Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells Shinichi Mitsui1,*, Akira Okui2, Katsuya Kominami2, Eiichi Konishi1, Hidetoshi Uemura2 and Nozomi Yamaguchi1 Department of Cell Biology, Research Institute for Geriatrics, Kyoto Prefectural University of Medicine, Kyoto, Japan Research and Development Center, Fuso Pharmaceutical Industries Ltd, Morinomiya, Joto-ku, Osaka, Japan Keywords cerebellum; chromosome 16; ovarian cancer; tumor marker Correspondence N Yamaguchi, Department of Cell Biology, Research Institute for Geriatrics, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Fax: +81 75 251 5848 Tel: +81 75 251 5797 E-mail: nozomi@koto.kpu-m.ac.jp *Present address Department of Neurobiology and Anatomy, Kochi Medical School, Okou, Nankoku 7838505, Japan Database The nucleotide sequence reported in this paper has been entered in the DDBJ ⁄ GenBank ⁄ EMBL databases under accession no AB010779 (Received 25 November 2004, revised July 2005, accepted August 2005) We have isolated a cDNA that encodes a novel serine protease, prosemin, from human brain The cDNA of human prosemin is 1306 bp, encoding 317 amino acids It showed significant homology with the sequence of a chromosome 16 cosmid clone (accession no NT_037887.4) The prosemin gene contains six exons and five introns The amino acid sequence of prosemin shows significant homology to prostasin, c-tryptase, and testisin (43%, 41%, and 38% identity, respectively), the genes of which are also located on chromosome 16 Northern hybridization showed that prosemin is expressed predominantly in the pancreas and weakly in the prostate and cerebellum However, western blot and RT-PCR analyses showed that prosemin is expressed and secreted from various kinds of cancer cells, such as glioma, pancreas, prostate, and ovarian cell lines Prosemin is secreted in the cystic fluid of clinical ovarian cancers Furthermore, immunohistochemistry showed prosemin protein localized in the apical parts of ovarian carcinomas Recombinant prosemin was expressed in COS cells and was purified by immunoaffinity chromatography Recombinant prosemin preferentially cleaved benzyloxycarbonyl (Z)-His-Glu-Lys-methylcoumaryl amidide (MCA) and t-butyloxycarbonyl (Boc)-Gln-Ala-Arg-MCA Our results suggest that prosemin is a novel serine protease of the chromosome 16 cluster that is highly expressed in the pancreas The usefulness of this serine protease as a candidate tumor marker should be further examined doi:10.1111/j.1742-4658.2005.04901.x Serine proteases play important roles in a variety of physiological processes, such as blood coagulation, growth factor processing, the digestion of nutrients, and cell migration, when cells move to the target organs and reconstitute extracellular matrices, especially during developmental stages In the central nervous system (CNS), serine proteases are believed to be involved in various neuronal functions [1] Tissue-type plasminogen activator is essential for memory formation and seizures [2,3] Knockout mice lacking neuropsin ⁄ KLK8, a member of the kallikrein family, have a reduced number of active synapses [4] On human and mouse genomes, over 500 proteases are encoded [5] and some proteases other than plasminogen activator and neuropsin may contribute to neuronal function We have recently reported a novel transmembrane Abbreviations Boc, t-butyloxycarbonyl; Bz, benzoyl; CNS, central nervous system; Glu(Obzl), glutamic acid c-benzyl ester; Glp, L-pyroglutamyl; MCA, 4-methylcoumaryl-7-amidide; NHS, N-hydroxysuccinimide; Z, benzyloxycarbonyl FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS 4911 A novel serine protease in various cancer cells serine protease, spinesin ⁄ TMPRSS5, which is localized at synapses [6] Motopsin (PRSS12) is a mosaic serine protease, with a kringle domain and three scavenger receptor cysteine-rich domains, that is expressed preferentially in motor neurons [7,8] Some novel members of the kallikrein family have also been reported Hippostasin (KLK11) is expressed in hippocampal pyramidal neurons and shows kallikrein-like enzyme activity [9] Another kallikrein-like protease, neurosin (KLK6), which has trypsin-like activity, is secreted by activated microglial cells and localized on senile plaques and Lewy’s bodies [10,11] We have shown that the alternative splicing of neuropsin ⁄ KLK8 is regulated in a tissue-specific manner [12] These proteases are thought to play important roles in neuronal functions via the digestion of extracellular matrices, the processing of growth factors, and the activation of cell-surface receptors However, such proteolytic phenomena occur markedly in tumor cells as well as in the CNS Some of the proteases described above have been reported to be tumor markers, although they are expressed predominantly in the CNS Neuropsin was identified as a serine protease that is overexpressed in ovarian carcinomas, although its mRNA is detected negligibly in normal ovaries [13,14] Serum neurosin levels are elevated specifically in patients with ovarian cancer [15] Furthermore, we have previously reported that the alternative splicing of hippostasin is regulated in a cancer-specific manner [16] In addition, serum levels of hippostasin are increased in patients with ovarian and prostate cancers [17] Other kallikreins are aberrantly expressed in many types of cancers and their expression is often associated with patient prognosis (reviewed in [18–20]) Here, we describe a novel member of the chromosome 16 serine protease family Prosemin cDNA was isolated from a human brain cDNA pool Immunochemical and RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas The characterization and functions of prosemin are described Results cDNA cloning and structure of the prosemin gene We isolated a cDNA of 958 bp that encodes a novel serine protease of 317 amino acids from human brain cDNA pool The predicted amino acid sequence includes a serine protease motif, and this protein was designated ‘prosemin’, as this protein was first detected in seminal fluid (data not shown) A BLAST search 4912 S Mitsui et al of the human genome draft sequence showed that this gene is located on chromosome 16p13.3 (NT_037887.4) Although human prosemin cDNA was isolated from the brain, northern hybridization showed that prosemin is expressed strongly in the pancreas, but weakly in the prostate and cerebellum (Fig 4) The nucleotide sequences of the cDNA and the cosmid clone are identical A comparison of the cDNA and genomic sequences clarified the gene structure of human prosemin (Fig 1) The prosemin gene is approximately 6.5 kb, and contains six exons and five introns All exon–intron boundaries are consistent with the GT– AG rule The exons range in size from 27 to 601 bp The second exon encodes only nine amino acids, which constitute part of the pro-enzyme fragment The initiation codon is consistent with Kozak’s consensus sequence [21] Although we did not determine the transcription initiation site, the 5¢ UTR appears to be longer than 67 bp because the primer for the first PCR used to isolate the full-length cDNA was designed to hybridize with that position (at 991 in Fig 2) Further, homology search showed that our sequence contained the longest 5¢ UTR when compared with EST sequences Several transcription regulatory elements occur within 1.2 kb upstream from the first exon: three AP-1 sites, a CREB binding site, and a NF-jB binding site There is no typical TATA or CAAT box in the putative promoter region The putative signal sequence is encoded by the first exon, and the pro-enzyme fragment is encoded by exons and The catalytic triad, His, Asp, and Ser, is encoded in exons 3, 4, and 6, respectively Exon contains a polyadenylation signal Structure of human prosemin The predicted amino acid sequence of prosemin shows that this protein belongs to the chymotrypsin (S1) family and may be synthesized as a prepro form Hydropathy plot analysis showed that the 32 amino acids of the N-terminus constitute a putative signal sequence (data not shown) A typical serine protease activation motif is also conserved at Arg49-Val-Val-Gly-Gly, suggesting that the 17 amino acids from Ala33 to Arg49 might comprise the pro-fragment of prosemin A possible N-glycosylation site occurs at Asn70 in the catalytic domain The essential triad for protease activity was identified at His90, Asp141, and Ser242 An aspartate residue six amino acids before the active Ser242 suggests that prosemin has trypsin-like activity In addition to a similarity in gene structure, a homology search of the SWISSPROT protein database showed significant similarity between prosemin and prostasin, c-tryptase, and testisin, with 43%, 41%, and 37.5% FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS Fig Gene structure and amino acid sequence of human prosemin Exons and putative cis-acting elements in the promoter region are boxed The exon–intron boundary consensus sequences and the polyadenylation signal are indicated by double and single underlines, respectively The consensus amino acids for serine proteases are shown in white letters An arrow and circle indicate the putative processing site and the N-glycosylation site, respectively The genomic sequence is derived from cosmid clone 325D7 taken from GenBank S Mitsui et al FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS A novel serine protease in various cancer cells 4913 A novel serine protease in various cancer cells identity, respectively (Fig 2) Amino acid alignment of these proteases shows that 10 of the 12 cysteine residues in the prosemin zymogen are conserved among these proteases Cys41 is predicted to form a disulfide bond with Cys175, as in other S1 proteases, whereas the a-, b-, and d-tryptases not contain a cysteine S Mitsui et al residue in the pro-enzyme fragment However, prosemin does not contain a hydrophobic region at the carboxyl terminus This portion is apparently different from the corresponding regions of prostasin, c-tryptase and testisin, which anchor the proteins to the plasma membrane Fig Amino acid alignment of the chromosome 16 serine protease family White letters indicate amino acids identical to those in human prosemin Asterisks show the amino acids conserved among the seven proteases Dashes denote gaps The essential triad and peripheral sequences are indicated by lines Cys41 in the pro-enzyme fragment may form a disulfide bond with Cys175 in the catalytic domain 4914 FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS S Mitsui et al A novel serine protease in various cancer cells Enzyme activity of human prosemin To analyze the enzyme activity of prosemin, recombinant prosemin was expressed in COS cells In our system, the putative catalytic domain was fused with the preproenzyme fragment of human trypsinogen Recombinant prosemin was secreted into the conditioned medium and purified by immunoaffinity chromatography SDS ⁄ PAGE of purified prosemin produced a single band of 33 000 Da, which reacted with anti-prosemin IgG (Fig 3A) Purified prosemin still contained the proenzyme fragment of trypsinogen and was activated by enterokinase (Fig 3B–D) Activated prosemin cleaved a A D B fluorescent substrate [t-butyloxycarbonyl (Boc)-GlnAla-Arg-4-methylcoumaryl-7-amidide (MCA)], whereas preactivated recombinant prosemin and enterokinase showed no activity against the same substrate SDS ⁄ PAGE showed that enterokinase treatment of recombinant prosemin caused a decrease in the molecular mass from 33 000 to 31 000, indicating successful digestion of the artificial