a preliminary assessment of using a white light confocal imaging profiler for cut mark analysis
Báo cáo lâm nghiệp: "Assessment of tension wood detection based on shiny appearance for three poplar cultivars Miguel Angel BADIA, Frédéric MOTHE, Thiéry " pot
... the Corel Photo paint software Then, to quantify the areas of TW identified within each ring, Visilog 5.3 image analysis software was used It was easy to separate them because of the different ... tangential direction and mm in the radial one (i.e thickness of the line) They were then transferred onto a transparent Mylar film containing additional information such as pith location and annual ... to clearly reveals that the inevitable simplification of the shape by the operator always leads to an enlargement of the surface Such an effect was partially – but not completely – compensated...
- 7
- 306
- 0
Báo cáo y học: "At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana" pps
... RNA 6000 Series II Nano kit (Agilent, Santa Clara, CA, USA) Probe preparation and array hybridization For synthesis of probes (targets) for ATH1 and tiling arrays, μg of total RNA was used as ... the Affymetrix GeneChip® Tiling 1.0R Array (Affymetrix Inc., Santa Clara, CA, USA) to provide an initial whole-genome expression atlas for A thaliana, dubbed 'Arabidopsis thaliana Tiling Array ... transcriptome Tiling array studies of human and C elegans indicated that about half of all transcripts are not polyadenylated [20] In contrast, our data suggest that nonpolyadenylated RNAs make a more limited...
- 16
- 265
- 0
Determining the effects of using VOA news to teach speaking skills for the third year english major students at Hong Duc university
... foreign language VOA news 3.1 What is VOA news? 3.2 Some fast facts of VOA news 3.3 VOA broadcasts 3.4 VOA and Technology VOA news – a kind of authentic materials 4.2 The Advantages of authentic materials ... authentic materials 4.3 The Disadvantages of authentic materials 4.4 Sources of Authentic Materials VOA news as a kind of language teaching materials 5.1 Benefits of VOA news in teaching speaking 5.2 ... purpose The study aims to apply VOA news as a kind of language teaching materials in teaching speaking skills to the third-year English major students of Department of foreign languages at Hong Duc...
- 8
- 778
- 9
Comparison of discrete singular convolution and generalized differential quadrature for the vibration analysis of rectangular plates
... ✛✕✧✕✘✛✪✗✢ y Simply Supported b Clamped Elastic Support with nonuniform rotational restraint x ✠ ✓✩✏✛✕ ✚ ✢✖☎ ✤✕✎✞ ✕✖✛❇ ✘✙✒ ✪✎✎✛✒✓✙✘✖✕ ✧❇ ✧✖✕✞ ✎✜ ✛✕✪✖✘✙ ✩✏✑✘✛ ✫✑✘✖✕✢ a ✁ ✁ ✝ ✁☛ ☞☎✝ ✟ ☛ ✄ ☎✄☞ ✰✱...
- 99
- 165
- 0
báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf
... individuals with unilateral spatial neglect to cross streets in a safe and vigilant manner [24] VR can give human versatile sensory information artificially and easily for the visual, vestibular, and ... portions and a right and then a left correct answer rates were analyzed 34 points were set as a cutoff value Page of (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation ... (VR) has many advantages over other ADL rehabilitation techniques and offers the potential to develop a human performance testing and training environment [23] and also a VR system for training...
- 9
- 541
- 0
THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS: A Preliminary Assessment pdf
... is cut into manageable pieces and shipped to mills as far away as South Korea, Malaysia, China and India Some reports indicate that a portion of the structural steel may be contaminated with a ... releases or threatened releases of hazardous substances” and to “collect and manage information concerning the amount, location and nature of hazardous substances” such as those discharged as a ... volumes of particulate matter, there was not a single recorded violation of national health standards for particulate matter This strongly suggests that a review of the adequacy of existing standards...
- 35
- 361
- 0
Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx
... and standard deviations for each parameter and time interval were calculated for each patient and used for further analysis Significant changes in the mean and standard deviations of these parameters ... patient’s contorted self-awareness–and reliable The latter is the prerequisite for obtaining meaningful data on a patient’s physical status and may be particularly valuable for assessing a patient’s ... in MS, for the design and evaluation of treatment and rehabilitation programs aimed at improving symptoms and for evaluating a patient’s ability to perform occupational tasks Author details Division...
- 13
- 434
- 0
báo cáo hóa học:" A biomechanical assessment of modular and monoblock revision hip implants using FE analysis and strain gage measurements" potx
... quadratic tetrahedrons for cortical bone, cancellous bone, and implants, and a 20-node quadratic hexahedron for the axial force applicator Contact elements were quadratic triangular for cortical ... storage and analysis Mechanical testing Experiments were performed using an Instron 8874 (Canton, MA, USA) with a capacity of ± 25 kN, a resolution of 0.1 N, and an accuracy of ± 0.5% Hip implants ... model and experimental strain at Locations to were calculated as described earlier For the Modular hip implant data (Table 1), the average differences for Locations to at axial loads of 700 and...
- 12
- 333
- 0
Báo cáo khoa hoc:" Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" pot
... were calculated for each patient and used for further analysis Significant changes in the mean and standard deviations of these parameters were used as probable indicators of fatigue It was assumed ... medio-lateral sway of the upper body were calculated for each step using the three-dimensional coordinates of the infrared markers Mean and standard deviations for each parameter and time interval ... data on a patient’s physical status and may be particularly valuable for assessing a patient’s ability to perform occupational tasks and consequently for determining a patient’s entitlement for...
- 34
- 272
- 0
Báo cáo y học: "Physical injury assessment of male versus female chiropractic students when learning and performing various adjustive techniques: a preliminary investigative study" ppsx
... of participant responses and additional analysis of the demographic data may reveal if a predisposition exists for certain individuals to sustain injury, and/or if a particular anatomical area ... Classroom Males % Another limitation was that, although data was collected for participant height and weight, the association of injury Page of (page number not for citation purposes) Chiropractic ... Mior and Diakow's epidemiological survey of 320 Canadian chiropractors found the overall prevalence of back pain was 87%, and that low back pain was predominant in 74% of the responding chiropractors...
- 6
- 253
- 0
Báo cáo y học: "Assessment of the effects and limitations of the 1998 to 2008 Abbreviated Injury Scale map using a large " pot
... which have only used major trauma patients in evaluating changes in major trauma classification are Table Victorian major trauma criteria met using AIS98 and (mapped) AIS08 Criteria met using AIS98 ... which has a substantial impact on estimates of major trauma classification using AIS08 These codes disproportionately affect the patient population, as one third of patients had at least one of these ... the available dictionary map More specifically, the effect of AIS version change on major trauma numbers will be ascertained by evaluating both major and non-major trauma patients Additionally,...
- 10
- 391
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human...
- 30
- 369
- 0
a translation quality assessment of the vietnamese version of the nover the notebook by petal lê (2010) using peter newmark's model = đánh giá chất lượng bản dịch tiếng việt của tiểu thuyết nhật ký (2010) do petal lê
... methods of translation as followed: Source Language Emphasis Target Language Emphasis Word -for- word translation Adaptation Literal translation Free translation Faithful translation Idiomatic translation ... is a paraphrase much longer than the original, a so-called „intra-lingual translation‟, often prolix and pretentious, and not translation at all Adaptation: This is the „freest‟ form of translation ... knowledge for any translation evaluator who would like to evaluate the quality of translation, including definition of translation, translation methods, translation equivalence, and translation assessment...
- 49
- 1,789
- 13
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... vasculature and angiogenesis Reverse primer ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC ... potential, BPA was outlawed from manufacturing of baby bottles in EU and Canada [49] Cleaning agents may contain a pool of solvents, detergents, fragrances, disinfectants, etc., many of which may cause ... CA: Caudal artery; CV: Caudal vein; DA: Dorsal aorta; DLAV: Dorsal longitudinal anastomotic vessel; PCV: Posterior (caudal) cardinal vein; Se: Intersegmental vessel B-E: No significant alteration...
- 58
- 262
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... content analysis As it was remarked, “data obtained from qualitative research is usually detailed, rich, deep and qualitative study typically involves a small number of research subjects” (Barnes, ... performance, using them over time so as to reveal change, growth, and increasing degrees of integration Such an approach aims for a more complete and accurate picture of learning, and therefore ... what standards to apply; assessment also prompts attention to where and how program goals will be taught and learned Clear, shared, implementable goals are the cornerstone for assessment that...
- 65
- 893
- 7
A comparative assessment of prediction capabilities of modified analytical hierarchy process (MAHP) and Mamdani fuzzy logic models using NetcadGIS for forest fire susceptibility mapping
... Shariff ARM, Nuruddin AA 2004 GIS-grid-based and multi-criteria analysis for identifying and mapping peat swamp forest fire hazard in Pahang, Malaysia Disaster Prev Manage 13(5):379À386 Jaafari ... at 00:53 15 March 2016 Geomatics, Natural Hazards and Risk 883 Nandi A, Shakoor A 2010 A GIS-based landslide susceptibility evaluation using bivariate and multivariate statistical analyses Eng ... control management in Chilla forest range of Rajaji National Park Uttaranchal (India) [thesis] Enschede: International Institute for Geo-information Science and Earth Observation Razali SBM 2007 Forest...
- 26
- 498
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25