carrying a SARS coronavirus (SARS- CoV) replicon, which is incapable of producing viral particles First, partia...

Ngày tải lên: 04/10/2015, 15:46

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotI...

Ngày tải lên: 12/08/2014, 04:20

... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... distance for (a) mirror magnetic field, and (b) flat magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma ch...

Ngày tải lên: 22/12/2013, 08:58

... genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT ... and will enable more detailed analysis of the exact reaction mechanisms The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space...

Ngày tải lên: 19/02/2014, 06:20

... Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from the local wetlands of Kanyakumari district, India The crabs used for experimental purpose were of either ... (1985) Purification and characterization of an O-acetyl sialic acid specific lectin from a marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13...

Ngày tải lên: 21/02/2014, 00:20

... Dr Ake Engstrom at the Peptide Synthesis and Analysis Laboratory ¨ of the Department of Medical Biochemistry and Microbiology, Uppsala University The SP6 primer 5¢-ATT TAG GTG ACA CTA TAG-3¢ and ... its absorbance at 315 nm, appeared as a peak at 0.33 M MDEA and was essentially stable in this buffer at +4 °C for at least months The phosphate content of the The standard assay...

Ngày tải lên: 21/02/2014, 01:21

... was observed (not shown) The arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome ... of an enzyme preparation containing only minor amounts of the 16-kDa c-type cytochrome The Table Features of the subunits of the Hme complex from A fulg...

Ngày tải lên: 21/02/2014, 03:20

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenho...

Ngày tải lên: 07/03/2014, 05:20

... mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding ... assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesoc...

Ngày tải lên: 07/03/2014, 11:20

... DNA with the oligonucleotides TG100 (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA ... and assayed as above Thiols were quantified by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the...

Ngày tải lên: 07/03/2014, 17:20

... nonterminal labels of the treebank g r a m m a r For example, our g r a m m a r maintains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of t ... (viz a year) or else a number Note t h a t all of these classifications were m a d e on the basis of the examination of concordances over a several-hundredtho...

Ngày tải lên: 08/03/2014, 07:20

... highest identity with the BAS1 protein of Brassica, spinach, barley and A thaliana, PR1 of Phaseolus and MHF of A thaliana These proteins belong to the 2Cys-Prx subfamily All plant 2Cys-Prx proteins, ... very weak when Trx m from Chlamydomonas was used (data not shown), probably because of the weaker af®nity of Arabidopsis NTR for Trx m [21] Therefore, the ability of T...

Ngày tải lên: 08/03/2014, 16:20

... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...

Ngày tải lên: 08/03/2014, 16:20

... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purifi...

Ngày tải lên: 14/03/2014, 23:20

... iron- and zinc-containing alcohol dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus J Bacteriol 181, 1163–1170 12 Shimizu Y, Sakuraba H, Kawakami R, Goda S, Kawarabayasi Y ... Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyp...

Ngày tải lên: 16/03/2014, 14:20