a novel mannose 6 phosphate specific antibody fragment for diagnosis of mucolipidosis type ii and iii
Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx
... 2005, 35: 269 1- 269 8 Duval M, Posner MR, Cavacini LA: A bispecific antibody composed of a nonneutralizing antibody to the gp41 immunodominant region and an anti-CD89 antibody directs broad human immunodeficiency ... treatment of disease is bispecific antibodies (BsAbs) that can bind to two distinct epitopes Besides the dual -specific antigen binding fragment (Fab) parts, they contain an Fc portion and can Jia et al ... test of the hypothesis would demonstrate that (anti-gp120 × anti-C3d)-Fc can bind to HIV virions and can result in an amplification of the complement activation cascade As a consequence of this action,...
- 4
- 242
- 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt
... for the W66S mutant, and by using the primer pair 5¢-GCCACCTCTTTCCACGCCGCAGGC-3¢ and 5¢-GC CTGCGGCGTGGAAAGAGGTGCC-3¢ for the W66F mutant Spectroscopic measurements and determination of the FAD ... primer pair 5¢GGCACCTCTTGGGCCGCCGCAGGC-3¢ and 5¢-GCC TGCGGCGGCCCAAGAGGTGCC-3¢ for the H6 7A mutant, by using the primer pair 5¢-GCAGCGGCAC CTCTTCTCACGCCGCAGGCTTG-3¢ and 5¢-CAAG CCTGCGGCGTGAGAAGAGGTGCCGCTGC-3¢ ... was amplified with the primer pair 5¢-GAC CTGAGTAGAAATGGATCCCTGATGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bearing the restriction enzyme recognition sites BamHI and XhoI, respectively pAO1...
- 8
- 647
- 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... by an ELISA based on a goat anti-human FXI afnity puried IgG as capture antibody and a goat antihuman FXI peroxidase-conjugated IgG as detecting antibody (Afnity Biological Inc., Hamilton, Ontario, ... (2005) Factor XI deciency database: an interactive web database of mutations, phenotypes, and structural analysis tools Hum Mutat 26, 192198 FXIVal317Ile a novel factor XI type II defect 14 Salomon ... incubation times, an aliquot of the activation solution was taken to measure the Michaelis parameters of S-2 366 hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis...
- 11
- 563
- 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )15 96 ) 163 2 )140 )1100 )15 96 ) 163 2 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... with a Thermal Cycler DiceÔ Real Time System (TaKaRa Bio Inc.) The forward primer 5¢-CGGAACCAAAACATGC TAACATTTTC[FAM]G-3¢ (Invitrogen, Carlsbad, CA, USA) and the reverse primer 5¢-CGTTACAGGCAACTTGTTTCTCA-3¢...
- 12
- 348
- 0
Báo cáo hóa học: " A novel cross-layer mesh router placement scheme for wireless mesh networks" pptx
... locations V’, and the price of an MR and the price of a pair of directional antennas, the goal of MRP is to deploy MRs and directional antennas the WMN backbone, and thus they cannot guarantee ... traffic demand of user i; rij: transmission rate between user i and MR j; C max : maximum link capacity of a local access antenna; Rj: local coverage of MR j; Rmax: maximum local coverage of an MR; ... total cost of MRs and additional directional antennas deployed Equations and guarantee that each MC i can be served by one MR, and its demand qi can be supported by the transmission rate rij that...
- 14
- 426
- 0
Báo cáo hóa học: " A Novel Efficient Cluster-Based MLSE Equalizer for Satellite Communication Channels with M-QAM Signaling" ppt
... error rates (BER) and their computational requirements Both 4-QAM and 16- QAM signaling schemes are considered Two channel types are examined: an AWGN channel (L = 1) and a 2-tap (L = 2) stationary ... 100 randomly generated symbols in the comparison experiments In Figure a detailed performance comparison for the case of an AWGN channel and 16- QAM signaling at 6 dB IBO with 60 , 100, 1000, and ... g (A) is commonly referred to as the AM/AM characteristic and the nonlinear phase function Φ (A) is called the AM/PM characteristic These are expressed as g (A) = a A , + a A2 (3) Φ (A) = α p A2 ...
- 16
- 381
- 0
Báo cáo hóa học: " A Novel High-Speed Configurable Viterbi Decoder for Broadband Access" doc
... number of states, λmax is maximum BM, and k is and for radix-2 ACS and radix-4 ACS, respectively Hence, for a maximum constraint length 10 and radix-2 ACS with 3-bit quantisation, N = 512, k = 1, and ... data needed for each BF unit For each ROM, the 120 2-bit index data are arranged as shown in Table as this allows for easy hardware implementation The first addresses (0 to 7) are not used, and ... cycles and 4, the corresponding allowed cycles for ACS are obtained as in Table As a result of address scrambling 2, pipeline levels can be available for ACS operations Γbits = log2 ∆max + kλmax...
