3p mir 378 378 and mir 30 mirnas suggests their contribution to adipogenesis
Báo cáo y học: " NF- B subunits RELB C-Rel RELA p50 p52 bound DNA b EMS" docx
... change the pattern of transcription factor (TF) binding to DNA are believed to be a major contributing factor to cis-modulation of gene expression; approximately 30% of expressed genes show evidence ... TFs to interpret and predict the effects of variations on TF binding genome-wide and to begin to model how gene expression varies as a function of polymorphisms within binding sites Materials and ... mapped to the nearest BRS and ordered according to distance of the TAS to the center of the peak summit Figure shows examination of the TAS together with the SNP(s) under the peak that leads to changes...
- 19
- 280
- 0
Báo cáo khoa học: Role of CCP2 of the C4b-binding protein b-chain in protein S binding evaluated by mutagenesis and monoclonal antibodies docx
... lgÆmL)1) for 30 Following this, the membrane was washed again, and incubated for 30 with horseradish peroxidase coupled Vectastain reagent (Vector Laboratories Inc., Ca, USA) prepared according to the ... different assays for their ability to bind protein S In the radioligand blotting assay, proteins were separated by SDS/PAGE, blotted to a poly(vinylidene difluoride)-membrane, and allowed to bind 125 I-labeled ... implying that access to their epitopes was sterically hindered in the fully assembled C4BP molecule All antibodies were IgG, MoAb 15 belonged to IgG1 and MoAb 44 belonged to IgG2a class The antibodies...
- 8
- 389
- 0
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... fluoride and 10% glycerol For helicase and ATPase assays, HpSSB (Wt) and DC20SSB were dialysed against MonoQ and MonoS buffers and subjected to ion exchange chromatography using MonoQ and MonoS ... Wt and DC20 SSB protein in varying concentrations (0, 0.45, 0.9, 1.8, 2.7 and 3.6 lg, respectively) with 300 ng of M13mp18 single-stranded circular DNA and ⁄ or 300 ng of pUC18 double-stranded ... (c-32P)ATP was monitored in the absence and presence of different concentrations of HpSSB in a mixture containing HpDnaB and ssDNA by thin-layer chromatography The positions of ATP and released Pi...
- 13
- 438
- 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot
... indicated mRNA relative to PBGD and compared to that found in Jurkat cells referred as Standard deviations are from two determinations performed in triplicate an overhang of single-stranded 3' DNA In ... and the shelterin subunits TRF1, TRF2 and Pot1 are regulating telomere homeostasis and cell proliferation Results Transcriptional expression of hTERT, POT1, TERF1 and TERF2 genes in resting and ... T lymphocytes, telomerase expression and activity are known to be tightly regulated [40-42] To determine whether POT1, TERF1 and TERF2 genes were submitted to a similar regulation, we analyzed...
- 10
- 281
- 0
Verbs followed by gerunds and infinitives
... Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org)...
- 2
- 433
- 0
Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt
... uorescence and acceptor absorption, and j2 is the orientation factor and accounts for relative orientation of the donor emission and acceptor absorption transition dipole Generally, j2 is assumed to ... strand was added, and the mixture was heated for at 96 C and slowly cooled to room temperature The double-stranded DNA was stored at )20 C in experimental buffer Protein purication The tryptophans ... donoracceptor such as tryptophan AEDANS to be 22 A [26,27], the distance between Trp85 and Cys178-AEDANS in the apo-CRP can be calculated to be 26.6 A This distance decreases by about A to 18.7...
- 11
- 494
- 0
Báo cáo khoa học: Characterization of HbpR binding by site-directed mutagenesis of its DNA-binding site and by deletion of the effector domain pot
... oligomeric form and contact the operator DNA correctly, similarly to that observed previously for DA-XylR, DA-DmpR and DA-TouR [21,25,27] Contrary to XylR, DmpR and TouR derivatives deleted of their A-domain, ... (lanes 7–10) Lanes and 6, no CBP fusion protein added; lanes and 7, 200 nM CBP fusion protein; lanes and 8, 400 nM CBP fusion protein; lanes and 9, 800 nM CBP fusion protein; lanes and 10, 1200 nM ... self-associate on its operator DNA in vitro without effector recognition or ATP binding The HbpR protein even seems to be able to form an oligomeric complex capable of protecting the operator DNA in the...