trypsinogen pro-enzyme fragment The amount of 31 kDa prosemin increased in proportion to the time of incubation with enterokinase Prosemin activity appeared to be related to the amount of 31 kDa protein, although extended incubation caused some degradation of the recombinant prosemin, C E F Fig Enzymatic characterization of recombinant prosemin (A) SDS ⁄ PAGE of purified recombinant prosemin Anti-prosemin IgG raised against a synthetic peptide recognized this protein (lane 1) Purified prosemin was detected as a single band by silver staining (lane 2) (B) After activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated times White and shadowed bars indicate before and after activation by enterokinase, respectively Black bars indicate the enzymatic activity of enterokinase on the substrate The closed circles and line indicate prosemin enzyme activity after activation of the protein by enterokinase; the enzymatic action of enterokinase upon the substrate has been subtracted Mean values and standard deviations (SD; n ¼ 3) are indicated (C) Activation of recombinant prosemin by enterokinase Purified recombinant prosemin was incubated with enterokinase at 37 °C for (lane1), (lane 2), 24 (lane 3), 48 (lane 4) h After incubation, the recombinant protein was visualized by silver staining after SDS ⁄ PAGE (D) The enzymatic activity of prosemin activated for various times was measured at 37 °C using the substrate Boc-Gln-Ala-Arg-MCA (E) Recombinant prosemin activated for 24 h was incubated with the indicated substrates for h at 37 °C Mean values and SD are shown (n ¼ 3) (F) Activated prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for h at various pHs Phosphate buffer (0.1 M) and Tris ⁄ HCl (0.1 M) buffer were used for pH 5.0–9.0 and pH 9.0–11.0, respectively Mean values and SD are shown (n ẳ 3) FEBS Journal 272 (2005) 49114923 ê 2005 FEBS 4915 A novel serine protease in various cancer cells S Mitsui et al A B Fig Expression of prosemin in normal human tissues (A) Northern hybridization was carried out overnight at 65 °C Strong signal was detected in the pancreas, and weak signals were observed in the prostate and cerebellum (B) Expression of prosemin mRNA was analyzed by RT-PCR A specific band of the expected size was detected in most human tissues (arrowhead) including autodegradation These results indicate that the detected activity derived from the activated recombinant prosemin At pH 8.0, recombinant prosemin the most preferentially cleaved benzyloxycarbonyl (Z)-His-Glu-LysMCA, and it showed high enzymatic activity against Boc-Gln-Ala-Arg-MCA and Boc-Glu(Obzl)-Ala-ArgMCA, which are substrates for trypsin and factor XIa, respectively, and weakly cleaved Boc-Val-Pro-ArgMCA, Pro-Phe-Arg-MCA, l-Pyroglutamyl (Glp)-ArgMCA, and Boc-Phe-Ser-Arg-MCA (Fig 3E) The optimum pH for prosemin activity was investigated using Boc-Glu-Ala-Arg-MCA as substrate (Fig 3F) Activated recombinant prosemin showed no enzymatic activity at pH < 6.0 Prosemin showed maximum enzymatic activity at pH 8.0–9.0, and showed about half maximal activity at pH > 10.0 Expression of prosemin mRNA in normal human tissues Prosemin mRNA of 1.4 kb was expressed strongly in the pancreas and weakly in the prostate and cerebel4916 lum (Fig 4A) We isolated a cDNA fragment encoding prosemin from a human brain cDNA pool However, prosemin mRNA was detected only in the cerebellum It was not detected in other regions of the brain, such as the thalamus, substantia nigra, hippocampus, corpus callosum, caudate nucleus, or amygdala (data not shown) However, using RT-PCR, we detected prosemin mRNA in most human tissues except the hippocampus and liver (Fig 4B) The levels of prosemin expression are very low in these tissues Prosemin expression in various cancer cell lines Recently, some serine proteases, including testisin and prostasin, have been reported as tumor markers The expression of prosemin in cancer cell lines was analyzed Immunoblotting using anti-prosemin IgG detected a protein of 33 kDa, which is identical to the molecular mass of recombinant prosemin, in conditioned medium from some human cancer cell lines (Fig 5A) A 20 kDa protein was detected in some cell lines, such as HPC-Y0, HPC-YS, SKOV-3, OVK-18, DU-145, U373, KHG2, HOG, KP-N-YN, Colo38, FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS S Mitsui et al A novel serine protease in various cancer cells A B C Fig Secretion of prosemin protein and expression of prosemin mRNA in various kinds of cancer cells (A) Conditioned medium (25 lg) from various cancer cell lines was used for western blot analysis with antibody raised against a synthetic prosemin peptide A 33 kDa immunoreactive protein (black arrowhead) and a 20 kDa protein (white arrowhead) were detected (B) RT-PCR for prosemin mRNA in cancer cell lines The predicted size of the PCR product was 500 bp and the specific PCR product was detected in various kinds of cell lines It should be noted that Ishikawa, OVK-18, and HUE showed no band or weak bands, which is consistent with the results of the western blot analysis (C) Western blot analysis of cancerous fluid from clinical ovarian cancers Immunoreactive protein was detected in the cystic fluid as a 30 kDa protein (lanes 2,3), whereas recombinant prosemin produced a 33 kDa band (lane 1) and OUR-10, although the 33 kDa protein was not detected Either the 33 kDa or the 20 kDa protein was detected in all 11 pancreatic cancer cell lines and four colon cancer cell lines An immunoreactive 20 kDa protein was detected in both of two prostate cell lines, two of three ovarian cell lines, and one of three lung cancer cell lines There was no detectable protein in the conditioned media from some cell lines: SKLU1, K562, HUE, Ishikawa-EM, and glioma Ishikawa RTPCR was used to confirm the expression of prosemin mRNA in some cell lines A band of the predicted size (500 bp) of the PCR product was observed for most of the cell lines tested, including HPC-YO and HPC-YS, in which only the 20 kDa protein was detected (Fig 5B) However, no PCR product was detected in Ishikawa, a glioma line HUE and OVK18 expressed low levels of prosemin mRNA The transcript levels of prosemin suggested by RT-PCR analysis were consistent with the results of western blot analysis, although RT-PCR is relatively nonquantitative A431, DU-145, and LNCap showed some smaller bands, which may reflect splicing variants because we identified eight FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS splicing variants during the PCR cloning process (S Mitsui, A Okui, K Kominami, E Konishi, H Uemura and N Yamaguchi, unpublished data) The expression pattern of prosemin in cancer cell lines is summarized in Table Immunohistochemical detection of prosemin in ovarian cancer Western blot analysis and RT-PCR indicated the expression of prosemin in ovarian cancer cell lines Ovarian cancers express some kinds of chromosome 16 serine proteases, including testisin and prostasin We investigated the expression of prosemin in ovarian cancers using immunohistochemistry Western blot analysis showed that prosemin occurred in ovarian cystic fluids (Fig 5C) As shown in Fig 6, immunoreactive prosemin was localized at the apical portion of carcinoma cells, whereas nonimmune serum produced no signal This localization was identical in mucinous and serous adenocarcinomas The strong expression of prosemin in serous carcinomas is noteworthy Three of 4917 A novel serine protease in various cancer cells S Mitsui et al Table Expression and secretion of prosemin from cancer cell lines ND, not determined Western blot of conditioned media Cell line Tissue 33 kDa 20 kDa RT-PCR HPC-Y0 HPC-Y3 HPC-Y5 HPC-Y9 HPC-Y25 HPC-YS HPC-YT AsPC-1 Capan I Capan II BxPC-3 HUE A431 Clo201 WiDr SW1119 Colo38 A549 SKLU QG MCF-7 T3M-1 Chang K562 OUR-10 KP-N-YN HOG Ishikawa KHG2 U373 Ishikawa-EM OVK-18 SKOV-3 HOC-Y1 PC-3 DU-145 Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Endothelium Vulva Colon Colon Colon Colon Lung Lung Lung Breast Thyroid Liver Blood Kidney Neuron Oligodendroglioma Glioma Glioma Glioma Endometrium Ovary Ovary Ovary Prostate Prostate – + + + + – – + – + – – + + + – – – – + + + – – – – – – – – – – – – – – ++ + + + + + + + + + + – + + + + + – – + + + – – ++ + + – + + – – + + + + ++ + ND ND + + ND ND ND ND ND +– + ND ND + ND ND ND ND ND ND ND ND ND + + – + ND +– +– ++ ND + + + ++ + + + + + + + five serous adenocarcinomas and three of eight mucinous adenocarcinomas were positively stained by antiprosemin IgG Discussion We have isolated a cDNA encoding a novel serine protease, prosemin, from a human brain cDNA pool Homology search to human genomic sequence indicated that the prosemin gene is located on chromosome 16p13.3 In this region, genes for at least eight serine proteases are clustered: aII-, b-, cI-, cII-, w-tryptases [22], testisin [23], prostasin [24], and prosemin On the 4918 syntenic region of mouse chromosome 17, there is a tryptase gene cluster consisting of at least four serine proteases [25] Among the chromosome 16 protease family members, the prosemin gene structure is similar to the structures of prostasin, c-tryptase, and testisin The characteristic feature of these genes is the short second exon, which encodes only six or nine amino acids of the pro-peptide fragment (Fig 1) No TATA box sequence has been identified in the promoter regions of these genes The amino acid sequence of prosemin is up to 43% homologous to those of prostasin and c-tryptase (Fig 2) Furthermore, two cysteine residues, Cys41 and Cys161, are conserved only among these four proteases, and not in the other tryptases These results suggest that, of the chromosome 16 serine protease family members, these four proteases at least are derived from a single ancestral gene The deduced amino acid sequence of prosemin shows the characteristic feature of the S1 family The triad essential for serine protease activity and the peripheral consensus sequence have been identified (Figs and 2) An aspartic acid residue six amino acids before the active Ser242 suggests that prosemin preferentially cleaves after Arg or Lys residues in a target substrate In fact, recombinant prosemin cleaved Z-His-Glu-Lys-MCA, Boc-Glu(Obzl)-Ala-Arg-MCA, and Boc-Gln-Ala-ArgMCA Prosemin might be synthesized as a prepro-protein because it contains 32 hydrophobic amino acids at the amino terminal, which constitute a possible signal peptide Prosemin protein was secreted into conditioned medium when the full-length prosemin cDNA was expressed by a baculovirus expression system (data not shown) In fact, western blot analysis showed that prosemin is secreted in the cystic fluids of ovarian cancers (Fig 5C) Prosemin secreted by human cancer cell lines was detected as a 33 kDa protein However, the prosemin zymogen contains 17 amino acids of the proenzyme fragment and 268 amino acids of the mature enzyme, so the molecular mass is calculated to be about 31 kDa This discrepancy may be attributable to posttranslational modifications, such as N-glycosylation at Asn70 An activation motif typical of serine proteases is also observed at Arg49-Val-Val-Gly-Gly-Glu-Asp The released pro-enzyme fragment is predicted to be linked with the catalytic domain by a disulfide bond between Cys41 and Cys175; this is typical of many members of the S1 family We confirmed the enzymatic activity of prosemin with a recombinant protein In our system, recombinant prosemin was secreted into conditioned medium (Fig 3A), although it was composed of the trypsinogen prepro-peptide and the catalytic domain of