a cosmetic and functional approach
Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt
... added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢) Amplification was performed ... markers were supplied by Sigma Aldrich (Milan, Italy) Reagents for bacterial growth were purchased from Fluka (Milan, Italy) T4 DNA ligase and Taq polymerase were from Stratagene (La Jolla, CA, ... MT A (m) and mussel MT 10 (n) as a function of the temperature increase from 20 to 90 °C The absorbance decrease at 254 nm was reported as a fraction of the standard absorbance (absorbance at...
- 10
- 414
- 0
Information Technology (IT) Security Essential Body of Knowledge (EBK): A Competency and Functional Framework for IT Security Workforce Development ppt
... Procurement: Manage, Design Regulatory and Standards Compliance: Manage, Evaluate Security Risk Management: Manage, Evaluate Strategic Security Management: Manage, Design, Evaluate System and Application ... classification and data management policies and guidance are issued and updated Specify policy and coordinate review and approval Ensure compliance with data security policies and relevant legal ... Manage Physical and Environmental Security: Manage, Evaluate Procurement: Manage, Design, Evaluate Regulatory and Standards Compliance: Manage, Design, Evaluate Security Risk Management: Manage,...
- 51
- 686
- 0
a metallization and bonding approach for high performance carbon nanotube thermal interface materials
... Tong T, Yang Z, Delzeit L, Kashani A, Meyyappan M and Majumdar A 2007 Dense vertically aligned multiwalled carbon nanotube arrays as thermal interface materials IEEE Trans Compon Packag Technol ... this paper, we explore the use of metallization and bonding of VACNT films for the creation of thermal interface and die attachment materials The metallization is based on evaporated titanium and ... will be based on techniques which can maximize the number of contacts at each interface [9] Cola B A, Capano M A, Amama P B, Xu X and Fisher T S 2008 Carbon nanotube array thermal interfaces for...
- 9
- 446
- 0
DYSLEXIA – A COMPREHENSIVE AND INTERNATIONAL APPROACH pptx
... children at age were morphological awareness, rapid automatized naming, and word reading at age 5, suggesting that rapid automatized naming and morphological awareness are relatively strong correlates ... Beijing, Mainland China, employing a psychophysical experiment, i.e., the motion-onset paradigm A similar psychophysical paradigm was first employed by RogersRamachandran and Ramachandran (1998) ... Developmental dyslexia and dysgraphia: a case report (in Japanese) NO TO HATTATSU (Brain and Child Development) 29, 249–253 Kaneko, M., Uno, A. , Kaga, M., Matsuda, H., Inagaki, M., Haruhara, N (1998)...
- 198
- 158
- 0
Báo cáo y học: " Breast conserving surgery with preservation of the nipple-areola complex as a feasible and safe approach in male breast cancer: a case report" pptx
... initial manuscript DJH performed the initial operation, and organised the primary management plan of the patient He supervised the writing and editing of the paper All the authors have read and approved ... Nahleh ZA: Hormonal therapy for male breast cancer: A different approach for a different disease Cancer Treat Rev 2006, 32:101-105 Fentiman IS, Fourquet A, Hortobagyi GN: Male breast cancer Lancet ... Abbreviations ANC: axillary node clearance; BCS: breast conserving surgery; DCIS: ductal carcinoma in situ; FBC: female breast cancer; FNA: fine needle aspiration; IDC: invasive ductal carcinoma;...
- 3
- 275
- 0
Báo cáo khoa học: " Towards a sane and rational approach to management of Influenza H1N1 2009" docx
... beings, maintaining literally an arm's length from others wherever practicable, and staying home when sick, will achieve more than all the antiseptic wipes and face masks that can be manufactured ... CDC and WHO are actively promulgating behavioral changes that can reduce the circulation of influenza [17] Further education and preparation of health care workers and first responders to deal ... has been measured and appropriate The good faith of the public is a precious commodity When one day a pandemic is trumpeted, and the next day the outbreak is called no more than normal flu and...
- 7
- 236
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site The gene was cloned at the NheI and BamHI sites ... Crystal structure and functional analysis of the SurE protein identify a novel phosphatase family Nat Struct Biol 8, 789–794 Zhang RG, Skarina T, Katz JE, Beasley S, Khachatryan A, Vyas S, Arrowsmith ... 13 b-strands, six a- helices and three 310-helices The core of the protein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 FEBS Journal 275 (2008)...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...
- 12
- 656
- 0
Tài liệu Hemodynamics – New Diagnostic and Therapeutic Approaches Edited by A. Seda Artis pdf
... calculate an output variable from other input variables and parameters The structural analysis by ISM classifies variables and parameters in accordance with the hierarchical levels, which are obtained ... turn, leads to a significant elevation in RI value Bradycardia and hypertension also lead to elevated intrarenal RI If blood pressure and heart flow are stable, an increase in heart level causes ... as abdominal vascular US Anesthetic agents may change systemic and renal hemodynamics and subsequently impact on vascular resistance Extensive data on the cardiovascular effects of drugs can...
