glucose 6 phosphate dehydrogenase deficiency and malaria a method to detect primaquine induced
Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx
... ÔExtra and intracellular nucleotide and nucleoside: chemical signals, metabolic regulators and potential drugsÕ and ÔHyperhomocysteinemia as a cardiovascular risk factor: biochemical mechanism(s)Õ ... are cytoskeletal components, such as ankyrin and bands 4.1 and 4.2, as well as the integral membrane protein band (AE1; the anion transporter) [6] In this respect, asparaginyl deamidation has been ... of haemolysis and in good clinical condition Routine biochemical blood tests (Hitachi 911 Automatic Analyzer) and a standard haematological screening test for anaemia were performed For all erythrocyte...
- 8
- 412
- 0
Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx
... /NADP+Glc6P (lM2Æs) /NADP+Glc6P/ /NADP+ (lM) /NADP+Glc6P/ /Glc6P (lM) /NADP+Glc6P/ /Glc6P/NADP+ (s)1) kcat (s)1) 54.8 54.8 54.8 6. 76 6. 76 6. 76 161 161 161 161 161 161 Table Dalziel parameters and ... human Glc6P dehydrogenase may involve a rapid-equilibrium rather than a steady-state random-order mechanism, although admittedly the curva- Ó FEBS 2002 Human glucose- 6- phosphate dehydrogenase ... the sugar phosphate as the leading substrate can similarly be made by comparing the data for alternative coenzymes (Tables and 2) The mean value of /NADP+Glc6P//NADP+ is 55 lM for NADP+ as coenzyme,...
- 8
- 373
- 1
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx
... CATGAGGCTCACCACCACA (AL929357) (PF08–0071) PfTrxR PfSOD TTGTACTAATATTCCTTCAATATTTGCTG CAACGCTGCTCAAATATGGA GGGGGACACCGCCCGTCGCTCCCCC CGGGCAGCAAGGCATAACGCAAGCCCG ACAATTCATCATATCTTTCAATCGG CCTAAACGGGATTTTTCGACA ... TTTATCGACGAGAAATTTTCCAA (X74988) (PFL0595C) PfG6PD-6PGL PfGPx GAACTCCAGGAAAAACAAGTCAAG AATTGTGATTCGATGCATGATG CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG GCCACGGGCGCTAATT ... (20 06) 1537–15 46 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 1543 1544 CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG TTTTGACAAGTCCAAATACCTCTTT TTTATCGACGAGAAATTTTCCAA...
- 10
- 437
- 0
thiếu men g6pd glucose - 6 - phosphate dehydrogenase
... NADPH đường pentose phosphat G6PD: glucose- 6- phosphate dehydrogenase ATP: adenosine triphosphate ADP: adenosine diphosphate NADP+: nicotinamide adenine dinucleotide phosphate [dạng oxy h a] ; ... oxy h a] ; NADPH: dạng NADP bị khử GSSG: glutathione bị oxy h a; GSH: glutathione bị khử Glucose phosphate dehydrogenase deficiency, trang web:http://www.malariasite.com /malaria/ g6pd.htm Tổn ... G6PD phổ biến G6PD Đ a trung hải (G6PD B) Phân loại Tổ chức Y tế Thế giới (WHO) G6PD Asahi (G6PD A- ) G6PD- Canton (G6PD A) Nhóm II Nhóm III Nhóm II A → G ± G → A vị trí 3 76 (A → G) 202 (G → A) ...
- 25
- 592
- 3
THIẾU MEN G6PD (Glucose - 6 - Phosphate Dehydrogenase) (Kỳ 2) pot
... Sulfamethoxypyridazine C11H12N4O3S Thấp Sulfanilamide 66 Tất C6 H N O S Cao (Sulphanilamide) Tất 67 Sulfapyridine C11H11N3O2S Cao Sulfasalazine, Tất 68 Salazosulfapyridine C18H14N4O5S Cao (Salazopyrin) ... Thấp Đ a Trung Hải O-Acetylsalicylic Acid 35 C9 H8 O4 Cao (Acetylsalicylic acid) Châu Á Đ a Oxidase, Urate Trung Hải 36 Cao (Urate oxidase) Châu Á Tất 37 Pamaquine C42H45N3O7 Cao Para-Aminobenzoic ... Sulfafurazole 61 C11H13N3O3S Cao (Sulfafurazone, Sulfisoxazole) Châu Á Tất 62 Sulfaguanidine C7H10N4O2S Thấp Tất 63 Sulfamerazine C11H12N4O2S Thấp Tất 64 Sulfamethoxazol C10H11N3O3S Cao Tất 65 ...
