Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot

DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 Vasundhara M. Navadgi, Ashish Shukla, Rahul Kumar Vempati and Basuthkar J. Rao Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India Human Rad51 protein (hRad51), a homologue of Escherichia coli RecA performs the fundamental role of homologous pairing and strand exchange during homologous recombination and double-strand break repair [1,2]. Rad51 and Rad52 colocalize in distinct nuclear foci in response to DNA damage [3]. Yeast rad52 mutants show extensive degradation of the DNA double-strand break ends suggesting that Rad52 is critically involved in stable maintenance of chromo- somal integrity [4]. Cytological studies indicate that Rad52 is required for Rad51 foci formation during meiosis [5] and chromatin immunoprecipitation assays demonstrated the requirement of Rad52 for association of yeast Rad51 to HO induced double strand break site at the MATa locus in vivo [6,7]. Biochemically, Rad52 stimulates the strand exchange activity of Rad51 [8–10] and is shown to displace Replication Protein A (RPA) [11,12] and stabilize the Rad51- single-stranded (ssDNA) filament [13]. hRad51 and hRad52 form ring-shaped structures like other recombination proteins RecA, RecT, human Dmc1 and b protein from bacteriophage k [14–18]. Rad51 and RecA bind DNA as helical filaments whereas their meiosis specific homologue Dmc1 and archaeal recombinase, RadA proteins, form stacked octameric rings on DNA in the absence of ATP and as helical filaments in the presence of ATP [18–20]. The crystal structure of Pyrococcus furiosus Rad51 reveals that it forms a biheptameric ring [21]. High-resolution crystal structural description of human Rad51, human Rad52 and human Dmc1 has delineated the complex- ity of homologous-pairing as well as the inter-subunit interaction domains [18,21–24]. Structural studies with both Rad51 and RecA suggest two distinct oligomeric states of these proteins: rings and DNA-bound helical forms [21,25]. Light scattering studies on RecA assem- bly have suggested that under some solution conditions free protein filament assembly effectively competes with RecA assembly on ssDNA [26,27]. This property of RecA seems to be evolutionarily conserved as archaeal RadA also forms long helical filaments even in the absence of DNA and the protein assembles into Keywords DNA binding; homologous recombination;oligomerization; Rad51; Rad52 Correspondence B.J. Rao, Department of Biological Sciences, Tata Institute of Fundamental Research, Homi Bhabha Road, Colaba, Mumbai 400 005, India Fax: +91 22 22782606 ⁄ 22782255 Tel: +91 22 22804545 Extn: 2606 (Received 1 October 2005, accepted 10 November 2005) doi:10.1111/j.1742-4658.2005.05058.x Purified human Rad51 and Rad52 proteins exhibit multiple oligomeric states, in vitro. Single-stranded DNA (ssDNA) renders high molecular weight aggregates of both proteins into smaller and soluble forms that include even the monomers. Consequently, these proteins that have a pro- pensity to interact with each other’s higher order forms by themselves, start interacting with monomeric forms in the presence of ssDNA, presumably reflecting the steps of protein assembly on DNA. In the same conditions, DNA binding assays reveal hRad52-mediated recruitment of hRad51 on ssDNA. Put together, these studies hint at DNA-induced disassembly of higher-order forms of Rad51 and Rad52 proteins as steps that precede protein assembly during hRad51 presynapsis on DNA, in vitro. Abbreviations ATPcS, Adenosine 5¢-O-(3-thiotriphosphate); hRad51, human Rad51; hRad52, human Rad52; ssDNA, single-stranded DNA. FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 199 shorter and thicker nucleoprotein filaments when ssDNA is added [28]. Tumour suppressors BRCA2 and p53 interact with the oligomerization domain of Rad51 [24,29,30], and RPA is shown to inhibit the higher order self association of hRad52 rings [31] sug- gesting that oligomerization of Rad51 and Rad52 is regulated by other molecules to control their activity. In this work, we have studied the oligomeric states of hRad51 and hRad52 in the presence and absence of ssDNA. Our studies indicate that human Rad51, like its bacterial homologue RecA exists in multiple aggre- gation states [14,32]. DNA seems to dissociate the higher order structures of both hRad51 and hRad52. hRad52 interacts specifically with higher oligomeric states of hRad51 in the absence of DNA, but with hRad51 monomers when ssDNA is present. These results are rationalized through a model where we pro- pose that the interaction between hRad52 and hRad51 monomers in the presence of DNA might be related to the steps of protein recruitment during hRad51 pre- synapsis on ssDNA. Results and discussion hRad51 is a 37-kDa protein whereas hRad52 is a 55-kDa protein. Both of the proteins are known to exist in oligomeric forms [15,20–23]. Here, we describe the changes associated with the aggregation states of hRad51 and hRad52 in the presence of 121-mer ssDNA and hRad52 mediated assembly of the ssDNA–hRad51 complex. The changes in the protein aggregation states were monitored by three different readouts: native PAGE, centrifugation assays, and analyses of hydrodynamic radii changes by dynamic light scattering (DLS). ssDNA-induced disassembly of higher oligomeric forms of hRad51 A fixed amount of hRad51 (7.5 lm) was incubated with ssDNA (0–22 lm) as described in Experimental procedures and analysed by native gel electrophoresis (Fig. 1A) and centrifugation assays (Fig. 1B). hRad51 migrated as a highly aggregated form (several hun- dred kDa complexes) that barely entered into the gel. Only a faint signal was detectable at the mono- mer position (based on the mobility of standard molecular weight markers) (lane 1, Fig. 1A). In the presence of ssDNA, the level of monomers increased (compare lanes 2–4 with lane 1, Fig. 1A). In these gel conditions, even though ssDNA and hRad51 were migrating close to each other, there was enough difference between the two to discern an increase in the monomer level. Using 5¢ 32 P-labelled ssDNA, we mapped the positions of protein–DNA complexes in this gel system (data not shown; compare Fig. 4). Based on this comparison, the protein–DNA com- plexes that entered into the gel mapped to the posi- tion indicated by the asterisk in Fig. 1A. The ssDNA mediated increase in monomer level remained essentially unchanged in the presence of nucleotide cofactors ADP, ATP or ATPcS (compare lanes 6–8, 10–12, 14–16 with of 2–4, respectively, Fig. 1A). However, the signals associated with protein–DNA complexes (position indicated by asterisk) appear to diminish and that of higher oligomeric forms that enter into the gel (as labelled in Fig. 1A) appear to increase in sets containing nucleotide cofactors. This trend is consistent with ATP induced effects reported earlier, where much larger forms of hRad51 are dis- aggregated into oligomeric complexes equivalent to 3–8 protein monomers [33]. In order to trap the oligomeric forms that do not enter the gel, we used centrifugation assays. Following the assay, we recovered a fraction of the protein in the pellet (lane 1, Fig. 1B) and the remainder in the super- natant (lane 5). In the presence of ssDNA, the protein fraction that was pelletable became fully soluble, as no signal was recovered in the pellet (lanes 2–4). This effect suggested that addition of ssDNA renders pellet- able forms of protein aggregates into smaller and more soluble forms. Consequently, the resultant ssDNA– protein complexes formed (see Fig. 5) are soluble as they are recovered in the supernatant fraction of the assay. Both of the assays suggested that addition of ssDNA facilitates significant level of disaggregation in hRad51. To reconfirm the DNA mediated disaggregation of hRad51, we analysed the hydrodynamic radii (R h )of hRad51 as a function of ssDNA using dynamic light scattering studies. Monomodal distribution of R h val- ues (in nm) vs. intensity is plotted as histograms where the observed R h distribution (10–80 nm range) is grouped into categories (a–d) for easy comparison between samples (Fig. 1C). It is to be noted that under these conditions, buffer components as well as naked ssDNA in solution hardly scatter any light, thereby yielding no detectable DLS signal in this R h range. The free protein showed a distribution of R h ranging from 30 to 80 nm sizes (grouped as b, c and d in Fig. 1C). Upon ssDNA addition, the distribution shif- ted towards smaller R h values (10–20 nm size, grouped as a) with a concomitant drop in the levels of larger ones (grouped as c and d). As a result, at