- 11
- 332
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
... easily available in routine and even reference laboratories Lichtman and colleagues have reported a mathematical formula which can be used to calculate P50 reliably [5] Calculating P50 using this formula ... polycythemia in her mother, maternal grandmother and her younger sister Physical examination was unremarkable Laboratory parameters were remarkable for elevated hemoglobin (17.2 gm%) and hematocrit ... gas parameters are available, without necessity of more sophisticated calculations using antilog parameters With increased ease and rapidity of calculation using our Excel program (Supplementary...
- 5
- 418
- 0
Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf
... 5’GTCAATGCGGAGGGAAAG3’ antisense: 5’CACGAAGCAGTTTGGGAC 3’ 349 bp TNF -a GenBank:219 26] sense: 5’CACTGGAGCCTCGAATGTC3’ antisense: 5’CAGGGAAGAATCTGGAAAGGT3’ 128 bp b-actin [GenBank:11 461 ] sense: 5’CCAGCCTTCCTTCTTGGGTAT3’ ... Huang Qiguang for technical assistances Author details Guangxi Cardiovascular Institute, Shuang-Yong Road 6, Nanning, PR China Department of Cardiology, the First Affiliated Hospital of Guangxi ... of primers for RT-PCR Molecule Sequence (5’-3’) length IL -6[ GenBank: 161 93] sense: 5’CACAGAAGGAGTGGCTAAGGACCA3’ antisense: 5’ACGCACTAGGTTTGCCGAGTAGA3’ 103 bp IL-17[GenBank: 161 71] sense: 5’GTCAATGCGGAGGGAAAG3’...
- 7
- 255
- 0
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... 20 06, 68 (12):1327-1329 192 Vaisocherova H, Faca VM, Taylor AD, Hanash S, Jiang S: Comparative study of SPR and ELISA methods based on analysis of CD 166 /ALCAM levels in cancer and control human ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... Lung Cancer 2009, 63 (1):1 06- 110 Ueno T, Kataoka M, Hirano A, Iio K, Tanimoto Y, Kanehiro A, Okada C, Soda R, Takahashi K, Tanimoto M: Inflammatory markers in exhaled breath condensate from patients...
- 17
- 377
- 0
Báo cáo y học: "Immediate determination of ACPA and rheumatoid factor - a novel point of care test for detection of anti-MCV antibodies and rheumatoid factor using a lateral-flow immunoassay" pdf
... device Lateral-flow immunochromatographic assay (LFIA) was manufactured as double antigen direct sandwich assay Devices (DCN, Carlsbad, CA, USA) for testing of up to 10 μl of biological samples ... in both standardized anti-MCV and RF-ELISA (Orgentec, Mainz, Germany) The ratio of applied antigens and serum anti-MCV antibodies and/ or RF was such that monodentate binding of autoantibodies ... after manufacture by storage at room temperature Direct antibody sandwich format A blood drop (approximately 20 μl) was placed in the sample port at A on the device After adding six drops of assay...
- 5
- 426
- 0
Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf
... GTAGGAA Akv-CD CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT -AAAGAG GTAGGAA Akv-EH CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT -AAAGGG GACGAAA Akv-CDH CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA ... 5'-CTATATAACTGGAAAAATAATAATCCATCATMut-D: 5'TCAGTGAAGATCCAGGTAAACT-3', GGATTATTATTTTTCCAGTTATATAGATCGCTGGAGGAAAACG-3', and Mut-H: 5'-TTGGGATTACACCACCCAAAGGGGACGAAACCACCT-3' A 720 bp Bsu36I – Bsu36I ... TTTTCCTCCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG|GAT TTCTCCTCTTCTGACCTTTACAACTGGAAAAATAATAACCCTTCTTTTTCTGAA|GAT TTTTCCTCCTCTGACCTCTATAACTGGAAAAATAACAACCCCTCTTTCTCCGAG|GAC TTCTCCTCCTCTGACCTGTATAATTGGAAAAATAACAACCCTTCTTTTTCTGAG|GAT...
- 19
- 178
- 0
Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf
... a novel validation scheme and assess data quality of a number of validation experiments performed on amplicon-based DNA-microarrays of L lactis IL1403 For any laboratory in which DNA-microarray ... paper proved to be satisfactory, while at same time a maximum amount of data was preserved One has to bear in mind that a significant part of the variance in our data is caused by varying factors ... RL, and CdH have conducted the DNA-microarray experiments SvH, AdJ, and CA analyzed the data and generated the figures SvH, RB, AdJ, and CA drafted the paper CA provided guidance with the statistical...
- 35
- 274
- 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... for OA and are widely used and recognized as reliable, accurate, and relevant WOMAC scores were determined, at screening, and baseline, as well as at days 30, 60 and 90 as described in Bellamy ... taken from subjects at day 30 and day 60 (visits and 4) for the determination of ALT, AST, bilirubin, and albumin if the subjects had been taking acetaminophen greater than g/day for more than ... clinical trial evaluated the safety and efficacy of UC -II in the treatment of the knee in OA patients Materials and Methods Study Design This clinical trial (Human Clinical Trial Approval #06UOHI)...
- 10
- 706
- 0
A study of linguistic features of intructions for use of foodstuffs in english and vietnamese
... butter, beaten eggs and teaspoon another adverb Basing on the data analysis, we found that adverbs of vanilla essence manner, adverbs of time and adverbs of degree are three main kinds of adverbs ... products as well as What are lexical, syntactic, and semantic features of instructions for use of foodstuffs in English and Vietnamese? What are similarities and differences of instructions for use of ... attempt to make a detailed study of linguistic exact and deep understanding of the way of using words and writing features of EIUFs and VIUFs in terms of lexical, syntactic, and semantic sentences...
- 13
- 697
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... favored and favored regions of the Ramachandran ˚ plot and r.m.s.d values for bond and angle of 0.005 A and 1.37 ° as shown in Table References Table Data collection and refinement statistics of ... Val-Ser-Ala-ArgflMet-Ala-Pro and Phe-Thr-Phe-ArgflSer-Ala-Arg for PAI-1 and PCI, respectively [6] By contrast, the reactive site loops of a1 -antichymotrypsin and heparin cofactor II contain leucine instead of arginine ... proteinase domain of DESC1, rapid amplification of cDNA ends reactions were performed on a human prostate Marathon-Ready cDNA (Clontech, Mountain View, CA, USA) Two fragments were isolated and confirmed...
- 13
- 588
- 0
báo cáo hóa học:" Preferences of diabetes patients and physicians: A feasibility study to identify the key indicators for appraisal of health care values" doc
... is based on the levels of assessment and appraisal as shown in Table The appraisal of health care services presumes that preferences can be measured and can be made available to the policy and ... distribution was similar in type and type patients Obesity type II and III were observed in 5% of patients with type diabetes, but was found in 12% of patients with type diabetes No obesity was observed ... Their average number of years of professional experience was 22.5 and 22.9 years, respectively The general practitioners had an average of 171 diabetes patients in their practices and the diabetes...
- 7
- 401
- 0
Báo cáo sinh học: " Research Article A New Switching-Based Median Filtering Scheme and Algorithm for Removal of High-Density Salt and Pepper Noise in Images" pptx
... densities for evaluating the performance of the algorithm Three images are selected They are Lena, Cameraman, and Boat image A quantitative comparison is performed between several filters and the ... and μx are mean intensities of original and restored images, σr and σx are standard deviations of original and restored images, r p and x p are the image contents of pth local window, and G is the ... autocorrelation for lags and Sort the 1-D array Z and calculate the median value Assuming stochastic approximation for maintaining simplest computational complexity Replace the noisy pixel by the median value...
- 11
- 356
- 0
Báo cáo toán học: "A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces" ppt
... H Arai and T Mizuhara, Morrey spaces on spaces of homogeneous type and estimates for b and the Cauchy-Szeg¨ projection, Math Nachr 175 (1997) o 5–20 G Di Fazioand and M Ragua, Interior estimates ... function inequality on Morrey -type Besov and Triebel-Lizorkin spaces, which is a characterization of Morrey -type Besov and Triebel-Lizorkin spaces Before stating it, we recall some notations and the ... Function space theory and applications to non-linear PDE, Trans Amer Math Soc 355 (2003) 1297–1 364 A Mazzucato, Decomposition of Besov-Morrey spaces, in Harmonic Analysis at Mount Holyoke, AMS Series...
- 11
- 311
- 0
Báo cáo y học: "Modulation of granulocyte-endothelium interactions by antileukoproteinase: inhibition of anti-type II collagen antibody-induced leukocyte attachment to the synovial endothelium" ppt
... vitro assays (cell adhesion assays, FACS analysis, reporter gene assays) and the statistical analysis PG and AK performed the animal experiments and intravital fluorescence microscopic analysis ... ion-exchange, metalchelate and size-exclusion chromatography as originally described by Heinzel-Wieland and colleagues [ 16] Analytical reverse-phase chromatography revealed a single peak, and SDS-PAGE ... effect of ALP on the cytoskeletal reorganization of stimulated granulocytes and the accompanying suppression of conformational changes of the β2 chain of the integrins LFA-1 (CD1 1a/ CD18) and Mac-1...
- 11
- 397
- 0
- lifeburst a novel
- glucose 6 phosphate dehydrogenase deficiency and malaria a method to detect primaquine induced
- turabian kate a manual for writers of term papers theses and dissertations
- slga a novel antibody isotype
- the estrogen paradox and a novel framework for targeting sex specific neurocircuits and behavior
- task specific training needed for transfer of learned abilities to overground walking
- 6 stored autologous placental transfusion for anemia of prematurity
- mouse glucose 6 phosphate isomerase antibody production
- ansi ashrae standard 41 6 1994 ra 01 methods for measurement of moist air properties
- specific activity activity ratio and udp glucose and glucose 6 phosphate kinetics of gsy2p
- make a selection of bullet type size and colour before clicking ok
- schematic representation of a spinner flask bioreactor this can be used for seeding of cells into 3d scaffolds and subsequent culture of the constructs 57
- life of radio type ii censored data with a high censoring level
- hdmcp a novel liver specific uncoupling protein 127
- sự hiện diện của mannose 6 phosphate tiêu protein để các lysosome
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25