prosemin We have developed this chimeric protein system FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS S Mitsui et al A novel serine protease in various cancer cells Fig Immunohistochemistry of prosemin in ovarian cancers Paraffin-embedded sections were stained with antibody directed against recombinant prosemin (A) Mucinous adenocarcinoma (B) and (C) Serous adenocarcinomas, borderline Immunoreactive prosemin was observed in the apical portion (D) Normal rabbit IgG produced no signals in the same sample as shown in (C) to use the attendant advantages, although full-length cDNA can be expressed in an expression system The recombinant protein was secreted into the conditioned medium by the trypsinogen signal peptide, which facilitates collection of the protein Furthermore, the trypsinogen prepro-peptide seems to function as a chaperon for some serine proteases Recently, pro-enzymatic fragments have been identified as intramolecular chaperons for some serine proteases, such as carboxypeptidase Y in yeast, subtilisin, a-lytic protease, and aqualysin in bacteria (reviewed in [26]) When a histidine tag was fused with the prosemin catalytic domain using the pTrcHis B vector (Invitrogen), no enzymatic activity was detected because refolding was disrupted (data not shown) We have reported the enzymatic activities of chimeric proteins composed of the trypsinogen signal ⁄ pro-peptide and the catalytic domains of the kallikrein-like proteases, neurosin (KLK6) and FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS hippostasin (KLK11) [9,10] It is also advantageous that the artificial pro-enzyme fragment blocks any proteolytic activity acting on the recombinant protein Recombinant prosemin only exhibited its activity when immobilized enterokinase digested away the proenzyme fragment (Fig 3B–D) Thus, we can recover the recombinant enzyme with no fear of autodegradation Our system might be suitable for producing recombinant serine proteases The enzymatic characteristics of prosemin are interesting, although its physiological functions are still obscure Prosemin hydrolyzes fluorogenic substrates at an optimum pH of 8.0–9.0 (Fig 3F), which is similar to the optimum pH for prostasin activity, pH 9.0 [27] Prostasin preferentially cleaved Pro-Phe-Arg-MCA and Val-Leu-Arg-MCA, but showed slight enzyme activity against Phe-Phe-Arg-MCA Prosemin acted enzymatically on Pro-Phe-Arg-MCA and Boc-Val-Leu-Arg4919 A novel serine protease in various cancer cells MCA, although it preferentially cleaved Boc-Glu(Obzl) and Gln-Ala-Arg-MCA as well as Z-His-Glu-LysMCA unlike prostasin (Fig 3E) Such enzymatic characteristics may reflect the amino acid similarities between prosemin and prostasin The optimum pH for prosemin is also similar to that for pancreatic digestive serine proteases, including CTRL-1 [28], trypsin, and pancreatic elastase [29] Northern blot analysis showed that, of the normal tissues, prosemin is abundantly expressed in the pancreas (Fig 4) All the pancreatic cancer cell lines tested secreted prosemin into the conditioned medium (Fig 5) These results suggest that the prosemin produced in the pancreas might function as a digestive enzyme, although confirmation that prosemin is secreted into the pancreatic fluid is required In other tissues, prosemin may not be involved in the reconstitution of the extracellular matrix, because recombinant prosemin does not digest fibronectin, laminin, type-V collagen, or gelatin, despite its enzyme activity (data not shown) The levels of prosemin expressed in normal tissues are too low for the reconstitution of the extracellular matrix Nerve growth factor and brain-derived neurotrophic factor have recently been shown to undergo processing by serine proteases in extracellular regions [30] Prosemin might be involved in the processing of some proteins In contrast to the specific expression of prosemin in normal tissues, various kinds of tumor cell lines secrete prosemin (Fig 5) The immunoreactive 20 kDa protein might be a degradation product of 33 kDa prosemin formed during the preparation process, because RT-PCR detected prosemin mRNA in cells that expressed only the 20 kDa protein (Fig 5B and Table 1) It should be noted that prosemin protein was detected in many ovarian, lung, and colon cancer cell lines, whereas the corresponding normal tissues expressed low levels of prosemin mRNA There are some reports that tumorigenesis causes the aberrant expression of serine proteases Neurosin ⁄ KLK6, expressed predominantly in the brain, is up-regulated in ovarian carcinomas [10,15] Neuropsin ⁄ KLK8 mRNA is not detected in the normal ovary, but is overexpressed in ovarian carcinomas [13] Furthermore, hippostasin ⁄ KLK11 is up-regulated in ovarian and prostate cancers [17] Recent experimental data suggest that human kallikreins promote or inhibit tumor growth, angiogenesis, invasion, metastasis by proteolytic processing of growth factor binding proteins, activation of other proteases and growth factors, degradation of extracellular matrix proteins (reviewed in [18–20]) Prosemin may also have other roles including the processing of growth factors and other proteases, as described above, especially in the CNS 4920 S Mitsui et al We have focused on ovarian cancer because other members of the chromosome 16 serine protease family, testisin and prostasin, are also expressed in ovarian carcinomas [31,32] Immunohistochemical analysis demonstrated the expression of prosemin in clinical ovarian carcinomas, regardless of cancer type (Fig 6) The localization of prosemin in the apical portion suggests that prosemin is secreted into the lumen Western blot analysis that detected prosemin in cystic fluids confirms this possibility (Fig 5C) It should be noted that prosemin occurs