- 164
- 582
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... set, A5 1 (5¢GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG ... amplified as described above using partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and ... heart, liver, ventral and dorsal skin, testis, stomach, intestine, urinary bladder and lungs of adult male Xenopus laevis toads Poly (A) + RNA extracted from rat testes and ovaries were used as...
- 11
- 506
- 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership Plan Grant, and a Heart and ... insulin aggregation at 25 °C, heat-induced citrate synthase aggregation at 43 °C, and maintenance of citrate synthase enzyme activity at 43 °C, WT p26 possessed the greatest chaperone activity and...
- 15
- 515
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval development (blastula, gastrula, trochophore larvae, D larvae, and 14 days ... QsBMPR1, 5¢-AGCTTGCCCCCAACCTC-3¢; QaBMPR1, 5¢-ATGGTCTCTGCGGGTTGA-3¢; QsTGFbsfR2, 5¢-GCC AGATCCCAAATTAGTGC-3¢; QaTGFbsfR2, 5¢-TGAA ACCACAGCCTCAGTTG-3¢, where ‘s’ and a indicate sense and antisense ... bootstrap replications is indicated ActR2b Carassius auratus (ABB58749)Daf-1 Caenohabditis elegans (P20792), Daf-4 Caenohabditis elegans (P50488), Cg-TGFbsfR2 C gigas (CAD20574), ActR-2b Danio...
- 17
- 508
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... designed: forward 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S...
- 12
- 561
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... gland, caudate nucleus, temporal lobe, hippocampus, and fetal tissues (brain, kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr...
- 12
- 584
- 0
Complementary and Alternative Medicine for Older Adults A Guide to Holistic Approaches to Healthy Aging ppt
... programs in the Philadelphia area He studied classical yoga with Dr Jayadeva and Hansaji Yogendra at the Yoga Institute in Bombay, India, and is author of Classical Yoga Study Guide Jack Carman, ASLA, ... that dietary saturated fat and trans fats should be reduced, and dietary omega-3 fatty acids and monounsaturated fats should be increased Anticancer Phytochemicals Table 2.1 shows the foods and ... different fats For example, fats are categorized as 18 Complementary and Alternative Medicine for Older Adults saturated, monounsaturated, and polyunsaturated, and the optimal balance for immune...
- 344
- 512
- 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... Mrcp-19k was amplified from M rosa total cDNA using the primers 5¢-ACC AAC GCA GCA GTT ATG GT-3¢ and 5¢-GCT GCA CAT CTT CGA CCT CA-3¢, and then subcloned KOD-plus DNA polymerase (Toyobo, Osaka, Japan)...
- 11
- 488
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... Cloning and characterization of Na+ channel b1B (Eur J Biochem 270) 4763 reaction (RT-PCR) and RACE-PCR Marathon-ReadyTM human adrenal gland and fetal brain cDNA libraries were purchased from ... kit (Ambion, Austin, TX, USA), in the presence of antisense primer SB1-20 (5¢-TC AAACCACACCCCGAGAAA-3¢) and [32P]dATP[aP] (3000 CiÆmmol)1; Amersham Pharmacia Biotech.), following the manufacturer’s ... individual data point in the histogram represents the peak inward current for a single oocyte Also shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio, and the sample size...
- 9
- 415
- 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino were observed Theoretical approach mathematical simulation ... the above values, application of the MATHEMATICA-3.0 program [37] to the case of a reaction mixture containing ATP, ADP and AMP (at the same concentrations as those present in the experimental approach, ... cells and automated assays of adenylate, citrate, pyruvate and glucose-6-phosphate pools Anal Biochem 58, 208216 23 Sillero, M .A. , Del Valle, M., Zaera, E., Michelena, P., Garcia, A. G & Sillero, A...
- 12
- 506
- 0
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
... its natural substrate, the zona pellucida, and with polysulfated polysaccharides Development 111, 1165±1172 Baba, T., Kashiwabara, S., Watanabe, K., Itoh, H., Michikawa, Y., Kimura, K., Takada, ... during the assembly of the head of bacteriophage T4 Nature 227, 680±685 Kodama, E., Baba, T., Yokosawa, H & Sawada, H (2001) cDNA cloning and functional analysis of ascidian sperm proacrosin J ... Spermatozoa lacking acrosin protein show delayed fertilization Mol Reprod Dev 46, 370±376 Yamagata, K., Murayama, M., Okabe, M., Toshimori, K., Nakanishi, T., Kashiwabara, S & Baba, T (1998) Acrosin accelerates...
- 7
- 493
- 0
DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf
... Chakravarty, Rajkumar Patra and Rohit Raja Chapter Density Estimation and Wavelet Thresholding via Bayesian Methods: A Wavelet Probability Band and Related Metrics Approach to Assess Agitation and ... Wavelet Transforms Techniques 27 Awad Kh Al-Asmari and Farhan A Al-Enizi Chapter DWT Based Resolution Enhancement of Video Sequences 45 Sara Izadpanahi, Cagri Ozcinar, Gholamreza Anbarjafari and ... Gholamreza Anbarjafari, Hasan Demirel, Sara Izadpenahi, Cagri Ozcinar, Dr Awad Kh Al-Asmari, Farhaan Al-Enizi, Fayez El-Sousy Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright...
- 232
- 417
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose