0

a tế bào gốc toàn năng hay tế bào gốc thủy tổ totipotent stem cells

Bài giảng Tế bào gốc ppt

Bài giảng Tế bào gốc ppt

Điện - Điện tử

... bốn loại: - Toàn (hay thuỷ tổ) - Vạn - a - Đơn a/ Tế bào gốc toàn hay tế bào gốc thủy tổ (totipotent stem cells) ∗ Là tế bào có khả biệt h a thành tất loại tế bào thể từ tế bào ban đầu ∗ Trứng ... nuôi cấy so với tế bào gốc phôi chúng giai đoạn biệt h a cao B Nguồn lấy tế bào gốc ∗ Nguồn lấy tế bào gốc phôi ∗ Nguồn lấy tế bào mầm phôi tế bào gốc thai ∗ 3.Nguồn lấy tế bào gốc trưởng thành ... - Tế bào gốc trưởng thành a/ Tế bào gốc phôi (Embryonic stem cells- ESCs) tế bào mầm phôi (Embryonic germ cells) ∗ Tế bào gốc phôi tế bào gốc vạn lấy từ phôi giai đoạn sớm (4-7 ngày tuổi) ∗ Tế...
  • 50
  • 6,533
  • 106
Tế bào gốc và ứng dụng trong y sinh học (Stem cells and the application in biomedicine) potx

Tế bào gốc và ứng dụng trong y sinh học (Stem cells and the application in biomedicine) potx

Báo cáo khoa học

... thấy tế bào gốc tổ chức phôi, bào thai cá thể trởng thành Những tế bào gốc có nguồn gốc khác nh tế bào gốc phôi (bao gồm tế bào gốc từ phôi tế bào mầm từ tổ chức bào thai) tế bào gốc cá thể trởng ... tế bào máu tuần hoàn mang marker khác với tế bào gan, tuỷ xơng bào thai máu cuống rốn - Tế bào gốc bào thai tế bào mầm bào thai: từ 1985 có nhiều nghiên cứu thu đợc tế bào tiền thân dòng tế bào ... nh tế bào gốc tạo tế bào (myoblast), tế bào gốc tạo xơng (osteoblast) tế bào gốc tế bào thần kinh vi tóm lại Nghiên cứu tế bào gốc cho biết thể đợc hình thành, phát triển từ tế bào nh tế bào...
  • 14
  • 757
  • 2
Báo cáo y học:

Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps

Báo cáo khoa học

... amplify the truncated form of MsrA and introduce a BamHI cutting site at the 3’ end (MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-BamHI-rev: 5’-tggggccaaggatccgctttgaaagaacc) The amplicons were ... the total RNA extracted from cultured embryonic stem cells using the primer pairs of: MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-rev: 5’-atggccatcgggcaggaaactcc The 744bp DNA band was gel ... 5’-AGGTATTGCTGGTGGTAGTCTTC; Amplicon size: 395bp MsrA-truncated-for: 5’CGACCCGACCCAAGGTTCTTTCA; MsrA-truncated-rev: 5’-GCCATCGGGCAGGAA ACTCCAG; Amplicon size:168bp b-actin-for: 5’-CCACTGCCGCATCCTCTTCCTC; b-actin-for:...
  • 10
  • 309
  • 0
Báo cáo y học:

Báo cáo y học: "A recessive genetic screen for host factors required for retroviral infection in a library of insertionally mutated Blm-deficient embryonic stem cells" doc

Báo cáo khoa học

... HMSpBb-Sau3AI 5'-gat cCC ACT AGT GTC GAC ACC AGT CTC TAA (T)10C (A) 7-3' HMSpBb-FatI 5'-cat gCC ACT AGT GTC GAC ACC AGT CTC TAA (T)10C (A) 7-3' Splinkerette PCR primers AB949new 5'-GCT AGC TTG CCA AAC ... 5'-CGA TGA TGT AGG AGA GAA TCA GGT-3' mCAT1-exon4-F 5'-GTA CTT CAA GCG TGG CAA GAG-3' mCAT1-exon7-R 5'-CTG GTG GAA AGT GCG CAG AGA-3' mCAT1-exon8-F 5'-TCT CCT AGG CTC CAT GTT TCC C-3' mCAT1-exon12-R ... 5'-CTA TCA GCA TCC ACA CTG CAA A- 3' LacZ-Gsp2-R 5'-ATG TGC TGC AAG GCG ATT AAG-3' Genomic PCR primers Actb-exon4-up 5'-GTT TGA GAC CTT CAA CAC CCC-3' Actb-exon4-down 5'-GTG GCC ATC TCC TGC TCG AAG...
  • 11
  • 339
  • 0
stem cells - Tế bào gốc

