a small portion of the excel object model the tag lt vx gt means that the object is new in version x of excel
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, P21(reverse): ... protein or the 55 kDa CDK9 protein, a minor isoform containing an amino terminal extension that arises from an upstream transcriptional start site [7] These CDK9 proteins are associated with a regulatory...
- 16
- 178
- 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... serine protease family, testisin and prostasin, are also expressed in ovarian carcinomas [31,32] Immunohistochemical analysis demonstrated the expression of prosemin in clinical ovarian carcinomas, ... RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas The characterization and functions of prosemin are described ... sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen)...
- 13
- 483
- 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... 4.3 and 7.3 mgÆdL)1) This indicates that the genetic basis of APA is complex and other genetic and/or biological factors are involved in the occurrence of APA The structural organization of the ... Trisborate and mM EDTA) at a constant voltage of 190 V, then dried and autoradiographed using intensifying screens The concentration of nuclear protein extracts used in each reaction was lg and ... starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) as described above The 696 bp long PCR amplified fragment...
- 9
- 462
- 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt
... may read as follows (paraphrasing O'Boyle [24]): "Meaning in life is what the individual says it is" Abbreviations IoW Index of Weighting IoS Index of Satisfaction IoWS Index of Weighted Satisfaction ... Table 2: Areas of MiL listed by the respondents (n = 856) Included are number and percentage of the listings as well as mean and standard deviation (SD) of the importance and satisfaction ratings ... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland,...
- 8
- 382
- 0
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx
... (PAP), was inserted through the introducer into the left jugular vein This catheter was positioned with the proximal port in the right atrium and the distal port and thermistor in the pulmonary ... the increase in rPV of D40 group was lower than that of HSS group at the end of the fluid infusion, the increases in rPV remained up to 10% Dextran 40 and hypertonic saline in calf higher than ... Kazuyuki Suzuki et al kg Healthy calves were selected on the basis of physical examination, electrocardiography and hematological analysis A well-balanced growth diet consisting of pelleted...
- 6
- 366
- 0
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx
... problem is a language L ⊆ Σ* × Σ*, where Σ is a finite alphabet and Σ* is the set of all strings over that alphabet The second component is called the parameter of the problem Practically, the parameter ... the existing solution [9] cannot satisfy the additional parity constraints We present an algorithm that solves the problem while still satisfying the additional constraints, and thus show that ... there are no data missing and no data errors We prove that our problem can be reduced to the problem of finding the line index of a signed graph [8] with additional parity constraints We further...
- 8
- 241
- 0
Efficient texture synthesis with a small set of tiles
... Kwatra03] always focus on eliminating the line seams in small rectangular overlapping regions Although such a method can find a heuristic solution to adapt the pixel values among the rectangular ... application is the focus of this thesis, though our results can be used in the first application In the past decade, a wave of algorithms has been explored in texture synthesis Many approaches of ... decrease the local difference around the discontinuous area in image In generating a good Wang tile, a cutting path approach [Efros01] is applied to combine a set of four patches that Chapter Introduction...
- 70
- 235
- 0
Neither of the children is interested in learning pptx
... chung; danh từ số nhiều “child” – đ a bé, đ a trẻ - Cách chia động từ: Sau “neither of ” động từ chia số hay số nhiều Ví dụ: “Neither of the children is (are) interested in learning” Không đ a bọn ... *Neither of the children is interested in learning • Hình thức cấu trúc ngữ pháp: Neither of + the/ these/ those…/ my/ your/ his … + N (số nhiều)” – không (trong hai cái), không người (trong hai ... tích - “Neither of the children” - không đ a bọn trẻ - is interested in learning” – thích học Cấu trúc từ “to be interested in + Ving” = “to be fond of + V-ing” = “to be keen on + Ving” – thích,...
- 5
- 376
- 0
Báo cáo khoa học: Modulation of the endocannabinoid system by focal brain ischemia in the rat is involved in neuroprotection afforded by 17b-estradiol pdf
... D Amantea et al Endocannabinoids are amides, esters and ethers of long-chain polyunsaturated fatty acids that are synthesized on demand Anandamide (arachidonoylethanolamide) (AEA) was the first ... downregulation of FAAH and upregulation of NAPE-PLD activity lead to increased levels of AEA, which in turn may play a role in the pathophysiology of damage occurring in the ischemic brain More interestingly, ... 1121–1132 Yamaji K, Sarker KP, Kawahara K, Iino S, Yamakuchi M, Abeyama K, Hashiguchi T & Maruyama I (2003) Anandamide induces apoptosis in human endothelial cells: its regulation system and clinical...