- 11
- 468
- 0
![Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx](https://media.store123doc.com/images/document/14/br/gc/small_Y97X8XlBli.jpg)
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx
... oligodeoxynucleotides were heated to 80 °C and allowed to cool to room temperature The MTases HhaI and SssI not bind X+CG or GCX+ strands (data not shown) To obtain unmodified GCG ⁄ CGC and GCG ⁄ CGM duplexes, ... ⁄ CGM and GCX+ ⁄ CGM), 5-methylcytosine was introduced into one of the strands of the recognition site instead of the target cytosine The melting curves of the hemimethylated X+CG ⁄ CGM and GCX+ ... adduct and unmodified duplexes, to the MTases SssI and HhaI Autoradiographs of EMSA of competitive binding of the unlabeled B[a]PDE-modified X+CG ⁄ CGM and 32 P-labeled GCG ⁄ CGMref duplexes to M.HhaI...
- 14
- 558
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... R53 band due to the p53–mdm2 complex exhibited only 10% intensity for rb ¼ 0.02, compared to the R53 band due to protein 4696 binding to the same but unmodified substrate (the rb value refers to ... autoradiogram showing retarded bands due to binding of p53(1–363) or p73d proteins to 50-mer target oligos containing PGM1, PGM4, mdm2, p21, p21a and p21b sites Other details as in (A), lanes and ... tagged with hemagglutinin (HA), we used antibody to HA and obtained analogous band patterns to those obtained with p53 (Fig 2; lanes 6–7, bands SR73b and SR73d), confirming the specificity of the observed...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... 6, 10, 14, 18, 22, 26, and 30) , lM (lanes 3, 7, 11, 15, 19, 23, 27, and 31), and lM (lanes 4, 8, 12, 16, 20, 24, 28, and 32) salt-induced ATPase activity very similar to that of HsRad51 in the ... at least twice to verify the absence of significant photobleaching, and were averaged to increase the signal to noise ratio All of the spectra were corrected for the Raman signal and background ... (No 4813) to MT, and Grants-in-Aid from the Japanese Society for the Promotion of Science (JSPS), and the Ministry of Education, Sports, Culture, Science, and Technology, Japan to HK HK and IS were...
- 12
- 662
- 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these two sites harbor the 15 bp O1 and ... correspond to )41G, )43G, )63G, )67G, )74G and )76G (bottom strand) and )33G, )35G, )46G, )56G and )68G (top strand) (Fig 3B) All the protected guanine bases except )56G are located in and around O1 and ... TCATCCAAAACATTCGCCCTCCACTGTTGTAC 5' * Bottom Top Fig Interaction of CI with 15 bp operator DNA (A) Autoradiograms of DMS protection footprints O DNA labeled at the top (Top) or bottom (Bottom) strand was incubated...
- 11
- 432
- 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... site I), C and D (to delete site II), E and F (to delete site III), G and H (to delete the perfect inverted repeat) and I and F (to delete simultaneously sites II and III) were ligated to each other ... proteins revealed that SenRD60A appeared to be partially degraded and aggregated (Fig 1) Both SenRD60A and SenRD65A seem to be perturbed in their conformation and hence show altered DNA-binding abilities ... KOAc) and [32P]ATP[cP] in 25 mm Tris ⁄ HCl (pH 7.5) and 10 mm MgCl2 for 30 at 25 °C or as a control without acetate kinase SenR and P-buffer were added, and the mixture was incubated at 30 °C...
- 14
- 428
- 0
Báo cáo khoa học: Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity pdf
... and Ser114) mutated in dHAND-Ala-X Akt binds to dHAND in vitro and in vivo To examine whether Akt can directly interact with dHAND, we performed pull-down assay using GST- Ó FEBS 2004 dHAND and ... GSTdHAND-(1–132) and -(1–196) In contrast, Akt did not bind to GST-dHAND-(1–102) efficiently, indicating that dHAND may bind to Akt via its bHLH domain To detect the interaction between dHAND and ... SDS/PAGE and bands were detected by staining with Coomassie Brilliant Blue (bottom) Arrowheads indicate the positions of dHAND mutants wild type dHAND (dHAND-WT) (Fig 4B, lanes and 4), leading us to...
- 10
- 483
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... OL and OH represent the origin of L and H strand replication, respectively LSS, L strand start site; HSS, H strand start site The map positions of the rRNA, tRNAs and mRNAs (ND1 to ND6, A6 and ... sequence boxes I-III (CSB), tRNA genes, L and H strand promoters (LSP and HSP), L and H strand transcription start sites (LSS and HSS) The L-strand sequence and position of the putative promoter ... vacuum dried and autoradiographed The individual complexes were excised, and subjected to SDS/PAGE (12% acrylamide) followed by autoradiography South-western blotting The South-western protocol was...
