... Special thanks goes out to Sai Mun and Souvik for always giving me timely assistance and advice in so many areas of research Also to Shruthi, who has been of great assistance for databasing, and analysis ... Tan CL, Reginald K, Chew FT (2006) Genomic organization and characterization of group allergen paralogs from Dermatophagoides farinae In: The 63th American Academy of Allergy and Immunology Annual ... from B tropicalis cDNA using primers Blo t LIC F: 5'- GACGACGACAAGATCATGTTCAAGTTTATCTGTCTC-3’ and Blot LIC R: 5'-GAGGAGAAGCCCGGTTTAATCGACAACCTCGG-3' with highly thermostable pfu polymerase The PCR...
Ngày tải lên: 15/09/2015, 17:09
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... standards (Amersham-Pharmacia Biotech or BioÁRad) DNA fragments of appropriate length were ligated into the T /A vector, pCRII (Invitrogen, San Diego, CA, USA), using T4 DNA ligase overnight at...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... aureus, one of the most important Gram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a wide spectrum of diseases, ranging from superficial skin infections ... Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant FnBR indicated the...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... chemicals used were of the highest grade available, with most being purchased from Wako Pure Chemical Industries (Osaka, Japan) and Takara Shuzo Co (Otsu, Japan) Twofold-concentrated ASW was prepared...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... Data Bank database under the accession number 3NJT Overlay assay Channel analysis Fha30 is a 30-kDa, secreted FHA truncate encompassing the TPS domain and first three repeats It was used as bait ... (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGG CTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGT GGCCGGAGCCAACCTCAGGACGTC-3¢) and RA+YA Lo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTG T-3¢) After mutagenesis and...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... faster than its actual mass would predict because of limited linearization in SDS The value of 38 kDa is consistent with such a dimer band A small amount of a high-molecular-mass aggregate was evident ... grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on 20 February 1997 and stored ... band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher than the molecular mass...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding to five codons encoding an enterokinase ... characterized by minima at 207 nm and by a maximum at 190 nm The negative band at 207 nm had a lower intensity in the case of rBmKIM in comparison with that in the spectra of AaHIT2 (a- toxin) and ... such as A (Ala) or D (Asp) Only AaHIT4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc
... growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able to obtain a dynamic picture of protein occupancy ... supercoiling - a global transcriptional regulator for enterobacterial growth? Nat Rev Microbiol 2005, 3:157-169 Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A: Growth phase-dependent variation in ... Escherichia coli genome and identifies unconventional target sites Genes Dev 2005, 19:2619-2630 20 Gama-Castro S, Jiménez-Jacinto V, Peralta-Gil M, SantosZavaleta A, Peñaloza-Spinola MI, Contreras-Moreira...
Ngày tải lên: 09/08/2014, 20:21
báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx
... 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' ... N-hydroxycinnamoyl/benzoyltransferase from I batatas (AB035183); AtHCT, shikimate/quinate hydroxycinnamoyltransferase of A thaliana (At5g48930); NtHCT, shikimate/ quinate hydroxycinnamoyltransferase of N tabacum (AJ507825); ... HPLC's All authors read and approved the final manuscript Acknowledgements We thank Prof G Mauromicale and Dr R Mauro of the University of Catania for providing plant material We are particularly...
Ngày tải lên: 12/08/2014, 05:20
Functional effects of a novel BIM deletion polymorphism in mediating resistance to tyrosine kinase inhibitors in cancer
... (array-CGH) approaches are tools that can analyse structural variations in a high throughput manner However, arrayCGH cannot identify balanced structural variations such as balanced translocations126 ... kinase, PI3K and JAK-STAT pathways are downstream pathways activated by tyrosine kinases When these pathways are constitutively activated, they can mediate malignant transformation by deregulating cell ... proliferation, inhibiting the induction of apoptosis and enhancing telomerase activity MAP kinase pathway The MAP kinase pathway consists of a phosphorylation cascade that regulates gene transcription...
Ngày tải lên: 10/09/2015, 09:04
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... β-oxidation FA FA Acyl-CoA synthetase Acyl-CoA oxidase L-bifunctional protein 3-ketoacyl-CoA thiolase ω-oxidation + Acetyl-CoA FA FA + Acetyl-CoA CYP 4A enzymes Decrease intracellular FA concentration...
Ngày tải lên: 12/09/2015, 08:20
Genomic organization and functional characterization of a novel cancer associated gene u0 44
... Molecular Cloning and Characterization of a Putative Oncogene, HuUO-44, in Human Ovarian Carcinogenesis Awarded AVON international scholar-in-training award poster presented at the 94th American Association ... mammals (Bandyopadhyay et al., 1999; Bandyopadhyay et al., 2002) It contains a signal peptide at the N-terminus, a ZP domain, a C-terminal putative TMD, and a cytoplasmic tail (Lopez-Casillas ... Singapore.”), National University of Singapore Presentation title: Molecular Characterization of a Membrane-Associated Protein HuUO-44 and its Potential Role in Ovarian Cancer Cell Attachment and...
Ngày tải lên: 14/09/2015, 21:59
Functional studies of a type III and a novel secretion system of edwardsiella tarda
... isolates were invasive in a HeLa cell assay (Marques et al., 1984) Janda et al (199 1a) reported that E tarda was able to penetrate and replicate in cultured HEp-2 cell Clinical isolates of E tarda ... extra-intestinal edwadsiellosis can be treated with a combination of antibiotics, such as a cephalosporin and an aminoglycoside (Janda and Abbott, 199 3a) E tarda infection in fish can be administered ... species of this genus that can infect humans and cause diseases in humans Association of E tarda with human diseases was first reported in 1969 (Jordan and Hadley, 1969) So far, at least 300 clinical...
Ngày tải lên: 15/09/2015, 17:11
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates DNA in vitro and is taken up by mitochondria However, in spite of its substantial import, ... that the extent of alkylation was proportional to the amount of DNA present and was independent of the size of the DNA fragment (Fig 3A, lane 1) As mtDNA in vivo is negatively supercoiled it was...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... Leader peptide domain 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain ... domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), ... AGGTCTTAT GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf
... both Tax1 and Tax2, but amino acids 90 to 100 are also critical for the localization of the viral transactivators [16] Using prediction software as well as in vitro assays, we now describe another ... export via the CRM1 pathway, and that point mutations at positions 195 and 200 abrogate NES mediated translocation All in all, these results demonstrate that the NES sequences of Tax1 and Tax2 have ... using a Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C and E): Western-blot analysis of GFP and GFP-NES...
Ngày tải lên: 13/08/2014, 09:21