the highest concentration of DNA, the distribution revealed a high preponderance of smaller protein particles and reduced Disassembly and recruitment of hRad51 and hRad52 proteins V. M. Navadgi et al. 200 FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS level of larger ones, thereby corroborating the effect of ssDNA induced disaggregation of hRad51. DNA/ATP induced changes in hRad51 We tested whether DNA induced disaggregation of protein leads to changes in the pattern of limited pro- teolysis of hRad51 by trypsin, where the extent of pro- tease attacks is a function of both conformational as well as overall organizational changes in the target protein system. Comparison revealed that hRad51 is relatively more protected in the presence of ssDNA than in its absence (compare lanes 4 and 5 with lanes 2 and 3, respectively, Fig. 1D). This effect might arise either due to steric hindrance imparted by ssDNA binding or to changes in protein configuration ⁄ conformation following ssDNA binding or a combina- tion of both. ATP has been shown to induce changes in hRad51 such that accessibility to protease attacks is altered [33]. We observed that ATP induced change was somewhat different from that induced by ssDNA (compare lane 3 with lane 4). Note the increase in small sized proteolytic product (indicated by arrow- head 3) with the concurrent decrease in large fragment (indicated by arrowhead 1) in the ATP lane (lane 3). However compared to the control (lane 2), presence of ATP results in an increase in the larger fragment (indi- cated by arrowhead 2, lane 3). The appearance of large fragments in the presence of ATP (compare lane 3 with lane 2) or ssDNA (compare lanes 4 and 5 with lanes 2and 3, respectively) hint that these binders induce discernable changes in hRad51 organization. A B CD Fig. 1. DNA induced solublization of Human Rad51 protein. (A) Native gel assay to visualize oligomeric state of hRad51. hRad51 (7.5 lM) was incubated with 0, 7.5, 15 and 22 l M oligo PUC+ in buffer containing 30 mM Tris ⁄ HCl pH 7.5, 1 mM MgCl 2 ,20mM KCl and 1 mM DTT either in the absence of nucleotide cofactors (lanes 1–4) or in the presence of 1 m M ADP (lanes 5–8), 1 mM ATP (lanes 9–12), 1 mM ATPcS (lanes 13–16) and analysed by native PAGE ( 6% acrylamide) followed by silver staining. (B) Centrifugation assay. hRad51 was incubated with varying concentrations of DNA as described in (A) in the absence of any nucleotide cofactors and later subjected to centrifugation and the resulting pellet and supernatant were analysed by SDS PAGE followed by silver staining. (C) Dynamic light scattering to study the effect of DNA on hydrodynamic radius (R h ) of hRad51. hRad51 (1 lM) was incubated with 0, 1, 3, 4 and 5 l M of oligo PUC+ (in the absence of any nucleotide cofactor) followed by the measurement of hydrodynamic radius of the protein molecules. Monomodal distribution of R h values (in nm) vs. intensity is plotted as histograms where groupings a–d depicts 10–80 nm range distribution. (D) Partial proteolysis experiment to analyse DNA induced conformational changes on hRad51 protein. hRad51 (25 l M) was incubated in binding buffer in the absence (lanes 2 and 3) or presence of 75 l M ssDNA (lanes 4 and 5) and 1 mM ATP (lanes 3 and 5) for 1 h at 37 °C and then subjected to partial digestion with trypsin (Sigma, Munich, Germany) (50 lgÆmL )1 ) for 1 min. The reaction was quenched by Laemmli buffer and analysed by SDS ⁄ PAGE (20% acrylamide), followed by silver staining. Lane 6 consists of only ssDNA. V. M. Navadgi et al. Disassembly and recruitment of hRad51 and hRad52 proteins FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 201 DNA-induced disassembly of higher oligomeric forms of hRad52 A similar effect of disaggregation by ssDNA was also observed with hRad52 protein. In the absence of ssDNA, hRad52 protein appeared to be so highly aggregated that it hardly entered into the gel (lane 5, Fig. 2A) and was mostly in the pellet fraction following a centrifugation assay (lane 1, Fig. 2B). Aggregation of hRad52 appears to be highly salt sensitive and in the present assay conditions with 20 mm KCl, the protein remains highly aggregated. The addition of ssDNA ren- dered the protein into forms that not only entered into the gel, but also migrated as the monomeric form. This effect was further evidenced by the complete recovery of the protein in the supernatant fraction, as a function of added ssDNA (lanes 7 and 8, Fig. 2B). Protein aggregation/disaggregation changes vs. ionic effects In order to assess whether ssDNA induced diaggrega- tion of hRad52 ⁄ hRad51 proteins reflects anionic effects contributed by ssDNA, we tested another relevant anion ATP and compared with its counter-cation Mg 2+ in the same assays. A titration with varying ATP concentra- tions had no effect on hRad52 sedimentation properties. Most protein that was in pellet fraction of the assay remained so even after the addition of 5 mm ATP (Fig. 3A), suggesting that anionic ATP had no effect on protein aggregation. As a control, we compared hRad51 protein in the same assay. ATP, a known modulator of hRad51 function, caused protein disaggregation, as evi- denced by significant recovery of hRad51 in the super- natant fraction of the assay (Fig. 3A). This effect is consistent with an increase in the level of higher oligo- meric forms of protein that enter into the gel due to ATP (compare lane 9 with lane 1, Fig. 1A). However, unlike with ssDNA where the entire protein fraction was rendered soluble by 7.5–15 lm nucleotide concen- tration of DNA (Fig. 1B), only a fraction of protein sample became soluble with as high as 5 mm ATP (Fig. 3A), suggesting that the effects were distinct and not related to general ionic conditions in the assay. This conclusion was further strengthened when the protein aggregation was tested as a function of Mg 2+ . In the same assay, Mg 2+ titration rendered hRad52 highly sol- uble, whereas hRad51 was highly insoluble (Fig. 3B). A significant fraction of pelletable hRad52 was recovered in the supernatant fraction following Mg 2+ treatment, indicating that the protein was subject to solublization not only by ssDNA (Fig. 2A and B), but also by Mg 2+ (Fig. 3B), a common effect facilitated by oppositely charged ionic species. On the other hand, hRad51 exhib- ited a behaviour opposite to that of hRad52 by under- going high level of aggregation, which is akin to that of E. coli RecA aggregation induced by Mg 2+ observed earlier [32]. These studies indicate that hRad52 ⁄ hRad51 disaggregation ⁄ aggregation properties assayed here reflect genuine modulations rendered by ssDNA ⁄ ATP ⁄ Mg 2+ , etc. rather than nonspecific ionic effects in solution conditions. hRad52 protein selectively interacts with higher oligomeric forms of hRad51 in the absence of DNA As seen in earlier experiment, hRad51 exhibited multiple oligomeric forms (lane 1, Fig. 4A) whereas hRad52 was in an aggregated state and hardly entered into the gel (lane 5, Fig. 4A). hRad51 (10 lm) was A B Fig. 2. DNA induced solublization of Human Rad52 protein. (A) Native gel to visualize oligomeric state of hRad52. hRad52 (10 l M) was incubated with 0, 10, 20 and 30 l M (lanes 1–4) oligo PUC+ in buffer containing 30 m M Tris pH 7.5, 1 mM MgCl 2 ,20mM KCl and 1m M DTT and analysed by native PAGE (6% acrylamide) followed by silver staining. (B) Centrifugation assay. hRad52 was incubated with varying concentrations of DNA as described in (A) and later subjected to centrifugation and the samples analysed by SDS PAGE followed by silver staining. Disassembly and recruitment of hRad51 and hRad52 proteins V. M. Navadgi et al. 202 FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS incubated with increasing concentrations of hRad52 (0–10 lm) in the absence of ssDNA; this led to a grad- ual and selective disappearance of higher oligomeric states of hRad51, whereas the smaller forms of hRad51 were largely unaffected (lanes 2–4, Fig. 4A). At the highest concentration of hRad52, most of higher oligomeric forms of hRad51 were converted into large complexes that did not enter the gel (Fig. 4A). These complexes were present in the pellet fraction in a centrifugation assay (data not shown). Earlier studies had shown that yeast Rad51 and Rad52 also form large complexes that elute much earlier than individual proteins in gel filtration chromatography experiment [34]. Recruitment of hRad51 to ssDNA targets: the role of hRad52 We addressed this issue by analysing the status of sol- uble forms of hRad51 protein as a function of increas- ing hRad52 protein in the presence of ssDNA. As expected, native gel analyses revealed DNA (25 lm) induced ‘monomerization’ of hRad51 protein (10 lm) (compare lanes 2 and 7 with lanes 1 and 6, respect- ively, Fig. 4B). In this native gel assay conditions, the ‘monomerized’ form of hRad52 essentially comigrates with that of hRad51 monomer (compare lanes 2 and 7 with lane 11, Fig. 4B). Interestingly, addition of hRad52 protein led to a measurable depletion rather than a cumulative increase in the monomer signal of both proteins (compare lanes 5 and 10 with 2–4 and 7–9, respectively, Fig. 4B). This was concomitantly associated with the rise of a signal at high molecular weight region in the gel (at asterisk position in lanes 5 and 10). This was observed both with and without ATP. In parallel, we studied protein binding to 5¢ 32 P- labelled ssDNA of 121-mer (used in the previous experiments) and analysed the complex formation by native gel electrophoresis. Increasing concentration of hRad51 led to the generation of protein–DNA com- plexes. The complexes formed at low protein concen- trations were presumably smaller in size and hence entered into the gel (small protein–DNA complexes, Fig. 5) and those at high protein concentrations were much larger and retained at the top of the gel (large protein–DNA complexes). Moreover, there appeared to be a precursor–product relationship between the small and large complexes, where the appearance of large complexes was concomitantly associated with the disappearance of small ones. To assess the role of hRad52 on hRad51 binding, we performed gel shift analyses of complexes at a limiting amount of hRad51 (1 lm) in the presence of increasing levels of hRad52. The control experiment revealed that in these condi- tions, the hRad52 protein by itself showed only margi- nal binding (lanes 10 and 11). In the set containing hRad51 protein, addition of hRad52 protein converted free DNA as well as ‘small protein–DNA complexes’ (lane 7) into much ‘larger complexes’ (lanes 8 and 9, Fig. 5). Comparison of gel-shifted complexes in lanes 8 and 9 with those in lanes 3, 4 and 5 reveals that the A B Fig. 3. Aggregation ⁄ disaggregation of hRad51 ⁄ hRad52 proteins vs. ionic effects. (A) hRad51 (10 lM) and hRad52 (10 lM) were incubated in buffer (30 m M Tris ⁄ HCl pH 7.5, 1 mM MgCl 2 ,20mM KCl, 1 mM DTT) containing varying concentrations of ATP, for 30 min at 37 °C, followed by centrifugation and analyses of pellet ⁄ supernatant fractions by SDS PAGE. (B) In separate sets, hRad51 (10 l M) or hRad52 (10 lM) was incubated in buffer (30 m M Tris ⁄ HCl pH 7.5, 20 mM KCl, 1 mM DTT) containing varying concentrations of MgCl 2 for 30 min at 37 °C, fol- lowed by centrifugation and analyses of pellet ⁄ supernatant fractions by SDS PAGE. V. M. Navadgi et al. Disassembly and recruitment of hRad51 and hRad52 proteins FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 203 presence of hRad52 renders much better binding of hRad51 to ssDNA even at lower concentrations of the latter, thereby implying that hRad52 plays a role in the recruitment of hRad51 to ssDNA. The results described in this study help us to under- stand the transitions associated with the oligomeric states of hRad51 and hRad52 proteins in the presence of ssDNA and relate them to their DNA binding activity. The observation that hRad51 protein in its DNA-unbound form, exits in higher oligomeric forms, poses a mechanistic challenge as to how such struc- tures transform into right-handed helical filaments during ⁄ following DNA binding. Whether higher oligo- meric states of protein are directly recruited to DNA or much smaller forms of the protein are generated prior to active assembly, is an open question. Our results suggest that transient contacts of DNA strands with either protein create an effect of ‘protein disaggre- gation’. It is important to note that all the effects uncovered in the present study are from in vitro analy- ses and it is not clear how these effects may relate to the situations in vivo, the mechanistic description of which is not very clear at present. A large body of experimental evidence available in the literature suggests that Rad52 functions as a stimu- lator of Rad51 mediated recombination [8–10], and it has been postulated that these effects of Rad52 are lar- gely due to its role as a recruiter of Rad51 to DNA. Our study extends this hypothesis further by showing that the recruitment of hRad51, mediated by hRad52, might encompass steps where the two proteins together undergo large-scale disaggregation in the presence of ssDNA, followed by interaction between the two at the level of monomeric forms, leading to an active faci- litated assembly of protein–DNA complexes. We want to end with a note of caution: we believe that purified hRad52 ⁄ hRad51 system is a highly complex organiza- tion and is difficult to probe by high-resolution analy- ses at its equilibrium state. We believe that the simple biochemical readouts used in the current study have A B Fig. 4. Effect of DNA on the interaction of hRad51–hRad52. (A) hRad52 selectively interacts with higher oligomeric forms of hRad51 in the absence of DNA. Rad51 (10 l M) was incubated with 0, 2.5, 5.0 and 10 l M (lanes 1–4) of hRad52 in binding buffer (see Experimental procedures) containing 50 m M KCl at 37 °C for 1 h and analysed by native PAGE (6% acrylamide) followed by silver staining. Lane 5 contains 10 l M hRad52 alone. (B) hRad52 interacts with hRad51 monomers in the presence of DNA. hRad51 (10 l M) was incubated with 0, 2, 4 and 10 l M (lanes 2–5 and 7–10) of hRad52 in the presence of 25 l M oligo PUC+ in binding buffer con- taining 50 m M KCl either in the absence (lane 1–5) or presence of 1m M ATP (lane 6–10) and analysed by native PAGE (6% acryl- amide) followed by silver staining. Lane 1 and 6 has hRad51 (10 l M) without DNA and lane 11 had hRad52 (10 lM) with DNA. The position of asterisk indicates the formation of large complex in the presence of hRad51, hRad52 and ssDNA. Fig. 5. hRad51 binding to ssDNA in the presence of hRad52. 32 P labelled oligo PUC+ (1 l M) was incubated with 0, 1, 2, 3, 6 lM hRad51 (lanes 1–5) in the absence of hRad52 and 1 lM hRad51 with 0, 0.25 and 0.50 l M hRad52 (lanes 6–9). Lanes 10 and 11 con- tain DNA samples incubated with hRad52 alone. Samples were resolved by native PAGE (6% acrylamide) and the gel was scanned using a PhosphorImager. Disassembly and recruitment of hRad51 and hRad52 proteins V. M. Navadgi et al. 204 FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS provided some useful clues on important organiza- tional changes that ensue in protein during their recruitment to ssDNA. However the results are limited by the resolution limits imposed by the assays. Experimental procedures Materials T4 polynucleotide kinase, ATP, ADP were from Amersham life Sciences (Piscataway, NJ, USA). ATPcS was obtained from Roche-Molecular Biochemicals (Mannheim, Germany). Ni–NTA agarose beads were from Qiagen (Hiden, Germany). Oligonucleotides were from DNA technology (Aarhus, Denmark). DNA substrate The sequence of the 121-mer ssDNA substrate PUC+, used in this study was: 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢. DNA concentrations are expressed as total nucleo- tide concentrations. The oligonucleotide used in the current study was more than 90% pure, as assessed by 8 m urea- containing denaturing PAGE. End labelling of oligonucleo- tides was carried out as described earlier [35]. Purification of hRad51 and hRad52 The hRad52 overexpressing clone was obtained from Steve West (Cancer Research UK, London, UK, earlier ICRF, London, UK). Protein was purified as described [35]. The hRad51 overexpression plasmid was obtained from Hitoshi Kurumizaka (Wako, Saitama, Japan) and purified as described [36]. Centrifugation assay Reaction mixtures containing DNA and protein (as des- cribed in the figure legends) were incubated in binding buffer [30 mm Tris ⁄ HCl pH 7.5, 1 mm MgCl 2 ,1mm di- thiothreitol (DTT)] at 37 °C for 1 h. Samples were subjec- ted to centrifugation at 14 000 r.p.m. for 10 min. The supernatant and pellet were separated and heated in Laemmli buffer at 90 °C for 10 min and analysed by SDS ⁄ PAGE (10% acrylamide), followed by silver staining. Native polyacrylamide gel electrophoresis of proteins Varying concentrations of Rad51, Rad52 and DNA were incubated in specific conditions (as described in the figure legends) at 37 °C for 1 h. Samples were subjected to native PAGE (6% acrylamide) in TBE buffer at 200 V for 3 h at room temperature (25 °C). Subsequently the proteins were visualized by silver staining. DNA binding by gel-shift assays Labelled DNA substrate was incubated with various con- centrations of hRad51 and hRad52 (as described in the