significantly in borderline serous adenocarcinomas, because there is still no available marker for the early diagnosis of ovarian cancer (Fig 6) Prosemin might be a good candidate tumor marker, although it remains to be confirmed that prosemin protein secreted from carcinomas flows into the blood We are developing an ELISA to measure prosemin, and seeking physiological substrates to better understand the physiological functions of the protein and its potential as a tumor marker Experimental procedures cDNA cloning of human prosemin cDNA cloning of human prosemin was performed by PCR techniques, as described previously [9] PolyA+ RNA from human brain (Clontech Laboratories Inc., Palo Alto, CA) was reverse-transcribed using an oligo-dT primer attached to a NotI adaptor sequence, GGCCACGCGTCGACTAG TAC(T)17, using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) Degenerate RT-PCR was performed using a primer designed to hybridize with the serine protease motif (Supplementary Fig S1) The sequences of PCR products were analyzed using an automatic sequencer (DSQ-1000, Shimadzu, Kyoto, Japan) after cloning into pGEM-T Easy vector (Promega, Madison, WI) Primers for 5¢ and 3¢ RACE were designed based on the sequence of the product of degenerate PCR For 3¢ RACE, nested PCR was carried out with primer and the adaptor primer, using the PCR product amplified by primer and the adaptor primer as template 5¢ RACE was performed with primers 3, 4, AP1, and AP2 using a Marathon RACE Amplification Kit (Clontech) according to the manufacturer’s instructions Full-length cDNA was isolated by nested RT-PCR between primers (GCCATGGTGGTTTC TGGAGC) and (CTGAATTCCTAGGAGCGCGCGGC GGCC) using the PCR product generated by primers (TACACACCCTGACCCGCATC) and as template Sequence analysis The sequence of the cDNA was analyzed using genetyx software (Software Development Co Ltd, Tokyo, Japan) FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS S Mitsui et al Multi-alignment and the search for transcriptional elements were carried out using BCM search (http://searchlauncher bcm.tmc.edu/) and TFSEARCH (http://www.cbrc.jp/ research/db/TFSEARCH.html), respectively Northern hybridization Multiple human polyA+ RNA blots were purchased from Clontech Full-length cDNA amplified between primers and was labeled using a BcaBEST Random Labeling Kit (Takara Suzo Co Ltd, Kyoto, Japan) Hybridization was carried out overnight in Express HybTM hybridization solution (Clontech) at 55 °C The membrane was washed in 0.1· SSPE and 0.1% (w ⁄ v) SDS at room temperature for 10 Radioactivity was detected using an FLA-2000 BioImage Analyzer (Fuji Photo Film Co Ltd, Tokyo, Japan) Production of recombinant prosemin The putative catalytic domain of human prosemin was fused to the trypsinogen prepro-peptide, as described elsewhere [10] In brief, a PCR fragment from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnI sites to produce pTSd The cDNA fragment encoding the putative catalytic site was amplified by PCR (forward primer, GTTGTGGGCGGCGAGGACAG; reverse primer, ATTGTCGACCTAGGAGCGCGCGGCGGC) This PCR fragment was digested with SalI and subcloned into pTSd at blunted KpnI and XhoI sites to produce pTSd ⁄ prosemin The veracity of the fusion vector was checked by DNA sequencing pTSd ⁄ prosemin (50 lg) was transfected into COS-1 cells cultured in a 150 cm2 flask using LipofectAmine Plus (Invitrogen, Carlsbad, CA) The cells were cultured in serum-free medium (Invitrogen) containing 700 lgỈmL)1 G418 The conditioned medium was recovered several days later Recombinant prosemin was purified by immunoaffinity column chromatography using an antibody directed against Asp-Asp-Asp-Asp-Lys, which was immobilized on N-hydroxysuccinimide (NHS)–Sepharose (Amersham Pharmacia Biotech, Buckinghamshire, UK) The bound protein was eluted with 0.1 m citrate buffer (pH 3.0) and neutralized with m Tris Enzyme assay Purified recombinant prosemin was activated by incubation with recombinant enterokinase (EK Max, Invitrogen), which was immobilized on NHS–Sepharose, at 37 °C overnight to remove the N-terminal sequence from Asp-Asp-Asp-AspLys An aliquot of activated prosemin was incubated with FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS A novel serine protease in various cancer cells 20 lm of a specific substrate in 20 mm Tris ⁄ HCl (pH 8.0) containing 0.2 m NaCl at 37 °C for the appropriate time To determine the optimum pH, 0.1 m phosphate buffers were used at pH 5.0 to pH 9.0, and 0.1 m Tris ⁄ HCl buffers from pH 9.0 to pH 11.0 Enzymatic activity was measured as fluorescence (excitation at 380 nm, emission at 460 nm) using a plate reader (Cytofluor 2300, Applied Biosystems, Foster City, CA) Western blot analysis Purified recombinant prosemin or synthetic peptide (Gly-Glu-Asp-Ser-Thr-Asp-Ser-Glu-Trp-Pro-Trp-Ile-ValSer-Ile-Gln-Lys-Asn-Gly-Thr-His-His-Cys) conjugated with keyhole-limpet hemocyanin was used to immunize New Zealand white rabbits, as described previously [33] Antibodies raised against prosemin were used after purification on Protein A Sepharose (Amersham Pharmacia Biotech) The indicated cell lines were cultured in protein free Ham’s F12 medium for several days The conditioned medium was recovered, freeze-dried, and reconstituted at mgỈmL)1 with NaCl ⁄ Pi Aliquots (5 lL) of reconstituted conditioned medium were separated electrophoretically on a 12.5% (w ⁄ v) SDS-polyacrylamide gel and blotted onto poly(vinylidene difluoride) membrane (Immobilon, Millipore, Bedford, MA) The membrane was incubated with anti-prosemin IgG diluted : 1000 with 5% (w ⁄ v) nonfat skim milk in NaCl ⁄ Pi containing 0.05% (v ⁄ v) Tween-20 (NaCl ⁄ Pi-Tween) The immunoreaction was enhanced by microwave treatment for 20 using an MI77 microwave oven (Azumaya, Tokyo, Japan) The