- 16
- 498
- 2
Thiếu men G6PD – 1 (Glucose 6 phosphate dehydrogenase) pptx
... thiếu G6PDH Acetanilic Ciprofloxacine Chloramphenicol Dapson Furazolidone Glafenine Methylene bleu Nalidixic acid Naphtalene PSA Primaquine Sulfacetamide Sulfamethoxazole Sulfanilamide Sulfapyridine ... đường oxy hoá trực tiếp glucose, vòng pentose phosphate Cụ thể men oxy hoá D -glucose phosphate trở thành D -glucose -dlacton -6- phosphate với có mặt NADP G6PDH có hoạt độ cao tuyến vú, vỏ thượng ... hiệu 5ad Một transcetolase khác vận chuyển carbon đầu xylulose đến cho erythrose phản ứng transaldolase để lại, tạo phân tử phosphoglyceraldehyt phân tử fructose phosphate Fructose phosphate biến...
- 21
- 831
- 7
Thiếu men G6PD - 2 (Glucose 6 phosphate dehydrogenase) pdf
... biết số quốc gia Lào 7.2%, Thái Lan 11.5%, Indonesia 3.7% Myanmar 5.4%, Việt Nam khoảng dao động 3% (Matsuoka H Kuni Iwai., 2000; T.T.Tĩnh cs., 2007), Pakistan tỷ lệ thiếu men G6PDH khác dân tộc, ... G6PDH quần thể người Việt Nam alen hay nhóm alen đột biến thông qua kỹ thuật sinh học phân tử PCR, sau xác định tính a hình cấu trúc mạch đơn DNA qua phương pháp SSCP (Single strand Conformation ... tộc Pathan 15.8%, Uzbak 9.1%, Tajik 2.9% Tukoman 2.1% (Bouma cs., 1995) Tỷ lệ thiếu men chung khu vực Đông Nam Á, Đ a Trung Hải New Papue Gunea 3-5% Tỷ lệ nam giới nước Ý, Hy Lạp, Ả Rập cao so...
- 25
- 636
- 3
THIẾU MEN G6PD (Glucose - 6 - Phosphate Dehydrogenase) ppsx
... Oxidase, Urate 36 Cao (Urate oxidase) 37 Châu Á C42H45N3O7 Cao Tất C7H7NO2 Thấp Tất C8H9NO2 Pamaquine Thấp Tất C18H27N3O Cao Tất Para-Aminobenzoic Acid (438 Aminobenzoic Acid) Paracetamol 39 (Acetaminophen) ... Sulfamerazine C11H12N4O2S Thấp Tất 64 Sulfamethoxazol C10H11N3O3S Cao Tất 65 Sulfamethoxypyridazine C11H12N4O3S Thấp Tất C6 H N O S Cao Tất Sulfanilamide 66 (Sulphanilamide) 67 C11H11N3O2S Cao ... Sulfapyridine Cao Tất Sulfasalazine, 68 Salazosulfapyridine (Salazopyrin) Đ a Trung Hải Thiazosulfone 69 C9H9N3O2S2 Cao (Thiazolesulfone) 70 Châu Á Thấp Tất Cao Tất C20H31NO Tiaprofenic Acid...
- 19
- 546
- 1
Thiếu Men G6PD (Glucose-6-Phosphate Dehydrogenase) pdf
... chất tương tự vitamin K (vitamin K analogs) +Tránh sulfonamides sulfanilamide, sulfamethoxypyridazine, sulfacetamide, sulfadimidine, sulfapyridine, sulfamerazine, sulfamethoxazole +Tránh tiếp ... Dạng thiếu G6PD:tất O-Acetylsalicylic Acid (acetylsalicylic acid) C9 H8 O4 Nguy cơ:cao Dạng thiếu G6PD:DTH-Châu Á Oxidase, Urate (urate oxidase) Nguy cơ:cao Dạng thiếu G6PD:DTH-Châu Á Pamaquine C42 ... thiếu G6PD: tất Arsenic As-H3 Nguy cơ:cao Dạng thiếu G6PD:tất Ascorbic Acid C6 H8 O6 Nguy cơ:thấp Dạng thiếu G6PD: tất Beta-Naphthol (2-Naphthol) C10 H8 O Nguy cơ:cao Dạng thiếu G6PD:tất Chloramphenicol...
- 25
- 655
- 3
THIẾU MEN GLUCOSE - 6 - PHOSPHATE DEHYDROGENASE Ở TRẺ SƠ SINH ĐƯỢC SINH RA ppt
... in malaria endemic areas is more higher than others In Ninh Thuan, there are many ethnic groups and 61 .8% of inhabitants living in malaria endemic areas However, there is not any study on situation ... group and ten of them lived in malaria endemic areas The average gestational age was 38.2 weeks and the mean of weight was 3.100 grammes The result of study showed that there was a significant ... (40%) and others (3.1%) (p < 0.05) Although the rate of G -6- PD deficiency of neonates living in malaria endemic areas was more higher than other areas (4.0% vs 2.9%) and the rate of G -6- PD deficiency...
- 45
- 680
- 8
SETTLEMENT OF CONPLAINTS AND DENOUNCEMENT A METHOD TO ENSURE LEGISLATION AND DISCIPLINE IN VIETNAMESE STATE ADMINISTRATIVE MANAGEMENT AT RESENT
... legislation system and laws related to land and other relevant policies, laws; Enhancing and innovating the propagandization of law education in a practical, effective and concentrated manner ... inspect and assess regulations and operation of all levels, branches and agencies to find out feasible solutions, advantages and disadvantages, limitations of departments to gradually complete state ... group, land for borrowing, land in connection with farms and plantation, land relating to army and police; whereas in the Highland provinces, the complaints and disputes focus on land management and...
- 28
- 374
- 0
Báo cáo y học: " SpeCond: a method to detect condition-specific gene expressio" doc
... of America 2004, 101 :60 62–7 15 Ihaka R, Gentleman R: R: A Language for Data Analysis and Graphics Journal of Computational and Graphical Statistics 19 96, 5:299–314 16 Team RDC: R: A Language and ... represents a small proportion of the data and is well separated from the main component; and (ii) whether the mixture component represents a small proportion of the data and has a large standard deviation ... Responses Pharmacology 2008, 36: 1 063 –1072 - 15 - 27 Kirschner MA, Arriza JL, Copeland NG, Gilbert DJ, Jenkins NA, Magenis E, Amara SG: The Mouse and Human Excitatory Amino Acid Transporter Gene (EAAT1)...
- 29
- 380
- 0
Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt
... in an operon may not be valid and such extrapolation was not our goal However, we were able to clearly separate the sensing and transport activities of UhpC membrane protein Materials and methods ... filters were placed in vials containing scintillation cocktail (Quicksafe A, Zinsser Analytic, Frankfurt/Main, Germany) The radioactivity was quantified in a Canberra-Packard Tricarb-2500 counter ... reciprocal exchange D223K abolished both transport and sensing and the mutant G213V is constitutive and lacks the ability to transport Glc6P (Table 1) The mutant H222Q also lacks transport activity...
- 8
- 411
- 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
... rheumatoid arthritis J Rheumatol 2003, 30:9 26- 933 Nieto A, Caliz R, Pascual M, Mataran L, Garcia S, Martin J: Involvement of Fcgamma receptor IIIA genotypes in susceptibility to rheumatoid arthritis ... discrimination, the cutoff OD (mean value + standard deviation) was 0.98 for human recombinant GPI and 0 .64 for rabbit native GPI Genomic DNA was isolated from 0.5 ml anticoagulated peripheral blood, ... model and human disease Nat Immunol 2001, 2:7 46- 753 van Gaalen FA, Toes RE, Ditzel HJ, Schaller M, Breedveld FC, Verweij CL, Huizinga TW: Association of autoantibodies to glucose- 6- phosphate isomerase...
- 6
- 414
- 0
Báo cáo y học: "Induction of a B-cell-dependent chronic arthritis with glucose-6-phosphate isomerase" pptx
... Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP70 gene causes autoimmune ... (red and swollen) toe and knuckle was scored as 1, whereas an affected ankle was scored as (total: 15/paw) [24] Antibody analysis Serum for analysis of antibody levels was taken at indicated ... indicated strains were immunized with 200 µg glucose- 6- phosphate isomerase (G6PI) in complete Freund's adjuvant Blood was drawn at day 40 and analyzed by ELISA for anti-hG6PI and anti-CII total IgG...