stem cells - Tế bào gốc

Công nghệ - Môi trường

... LOẠITẾ TẾBÀO BÀOGỐC GỐC Tế bào gốc toàn Tế bào gốc vạn Tế bào gốc a Tế bào gốc đơn Stem cells 2.PHÂN PHÂNLOẠI LOẠITẾ TẾBÀO BÀOGỐC GỐC 1/ Tế bào gốc toàn hay tế bào gốc thủy tổ (totipotent stem cells) : ... LOẠITẾ TẾBÀO BÀOGỐC GỐC Tế bào gốc phôi (trong có tế bào gốc phôi thực thụ tế bào mầm phôi) Tế bào gốc thai Tế bào gốc trưởng thành Stem cells 2.PHÂN PHÂNLOẠI LOẠITẾ TẾBÀO BÀOGỐC GỐC 1/ Tế bào gốc ... VỀTẾ TẾBÀO BÀOGỐC GỐC Stem cells 1.KHÁI KHÁIQUÁT QUÁTVỀ VỀTẾ TẾBÀO BÀOGỐC GỐC Thuật ngữ tế bào gốc tất tế bào ch a biệt h a có khả phân chia thành loại tế bào Tế bào gốc sản sinh cặp tế bào...
  • 50
  • 288
  • 0
Báo cáo y học:

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Y học thưởng thức

... MTT absorbance values obtained after exposure, with the initial absorbance reading for the unexposed physiological control maintained at 37oC Raw absorbance values obtained for % survival MTT assay ... serial passages Their appearance was virtually indistinguishable from non-temperature exposed hESC (data not shown) Chromosomal Analysis of hESC after exposure to low temperature Metaphase spreads ... cells were washed off prior to the MTT assay From the raw absorbance values, the survival rate was computed by a simple formula based on reference to the initial absorbance value obtained for the...
  • 6
  • 477
  • 0
bien te bao goc phoi chuot thanh te bao mau

bien te bao goc phoi chuot thanh te bao mau

Y học thưởng thức

... biệt hoá thành tế bào gốc máu tế bào gốc máu tự nhiên chuột chết hoàn toàn trình chiếu xạ Như vậy, với thành công này, nhóm nghiên cứu chứng minh thay tế bào bị chết thể tế bào gốc Mong muốn TS ... hoá thành tế bào chuyên biệt (vẫn giữ đặc điểm ban đầu) Đây công đoạn khó khăn Tế bào trì từ vài tháng tới năm để xác định xem có thật tế bào gốc hay không có phải dòng tế bào ổn định hay không ... chục tế bào gốc ban đầu tách từ phôi nhân nuôi thành hàng vạn tế bào theo quy trình đặc biệt Kết kiểm tra hình thái tế bào chất thị hoá mô chứng minh tế bào tách từ phôi chuột tế bào gốc Trước...
  • 10
  • 411
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Báo cáo khoa học

... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL-1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...
  • 11
  • 653
  • 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học

... 5¢GGTACCTATATAGGT GACTTACATA-3¢ and DS: 5¢CACCTAAGACACTGTG GAAGAGCAG-3¢; mouseHS2 US: 5¢GGGTCTCTCTA GGAGGAAGTCCACAGG-3¢ and DS: 5¢CAGATCTAAT GACCCTAACTCTAAC-3¢; mouse bmajor US: 5¢GGT GCACCTGACTGATGCTGAGAAG-3¢and ... TTTCCCTGATGAGGATTCAATGG-3¢ and DS 5¢-CCC ACACATGGTCATCTATCTGAGC-3¢; mouse HS2 core: US 5¢-TTCCTACACATTAACGAGCCTCTGC-3¢ and DS 5¢AACATCTGGCCACACACCCTAAGC-3¢; ⁄ 2flank, US 5¢-CTATTTGCTAACAGTCTGACAATAGAGTAG-3¢ ... bmajor-globin: US 5¢-AAGCCTGATTCCGTAG AGCCACAC-3¢ and DS 5¢-CCCACAGGCAAGAGACA GCAGC-3¢; mouse ec-globin: US 5¢-CAAAGAGAGTTT TTGTTGAAGGAGGAG-3¢ and DS 5¢-AAAGTTCACCA TGATGGCAAGTCTGG-3¢; mouse HS3...
  • 10
  • 422
  • 0
Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx

Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx

Báo cáo khoa học

... essential for de novo methylation and mammalian development Cell 99, 247–257 33 Tsumura A, Hayakawa T, Kumaki Y, Takebayashi S, Sakaue M, Matsuoka C, Shimotohno K, Ishikawa F, Li E, Ueda HR et al ... K, Abe T, Nakano T, Asami T, Ebisuzaki T, Held WA, Yoshida S & Nagase H (2003) Global methylation screening in the Arabidopsis thaliana and Mus musculus genome: applications of virtual image ... Martins-Silva J & Saldanha C (2003) Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects Biochem Pharmacol 65, 1035–1041 19 Wakayama T & Yanagimachi...
  • 7
  • 439
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học

... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... 247–256 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M et al (2005) Human mesenchymal stem cells xenografted directly to rat liver are differentiated ... regulated by differential roles of Cdc42 and Rac1 Dev Cell 7, 425–438 33 Hatada I, Fukasawa M, Kimura M, Morita S, Yamada K, Yoshikawa T, Yamanaka S, Endo C, Sakurada A, Sato M et al (2006) Genome-wide...
  • 14
  • 597
  • 0
báo cáo hóa học:

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

Hóa học - Dầu khí

... Yamahara, Jun Yamashita K, Takami Yurugi-Kobayashi, Akane Nonoguchi, Yutaka Suzuki, TingHsing Chao, Naoki Sawada, Yasutomo Fukunaga, Kazutoshi Miyashita, Kwijun Park, Naofumi Oyamada, Naoya Sawada, ... Sawada, Yasutomo Fukunaga, Masakatsu Sone, Kenichi Yamahara, Takami Yurugi-Kobayashi, Kwijiun Park, Naofumi Oyamada, Naoya Sawada, Daisuke Taura, Hirokazu Tsujimoto, Ting-Hsing Chao, Naohisa ... AGAGCGACCCTCACATCAAG (forward) and TCGTTTCAGTGCCACATACC (reverse); human hepatic growth factor (HGF, Genbank accession No.X16323), 5'-AGTCTGTGACATTCCTCAGTG-3' (forward) and 5'-TGAGAATCCCAACGCTGACA-3'...
  • 14
  • 450
  • 0
báo cáo hóa học:

báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc

Hóa học - Dầu khí

... for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze continuous variables: time latency, ... collected and analyzed data KST interpreted data and wrote the manuscript CRS, JL and HH acquired data FZC analyzed and interpret data YHA designed the study and approved the manuscript Additional material ... pre-clinical and clinical studies showed that allograft could be an alternative nerve graft [2,7,21] Nerve allograft may act as a temporary scaffold across which host axons regenerate Natural or synthetic...
  • 11
  • 1,027
  • 0
báo cáo hóa học:

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

Hóa học - Dầu khí

... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... reagent and the RNA quality was tested with the Agilent Bioanalyzer 2000 (Agilent Technologies, Santa Clara, CA) The RNA was amplified into antisense RNA (aRNA) as previously described[80] Total ... 26(2):356-363 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al.: Reduced expression of the let-7 microRNAs in human lung cancers in association...
  • 17
  • 593
  • 0
báo cáo hóa học:

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

Hóa học - Dầu khí

... CACTAGCCTGTGGAGCAAGATGAA CGCTTCTGGAACGTCTGAGGTTAT TGTCCACTCCTGATGCTGTTATGG GGTCTCAAGTCAGTGTACAGGTAAGC GGTGTGCCAAAGTTGCCAATACAC CACCGTGTCAAGATTGGGAATGCT CCAGCATCACATCTCAAACAGCAC TGTTCCCAGCATTTCACACTATGG AAGAGGCAGCTGGTGATAAGGGTT ... AAGAGGCAGCTGGTGATAAGGGTT ATTTGTGGAGGGCGAGGTCATAGA AAGTCTTCAGCAGAGGGTCACGTA ATCAGCACTCCCAGCAGAGT ATCCGACAGAGGTGAGATGG AATCACCATCACGTTACCCAGGAG CCAGGAGCTTGAAGTTCTCAGGAT AGCTTAGTGATACTTGTGGGCCAG ... CCATTGCTGTTGTTGCAGGGAAGT CCCATGGTGGGTTGTCATATATTCATGT CCTCTACTCCAGTAAACCTGATTGGG AAATCCTCTTCCTCTGAGGCTGGA ATCATTTCTAGCGCATGGCCTGGT AAGGGCACAGCATCTGTAGTCA CGCTGTCTTCCTTCTGAACC CTCTGAGACGCCATGTTCAA CACTAGCCTGTGGAGCAAGATGAA...
  • 10
  • 409
  • 0
báo cáo hóa học:

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

Hóa học - Dầu khí

... São Paulo, Brazil) Unconjugated markers were reacted with anti-mouse PE secondary antibody (Guava Technologies, Hayward, CA) Unstained cells were gated on forward scatter to eliminate particulate ... Costa AM, Martins MT, Kobayashi GS, Zucconi E, Fanganiello RD, Salles FT, Almeida AB, Amaral CE, Alonso N, Passos-Bueno MR: New Source of Muscle-Derived Stem Cells with Potential for Alveolar ... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational...
  • 10
  • 456
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx

Điện - Điện tử

... Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of human adipose tissue mesenchymal stem cells after transplantation ... in animals after acute lung IR Additionally, the number of alveolar sacs was significantly decreased, whereas the crowded score of lung parenchyma was substantially increased in the animals after ... of ADMSC therapy on arterial oxygen saturation (Sat O2 ), carotid arterial blood gas was analyzed prior to left thoracotomy and at 72 h after the IR procedure RVSBP, an indicator of pulmonary arterial...
  • 13
  • 280
  • 0
báo cáo hóa học:

báo cáo hóa học:"Transplantation of selected or transgenic blood stem cellsa future treatment for HIV/AIDS?" pot

Hóa học - Dầu khí

... CCR5delta32 status appears to have several beneficial effects on the alloHSCT setting: previous analyses revealed that the CCR5-delta32 allele appears to protect against acute graft versus host disease ... 91(12):1628-1634 Bogunia-Kubik K, Jaskula E, Lange A: The presence of functional CCR5 and EBV reactivation after allogeneic haematopoietic stem cell transplantation Bone Marrow Transplant 2007, 40(2):145-150 ... homozygous carriers is in the range of 1% to 3% among caucasians Future approaches to HIV therapy by CCR5-negative alloHSCT may thus be limited by the availability of HLA-matched donors in general and...
  • 5
  • 206
  • 0
Thay đổi đơn giản biến tế bào thành tế bào gốc phôi pptx

Thay đổi đơn giản biến tế bào thành tế bào gốc phôi pptx

Điện - Điện tử

... mang hỗn hợp DNA phôi gốc lẫn tế bào iPS toàn thể "Năm trước không thoải mái với từ "vạn năng" , Hans Scholer, chuyên gia tế bào gốc Viện Max Planc nói Tuần v a qua, Yamanaka đ a hệ iPS thứ hai, ... tế bào thể Yamanaka gọi chúng tế bào gốc vạn cảm ứng (iPS cells) "Dễ bỡn Chẳng có phép màu cả." Yamanaka nói Kết mang lại nhiều ngạc nhiên hoài nghi Bốn nhân tố dường Và tế bào có đặc điểm tế ... trứng hay phôi Và ch a làm việc với chúng" Shinya Yamanaka đại học Kyoto, người tiên phong kỹ thuật nói Năm ngoái Yamanaka người sử dụng kỹ thuật người ta dùng tế bào xơ chuột, loại tế bào phổ...
  • 14
  • 362
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25