membrane was washed with NaCl ⁄ Pi-Tween three times, and incubated with anti-rabbit IgG conjugated with alkaline phosphatase The immunoreaction was visualized by incubation in 50 mm Tris ⁄ HCl (pH 9.7) containing mm MgCl2, 450 lgỈmL)1 4-nitroblue tetrazolium chloride, and 157 lgỈmL)1 5-bromo-4-chloro-3-indolyl phosphate The following cell lines were tested: pancreatic cancer, HPC-Y0, HPC-Y3, HPC-Y5, HPC-Y9, HPC-Y25, HPC-YS, HPC-YT, and those established by the author (N Yamaguchi), AsPC-1 (ATCC CRL-1682), Capan-1 (ATCC HTB-79), Capan-2 (ATCC HTB-80), BxPC-3 (ATCC CRL-1687); colon cancer, Colo 201 (ATCC CCL204), WiDr (ATCC CCL-218), SW1116 (ATCC CCL-223); lung cancer, A540 (ATCC CCL-185), SKLU1 (ATCC HTB-57); neuroblastoma, KP-N-YN [34] (a gift from T Sugimoto, Kyoto Prefectural University of Medicine, Japan); glioma, U373 MG, Ishikawa, KHG2 (established by N Yamaguchi); oligodendroglioma, HOG (a gift from G Dawson, University of Chicago, IL); ovarian cancer, OVK18 (supplied by the Institute of Development, Aging and Cancer, Tohoku University, Japan), SKOV-3 (ATCC HTB-77); endometrial tumor, Ishikawa-EM [35], epidermoid, A431 (ATCC CRL-1555); breast cancer, MCF-7 (ATCC HTB-22); thyroid cancer, T3M-1 [36]; liver, Chang 4921 A novel serine protease in various cancer cells (ATCC CCL-13); lymphoma, K562 (ATCC CCL-243); kidney, OUR-10 (supplied by Osaka University, Japan); endothelial cell line, HUE (established by N Yamaguchi) RT-PCR Total RNA and polyA+ RNA were prepared from cultured cells using Trizol reagent (Invitrogen) and a Quick Prep mRNA Purification Kit (Amersham Pharmacia Biotech), respectively, according to the manufacturers’ manuals PolyA+ RNAs from various human tissues were purchased from Clontech cDNA synthesis was performed as described above The PCR was performed for 35 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s, using the forward primer 5¢-GTGAGCATCCAGAAGAATGG-3¢, and the reverse primer 5¢-AAGTAGCCGGCACACAG CAT-3¢ PCR products were analyzed by 1% (w ⁄ v) agarose gel electrophoresis Immunohistochemistry Paraffin-embedded specimens were cut into lm sections Sections had paraffin removed by passage through xylene and a graded series of ethanol (100–70%), and the slides were treated in STUF solution (Serotec, Oxford, UK) at 95 °C for 10 to activate the immunoantigen The slides were incubated in methanol containing 0.3% (v ⁄ v) H2O2 for 30 at room temperature and washed with NaCl ⁄ Pi-Tween three times The immunodetection of prosemin was performed using a Vectastain ABC kit (Vector Laboratories Inc., Burlingame, CA) The slides were blocked with normal horse serum for 60 Diluted antibody directed against recombinant prosemin was placed on the slides overnight Slides were washed with NaCl ⁄ Pi-Tween, and covered with biotinylated horse anti-rabbit secondary antibody for h The slides were washed, and reacted with an avidin–horseradish peroxidase–biotin complex for h The immunoreaction was detected by incubating the slides in 20 mm Tris ⁄ HCl (pH 7.5) containing 3,3¢-diaminobenzidine and aliquots of H2O2 Acknowledgements We thank Drs Sugimoto and Dawson for providing neuroblastoma and oligodendroglioma, respectively This work was supported in part by a Grant-in-Aid for Scientific Research (B) from Japan Society for Promotion of Science References Turgeon VL & Houenou LJ (1997) The role of thrombinlike (serine) proteases in the development, plasticity and pathology of the nervous system Brain Res Rev 25, 85–95 4922 S Mitsui et al Qian Z, Gilbert ME, Colicos MA, Kandel ER & Kuhl D (1993) Tissue-plasminogen activator is induced as an immediate-early gene during seizure, kindling and longterm potentiation Nature 361, 453–457 Tsirka S, Gualandris A, Amaral DG & Strickland S (1995) Excitotoxin-induced neuronal degeneration and seizure are mediated by tissue plasminogen activator Nature 377, 340–344 Hirata A, Yoshida S, Inoue N, Matsumoto-Miyai K, Ninomiya A, Taniguchi M, Matsuyama T, Kato K, Iizasa H, Kataoka Y, Yoshida N & Shiosaka S (2001) Abnormalities of synapses and neurons in the hippocampus of neuropsin-deficient mice Mol Cell Neurosci 17, 600–610 Puente XS, Sanchez LM, Overall CM & Lopez-Otin C (2003) Human and mouse proteases: a comparative genomic approach Nat Rev Genet 4, 544–558 Yamaguchi N, Okui A, Yamada T, Nakazato H & Mitsui S (2002) Spinesin ⁄ TMPRSS5, a novel transmembrane serine protease, cloned from human spinal cord J Biol Chem 277, 6806–6812 Yamamura Y, Yamashiro K, Tsuruoka N, Nakazato H, Tsujimura A & Yamaguchi N (1997) Molecular cloning of a novel brain-specific serine protease with a kringle-like structure and three scavenger receptor cysteine-rich motifs Biochem Biophys Res Commun 239, 386–392 Iijima N, Tanaka M, Mitsui S, Yamamura Y, Yamaguchi N & Ibata Y (1999) Expression of a serine protease (motopsin PRSS12) mRNA in the mouse brain: in situ hybridization histochemical study Mol Brain Res 66, 141–149 Mitsui S, Yamada T, Okui A, Kominami K, Uemura H & Yamaguchi N (2000) A novel isoform of a kallikreinIike protease TLSP ⁄ Hippostasin (PRSS20) is expressed in the human brain & prostate Biochem Biophys Res Commun 272, 205–211 10 Yamshiro K, Tsuruoka N, Kodama S, Tsujimoto M, Yamamura Y, Tanaka T, Nakazato H & Yamaguchi N (1997) Molecular cloning of a novel trypsin-like serine protease (neurosin) preferentially expressed in brain Biochim Biophys Acta 1350, 11–14 11 Ogawa K, Yamada T, Tsujioka Y, Taguchi J, Takahashi M, Tsuboi Y, Fujino Y, Nakajima M, Yamamoto T, Akatsu H, Mitsui S & Yamaguchi N (2000) Localization of a novel type trypsin-like serine protease, neurosin, in brain tissues of Alzheimer’s disease and Parkinson’s disease Psychiatry Clin Neurosci 54, 419–426 12 Mitsui S, Tsuruoka N, Yamashiro K, Nakazato H & Yamaguchi N (1999) A