Development and characterization of a SARS coronavirus repli

Development and characterization of a SARS coronavirus replicon cell line

... detection of GFP-BlaR and GAPDH genes 47 iii 2.4.5 Sequencing of SARS- CoV replicon and sub -replicon RNAs RESULTS 48 50 3.1 Generation of SARS- CoV replicon RNA 51 3.2 Generation and analysis of SARS- CoV ... project was to construct a cell line carrying a SARS coronavirus (SARS- CoV) replicon, which is incapable of producing viral particles First, partia...

Ngày tải lên : 04/10/2015, 15:46

103
347
0

Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotI...

Ngày tải lên : 12/08/2014, 04:20

6
270
0

Design, fabrication, and characterization of a solenoidsystem to generate magnetic ﬁeld for an ECR proton source

... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... distance for (a) mirror magnetic field, and (b) flat magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma ch...

Ngày tải lên : 22/12/2013, 08:58

8
650
0

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT ... and will enable more detailed analysis of the exact reaction mechanisms The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space...

Ngày tải lên : 19/02/2014, 06:20

14
650
0

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from the local wetlands of Kanyakumari district, India The crabs used for experimental purpose were of either ... (1985) Purification and characterization of an O-acetyl sialic acid specific lectin from a marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13...

Ngày tải lên : 21/02/2014, 00:20

8
616
0

Tài liệu Báo cáo Y học: Identiﬁcation and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

... Dr Ake Engstrom at the Peptide Synthesis and Analysis Laboratory ¨ of the Department of Medical Biochemistry and Microbiology, Uppsala University The SP6 primer 5¢-ATT TAG GTG ACA CTA TAG-3¢ and ... its absorbance at 315 nm, appeared as a peak at 0.33 M MDEA and was essentially stable in this buffer at +4 °C for at least months The phosphate content of the The standard assay...

Ngày tải lên : 21/02/2014, 01:21

8
666
0

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... was observed (not shown) The arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome ... of an enzyme preparation containing only minor amounts of the 16-kDa c-type cytochrome The Table Features of the subunits of the Hme complex from A fulg...

Ngày tải lên : 21/02/2014, 03:20

10
564
0

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenho...

Ngày tải lên : 07/03/2014, 05:20

10
490
0

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding ... assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesoc...

Ngày tải lên : 07/03/2014, 11:20

16
542
0

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulﬁde reductase from Pyrococcus horikoshii Implications for the disulﬁde metabolism of anaerobic hyperthermophiles doc

... DNA with the oligonucleotides TG100 (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA ... and assayed as above Thiols were quantiﬁed by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the...

Ngày tải lên : 07/03/2014, 17:20

12
420
0

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... nonterminal labels of the treebank g r a m m a r For example, our g r a m m a r maintains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of t ... (viz a year) or else a number Note t h a t all of these classifications were m a d e on the basis of the examination of concordances over a several-hundredtho...

Ngày tải lên : 08/03/2014, 07:20

8
562
0

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... highest identity with the BAS1 protein of Brassica, spinach, barley and A thaliana, PR1 of Phaseolus and MHF of A thaliana These proteins belong to the 2Cys-Prx subfamily All plant 2Cys-Prx proteins, ... very weak when Trx m from Chlamydomonas was used (data not shown), probably because of the weaker af®nity of Arabidopsis NTR for Trx m [21] Therefore, the ability of T...

Ngày tải lên : 08/03/2014, 16:20

11
608
0

Báo cáo Y học: Identiﬁcation and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...

Ngày tải lên : 08/03/2014, 16:20

11
656
0

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... exclusively of AATs from prokaryotes, including AATs from proto- Identiﬁcation of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the puriﬁ...

Ngày tải lên : 14/03/2014, 23:20

13
490
0

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... iron- and zinc-containing alcohol dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus J Bacteriol 181, 1163–1170 12 Shimizu Y, Sakuraba H, Kawakami R, Goda S, Kawarabayasi Y ... Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyp...

Ngày tải lên : 16/03/2014, 14:20

8
415
0