- 12
- 460
- 0
Báo cáo y học: "’Choosing shoes’: a preliminary study into the challenges facing clinicians in assessing footwear for rheumatoid patients" pot
... to financial constraints of purchasing ‘good’ footwear, i.e direct costs to the patients Furthermore, RA is a painful and distressing condition that can affect all ages and have a major impact ... characteristics we found that the majority of patients wore shoes that had an adequate heel height On examining the fastening mechanism of the footwear, one strap/buckle was found in nearly 50% of ... Auckland, New Zealand One examiner (RS) interviewed and assessed all patients Patients were eligible if they had a diagnosis of RA according to the 1987 American Rheumatism Association revised...
- 8
- 347
- 0
Báo cáo khoa học: "Prolonged refractory status epilepticus following acute traumatic brain injury: a case report of excellent neurological recovery" docx
... anesthetics, intravenous ketamine and newer anticonvulsant agents including topiramate may be considered [27] In cases where a localized area is causing the seizure, surgery has been used as a last resort ... support patients for indefinite periods of time exists This then raises the ethical issue of defining the duration of therapy beyond which the treatment of RSE is considered futile Bramstedt and colleagues ... ketamine infusion up to mg/kg/hour and inhalational isoflurane with a minimum alveolar concentration of 1.0% did not result in ameliorating the RSE when burst suppression was interrupted On day...
- 4
- 183
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the ... BPA was outlawed from manufacturing of baby bottles in EU and Canada [49] Cleaning agents may contain a pool of solvents, detergents, fragrances, disinfectants, etc., many of which may cause allergy, ... causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark...
- 58
- 262
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... (1–4) indicates the oxidation stage represented by the line apparent that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that ... very small As observed for the case of phosphate binding, the signals for intermediate redox stages and of haems III and IV are the more affected This suggests that the binding of phosphate and ... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the...
- 10
- 640
- 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... quiescence, they survive for several years without oxygen This is arguably the ultimate indifference to anoxia of any metazoan [42], and qualifies the organism, as other of its characteristics, as an extremophile ... Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership Plan Grant, and a Heart and Stroke Foundation of Nova Scotia Grant...
- 15
- 515
- 0
Báo cáo khoa học: "A COMPUTATIONAL MODEL OF THE SYNTAX-PROSODY INTERFACE IN TOKYO JAPANESE" doc
... phrase is justified phonetically as the domain of downstep; the precise character of major phrases is a point at issue in this paper The diagram is annotated according to the notation of Pierrehumbert ... verbal - adverbial waratte (laugh-and), amaku (sweetly) verbal - adnominal warau (that laughs), amakatta (that was sweet) The syntactic rules define three ways of building signs (3) shows rule A ... phrase In fact, in minor phrases with a late accent, this early peak is also distinguishable, so this "phrasal' tone can be assumed present in all minor phrases Note the phonetic justification of...
- 8
- 484
- 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx
... over his pajamas, and approach the bed “What on earth is the matter?” he said He also laid hands on Maria, and, at his touch, she became able to move “What on earth is the matter?” he asked again ... that anything human, in fact, was making such a noise, and yet no animal could have made it, for it was articulate Her mother was in fact both praying and repeating verses of Scripture, in that ... woman, and which is primeval, involving the adoration and awe of womanhood itself The boy had not reached the age when he was capable of falling in love, but he had reached the age of adoration,...
- 488
- 398
- 0
THE REFORM OF THE SAVINGS BANK SYSTEM IN FRANCE – A MODEL FOR OTHER COUNTRIES? docx
... local savings companies at its disposal since 1999 These are not involved in the financial business but are closely associated with the savings banks in a legal and practical sense The local savings ... in France Although not independent institutions, they are invariably attached to the savings bank in the region in which they operate In this way, several savings companies are attached to each ... – The legal and actual conversion of the savings banks into cooperatives, – The use of the revenues accruing from the sale of the shares of the cooperative savings banks, – The corporate aim of...
- 6
- 436
- 0
Báo cáo hóa học: " Predictors of quality of life: A quantitative investigation of the stress-coping model in children with asthma" pptx
... decides what can be done to deal with the situation (secondary appraisal) An event is appraised as stressful when primary appraisals exceed secondary appraisals, and by using coping processes a person ... variables were examined for multi- and univariate outliers, missing values, normality, and linearity Missing data were excluded list-wise Pearson correlations were used to examine the associations ... characteristics, appraisal of the disease, coping, and quality of life are all significantly related to each other This part of the extended stress-coping model might be seen as a representation...
- 9
- 336
- 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and ... cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized sections were incubated at...
- 10
- 478
- 0
Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot
... seven individual miniaturized cell culture chambers in each cultivation segment guarantee a statistical analysis of the generated data The MCC represents an array of miniaturized cell culture chambers ... promoter activations that is based on the analysis of individual cells within a population It has been described that the physical properties of nanoscale materials can interfere with the analysis of ... (Zeiss, Jena, Germany) using exFDA 470 nm/emFDA 525 nm and exFDA 555 nm/ emFDA 602 nm The percentage of the viable and dead cells was analyzed using the cell imaging analysis software Time-lapse...
- 14
- 632
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25