novel form of human neuropsin, a brain-related serine protease, is generated by alternative splicing and is expressed preferentially in human adult brain Eur J Biochem 260, 627–634 FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS S Mitsui et al 13 Underwood LJ, Tanimoto H, Wang Y, Shigemasa K, Parmley TH & O’Brien TJ (1999) Cloning of tumorassociated differentially expressed gene-14, a novel serine protease overexpressed by ovarian carcinoma Cancer Res 59, 4435–4439 14 Magklara A, Scorila A, Katsaros D, Massobiro M, Yousef GM, Fracchioli S, Danese S & Diamandis EP (2001) The human KLK8 (Neuropsin ⁄ Ovasin) gene: Identification of two novel splice variants and its prognostic value in ovarian cancer Clin Cancer Res 7, 806–811 15 Diamandis EP, Yousef GM, Soosaipillai AR & Bunting P (2000) Human kallikrein (zyme ⁄ protease M ⁄ neurosin): a new serum biomarker of ovarian carcinoma Clin Biochem 33, 579–583 16 Nakamura T, Mitsui S, Okui A, Kominami K, Nomoto T, Ukimura O, Kawauchi A, Miki T & Yamaguchi N (2001) Alternative splicing isoforms of hippostasin (PRSS20 ⁄ KLK11) in prostate cancer cell lines Prostate 49, 72–78 17 Diamandis EP, Okui A, Mitsui S, Luo L-Y, Soosaipillai A, Grass L, Nakamura T, Howarth DJC & Yamguchi N (2002) Human kallikrein 11: a new biomarker of prostate and ovarian carcinoma Cancer Res 62, 295–300 18 Yousef GM & Diamandis EP (2001) The new human tissue kallikrein gene family: structure, function, and association to disease Endocr Rev 22, 184–204 19 Borgono CA, Michael IP & Diamandis EP (2004) ˜ Human tissue kallikreins: Physiologic roles and applications in cancer Mol Cancer Res 2, 257–280 20 Borono CA & Diamandis EP (2004) The emerging roles ˜ of human tissue kallikreins in cancer Nat Rev Cancer 4, 876–890 21 Kozak M (1981) Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes Nucleic Acids Res 8, 5233–5262 22 Caughey GH, Raymond WW, Blount JL, Hau LW-T, Pallaoro M, Wolaters PJ & Verghese GM (2000) Characterization of human gamma-tryptases, novel members of the chromosome 16p mast cell tryptase and prostasin gene families J Immunol 164, 6566–6575 23 Hooper JD, Bowen N, Marshall H, Cullen LM, Sood R, Daniels R, Stuttgen MA, Normyle JF, Higgs DR, Kastner DL, Ogbourne SM, Pera MF, Jazwinska EC & Antalis TM (2000) Localization, expression and genomic structure of the gene encoding the human serine protease testisin Biochim Biophys Acta 1492, 63–71 24 Yu JX, Chao L, Ward DC & Chao J (1996) Structure and chromosomal localization of the human prostasin (PRSS8) gene Genomics 32, 334–340 25 Wong GW, Li L, Madhusudhan MS, Krilis SA, Gurish MF, Rothenberg ME, Sali A & Stevenes RL (2001) Human tryptase epsilon (PRSS22), a new member of the chromosome 16p13.3 family of human serine proteases expressed in airway epithelial cells J Biol Chem 276, 20648–20658 FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS A novel serine protease in various cancer cells 26 Ellis RJ (1998) Steric chaperones Trends Biochem Sci 23, 43–45 27 Yu JX, Chao L & Chao J (1994) Prostasin is a novel human serine proteinase from seminal fluid Purification, tissue distribution, and localization in prostate gland J Biol Chem 269, 18843–18848 28 Reseland JE, Larsen F, Solheim J, Eriksen JA, Hanssen LE & Prydz H (1997) A novel human chymotrypsin-like digestive enzyme J Biol Chem 272, 8099–8104 29 Sarath G, Zeece MG & Penheiter AR (1989) Protease assay methods In Proteolytic Enzymes: a Practical Approach, 2nd ed (Baynon RJ & Bond JS, eds), pp 45–76 Oxford University Press, Oxford, UK 30 Lee R, Kermani P, Teng KK & Hempstead BL (2002) Regulation of cell survival by secreted proneurotrophins Science 294, 1945–1948 31 Shigemasa K, Underwood LJ, Beard J, Tanimoto H, Ohama K, Parmley TH & O’Brien TJ (2001) Overexpression of testisin, a serine protease expressed by testicular germ cells, in epithelial ovarian tumor cells J Soc Gynecol Invest 7, 358–362 32 Mok SC, Chao J, Skates S, Wong K-K, Yiu GK, Muto MG, Berkowitz RS & Cramer DW (2001) Prostasin, a potential serum marker for ovarian cancer: identification through microarray technology J Natl Cancer Inst 93, 1458–1464 33 Okui A, Kominami K, Uemura H, Mitsui S & Yamaguchi N (2001) Characterization of a brain-related serine protease, neurosin (human kaillikrein 6), in human cerebrospinal fluid Neuroreport 12, 1345–1350 34 Sugimoto T, Ueyama H, Hosoi H, Inazawa J, Kato T, Kemshead JT, Reynolds CP, Gown AM, Mine H & Sawada T (1991) Alpha-smooth-muscle actin and desmin expressions in human neuroblastoma cell lines Int J Cancer 48, 277–283 35 Chatzaki E, Bax CM, Eidne KA, Anderson L, Grudzinskas JG & Gallagher CJ (1996) The expression of gonadotropin-releasing hormone and its receptor in endometrial cancer, and its relevance as an autocrine growth factor Cancer Res 56, 2059–2065 36 Sato K, Fujii Y, Kakiuchi T, Kasano K, Imamura H, Kondo Y, Mano H, Okabe T, Asano S, Takaku F, Tsuchima T & Shizume K (1989) Paraneoplastic syndrome of hypercalcemia and leukocytosis caused by squamous carcinoma cells (T3M-1) producing parathyroid hormone-related protein, interleukin alpha, and granulocyte colony-stimulating factor Cancer Res 49, 4740–4746 Supplementary material The following supplementary material is available for this article online: Fig S1 4923 .. .A novel serine protease in various cancer cells serine protease, spinesin ⁄ TMPRSS5, which is localized at synapses [6] Motopsin (PRSS12) is a mosaic serine protease, with a kringle domain and... RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas The characterization and functions of prosemin are described... FEBS A novel serine protease in various cancer cells 4913 A novel serine protease in various cancer cells identity, respectively (Fig 2) Amino acid alignment of these proteases shows that 10 of the