- 13
- 415
- 0
Báo cáo khoa học: Pherokine-2 and -3 Two Drosophila molecules related to pheromone/odor-binding proteins induced by viral and bacterial infections ppt
... and the fractions were handcollected and analyzed by MALDI-TOF MS Three purified fragments were submitted to automated Edman degradation on a pulse liquid automatic sequenator (Applied Biosystems ... subjected to gel permeation HPLC using two serially linked columns (Ultraspherogel SEC 300 0 and SEC 2000 columns, 7.5 · 300 mm, Beckman) Elution was performed under isocratic conditions with 30% acetonitrile ... viral infection was detected by MALDI-TOF MS (Fig 2B) The molecule was purified to homogeneity by gel permeation and reversed-phase chromatography and submitted to proteolysis for structural characterization...
- 10
- 470
- 0
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc
... laminin receptor and laminin binding to LBP was found to be dosedependent, specific and saturable Laminin–LBP interaction also involved a single class of binding sites, which appeared to be conformation-dependent, ... donovani using anti-LBP Ig and protein A–Sepharose beads When these immune complexes were dissociated and run on SDS/PAGE and autoradiographed, we observed a single band at 67 kDa (lane 6) RESULTS ... activity (Kd ¼ 1.92 ± 0.42 nM and Bmax ¼ 10.20 ± 0.90 ng) Mn2+ and Cu2+ are the other two metals, which promoted binding to a small extent whereas Ca2+ and Mg2+ showed inhibitory effect compared with...
- 8
- 420
- 0
Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx
... (i.e the antisense strand to BcBL1) to bind to any concentration of PyrR tested (Fig 2A) Binding of PyrR to BcBL2 and BcBL3 in standard binding buffer in the absence of effectors followed a binding ... because that protein tended to aggregate and failed to bind quantitatively to various hydrophobic filters However, the filter binding method can be used to study RNA binding to PyrR from B caldolyticus, ... caldolyticus PyrR to the three RNA sequences to which it binds in B caldolyticus, which we called BcBL1, BcBL2 and BcBL3, and the effects of nucleotides on RNA binding A rapid and convenient filter...
- 16
- 309
- 0
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
... 1· Gels were dried and autoradiography visualized by using GP-Storage Phosphor Screen and storm scanner and software (Amersham Biosciences) Radioactive bands were quantified and annealing percentage ... kinase inhibitors at 30 °C and then used to analyse in vitro recombinant CNBP phosphorylation in kinase buffer containing 100 lm ATP and lCi [32P]ATP[cP] at 30 °C for Kinase inhibitors analysed ... effective tool for customizing the action of other factors and their upstream signalling systems In the case of c-myc gene, this mechanism is proposed to proceed through the binding of trans factors,...
- 13
- 500
- 0
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
... [24,29 ,30] , and RPA is shown to inhibit the higher order self association of hRad52 rings [31] suggesting that oligomerization of Rad51 and Rad52 is regulated by other molecules to control their ... nucleotide cofactors and later subjected to centrifugation and the resulting pellet and supernatant were analysed by SDS PAGE followed by silver staining (C) Dynamic light scattering to study the ... incubated in binding buffer in the absence (lanes and 3) or presence of 75 lM ssDNA (lanes and 5) and mM ATP (lanes and 5) for h at 37 °C and then subjected to partial digestion with trypsin (Sigma,...
- 9
- 378
- 0
![Báo cáo khoa học: Recognition of DNA modified by trans-[PtCl2NH3(4hydroxymethylpyridine)] by tumor suppressor protein p53 and character of DNA adducts of this cytotoxic complex potx](https://media.store123doc.com/images/document/14/rc/cf/small_cfu1394954409.jpg)
Báo cáo khoa học: Recognition of DNA modified by trans-[PtCl2NH3(4hydroxymethylpyridine)] by tumor suppressor protein p53 and character of DNA adducts of this cytotoxic complex potx
... coordinated to two guanines at their N7 position in the top strand of the duplex TGTGT The platinated top strand was allowed to anneal with unplatinated complementary strand (bottom strand, Fig ... aim to synthesize and characterize a new compound and to investigate its cytotoxicity Thus, to expand the database of biochemical ⁄ biophysical properties of DNA adducts of cytotoxic analogues ... present work The top and bottom strand of the pairs of oligonucleotides in Fig 1(B) are designated ‘top’ and ‘bottom’, respectively, throughout The boldface letter in the top strand of the duplexes...
- 14
- 272
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25