- 9
- 392
- 0
Báo cáo y học: "Therapeutic effects of antibodies to tumor necrosis factor-α, interleukin-6 and cytotoxic T-lymphocyte antigen 4 immunoglobulin in mice with glucose-6-phosphate isomerase induced arthritis" docx
... hematoxylin and eosin, and evaluated for histologic changes indicating inflammation, pannus formation, and cartilage and bone damage Preparation of splenocytes and cytometric bead array Spleens were ... Nishimoto N, Yoshizaki K, Miyasaka N, Yamamoto K, Kawai S, Takeuchi T, Hashimoto J, Azuma J, Kishimoto T: Treatment of rheumatoid arthritis with humanized anti-interleukin -6 receptor antibody: a multicenter, ... Sherrer Y, Kremer J, Birbara C, Box J, Natarajan K, Nuamah I, Li T, Aranda R, Hagerty DT, Dougados M: Abatacept for rheumatoid arthritis refractory to tumor necrosis factor α inhibition N Engl...
- 8
- 318
- 0
Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf
... BAD and glucokinase reside in a mitochondrial complex that integrates glycolysis and apoptosis Nature 424, 952–9 56 Castelhano AL, Dong H, Fyfe MC, Gardner LS, Kamikozawa Y, Kurabayashi S, Nawano ... Biol 24, 69 –99 Aiston S, Green AR, Mukhtar M & Agius L (2004) Glucose 6- phosphate causes translocation of phosphorylase in hepatocytes and it inactivates the FEBS Journal 273 (20 06) 3 36 3 46 ª 2005 ... Glc6P and the activity of phosphorylase were also similar after h and h Metabolite and enzyme assays Glc6P and Fru2,6P2 were determined as described previously [8] Glucokinase (free and bound activity)...
- 11
- 503
- 0
Báo cáo y học: "Immunization with an immunodominant self-peptide derived from glucose-6-phosphate isomerase induces arthritis in DBA/1 mice" pot
... used as the substrate, and the optical density was measured at 492 nm Statistical analysis All data are presented as the mean ± standard error of the mean unless otherwise indicated Statistical analysis ... collagen auto-antibodies Scand J Immunol 1990, 31:147-157 19 Stuart JM, Tomoda K, Yoo TJ, Townes AS, Kang AH: Serum transfer of collagen -induced arthritis II Identification and localization of autoantibody ... Nat Med 2005, 11:1113-1117 30 Iwanami K, Matsumoto I, Tanaka Y, Inoue A, Goto D, Ito S, Tsutsumi A, Sumida T: Arthritogenic T cell epitope in glucose- 6phosphate isomerase -induced arthritis Arthritis...
- 11
- 292
- 0
Báo cáo y học: "Altered peptide ligands inhibit arthritis induced by glucose-6-phosphate isomerase peptide" pot
... FACSCalibur (BD PharMingen) and data were analyzed with FlowJo (Tree Star, Ashland, OR, USA) Analysis of anti -glucose- 6- phosphate isomerase antibody Sera were taken from immunized mice on day 28 and were ... added, and after an additional 72 hours of culture, the supernatants were assayed for IL-17 by ELISA The inhibition ratio was calculated as stated in Pre-pulse assay Data presented as average ± standard ... Sherrer Y, Kremer J, Birbara C, Box J, Natarajan K, Nuamah I, Li T, Aranda R, Hagerty DT, Dougados M: Abatacept for rheumatoid arthritis refractory to tumor necrosis factor α inhibition N Engl...
- 14
- 274
- 0
Anh văn 6 Unit 8: Out and about (A 1) ppsx
... football My father is reading a book My father reading a book I'm watch T.V I'm watching T.V She's runing She's running Ann and her mother is waiting for the bus Ann and her mother are waiting ... Students play the game: play walk watch TiÕt Unit 8: Out and about (A1 ) ride wait read drive travel write BÀI TẬP TRẮC NGHIỆM Choose the right sentences (): He is to playing football He is playing ... by teacher Others guess what he's doing (using P.C) WATCH T.V - PLAY FOOTBALL- WASH DISHES - READ BOOKS SING SONGS v.v Activity 3: Noughts and crosses Teacher provides crossed papers and verbs...
- 7
- 460
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25