fig- ure legends) in a binding buffer (30 mm Tris ⁄ HCl pH 7.5, 1mm MgCl 2 ,1mm DTT, 100 lgÆmL )1 BSA) at 37 °C for 1 h. DNA–protein complexes were analysed by native PAGE (6% acrylamide) in TBE buffer at 200 V for 3 h at room temperature (25 °C). The radioactivity in the gels was quantified by ImageQuant software on a Phosphor- Imager (Molecular Dynamics, Piscataway, NJ, USA). Dynamic light scattering Measurement of hydrodynamic radius Dynamic light scattering experiments were performed at 22 °C on a DynaPro-MS800 dynamic light scattering instru- ment (Protein Solutions Inc., VA, USA). Buffer solutions were filtered carefully through 20-nm filters (Whatman Ano- disc 13) to remove dust particles. The particulate matter, if any, in the DNA and protein samples, were removed by sub- jecting the samples to centrifugation (14 000 r.p.m) at 4 °C for 10 min. hRad51 (1 lm) was incubated with different con- centrations of DNA (as mentioned in the legends) in a 50-lL reaction buffer (30 mm Tris ⁄ HCl pH 7.5, 1 mm MgCl 2 , 1mm DTT) in the absence of any nucleotide cofactor for 10– 15 min in a quartz cuvette followed by DLS analysis. It was ascertained that the buffer system was free of particles as reflected by very low R h (0.1–0.2 nm) values associated with it. The data were analysed using Dynamics software, which reported the hydrodynamic radii (R h ) for monomodal distri- butions as defined by a baseline from 0.9 to 1.001. Acknowledgements We thank Steve West, Cancer Research, UK, and Hitoshi Kurumizaka, Japan for hRad52 and hRad51 overexpression clones, respectively. References 1 West SC (2003) Molecular views of recombination pro- teins and their control. Nat Rev Mol Cell Biol 4, 435–445. 2 Sung P, Krejci L, Van Komen S & Sehorn MG (2003) Rad51 recombinase and recombination mediators. J Biol Chem 278, 42729–42732. 3 Liu Y & Maizels N (2000) Co-ordinated response of mammalian Rad51 and Rad52 toDNA damage. EMBO Rep 1, 85–90. V. M. Navadgi et al. Disassembly and recruitment of hRad51 and hRad52 proteins FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 205 4 Sugawara N & Haber JE (1992) Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation. Mol Cell Biol 12, 563–575. 5 Gasior SL, Olivares H, Ear U, Hari DM, Weichselbaum R & Bishop DK (2001) Assembly of RecA-like recombi- nases: distinct roles for mediator proteins in mitosis and meiosis. Proc Natl Acad Sci USA 98, 8411–8418. 6 Sugawara N & Wang X, Haber JE (2003) In vivo roles of Rad52, Rad54, and Rad55 proteins in Rad51- mediated recombination. Mol Cell 12, 209–219. 7 Wolner B, Van Komen S, Sung P & Peterson CL (2003) Recruitment of the recombinational repair machinery to a DNA double-strand break in yeast. Mol Cell 12, 221–232. 8 Benson FE, Baumann P & West SC (1998) Synergistic actions of Rad51 andRad52 in recombination and DNA repair. Nature 391, 401–404. 9 Shinohara A, & Ogawa T (1998) Stimulation by Rad52 of yeast Rad51-mediated recombination. Nature 391, 404–407. 10 New JH, Sugiyama T, Zaitseva E & Kowalczykowski SC (1998) Rad52 protein stimulates DNA strand exchange by Rad51 and replication protein A. Nature 398, 407–410. 11 Sung P (1997) Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. J Biol Chem 272, 28194–28197. 12 Sugiyama T.& Kowalczykowski SC(2002) Rad52 pro- tein associates with replication rotein A (RPA)-single stranded DNA to accelerate Rad51 mediated displace- ment of RPA and presynaptic complex formation. J Biol Chem 277, 31663–31672. 13 New JH & Kowalczykowski SC (2002) Rad52 protein has a second stimulatory ole in DNA strand exchange that complements Replication protein–A function. J Biol Chem 277, 26171–26176. 14 Baumann P, Benson FE, Hajibagheri NMA & West SC (1997) Purification of human Rad51 protein by selective spermidine precipitation. Mutat Res DNA Repair 384, 65–72. 15 Stasiak AZ, Larquet E, Stasiak A, Muller S, Engel A, Van dyck E, West SC & Egelman EH (2000) The human Rad52 protein exists as a heptameric ring. Curr Biol 10, 337–340. 16 Thresher RJ, Makhov AM, Hall SD, Kolodner R & Griffith JD (1995) Electron microscopic visualization of RecT protein and its complexes with DNA. J Mol Biol 254, 364–371. 17 Passy SI., YuX, Li Z, Radding CM & Egelman EH (1999) Rings and filaments of B protein from bacterio- phage 1 suggest a superfamily of recombination pro- teins. Proc Natl Acad Sci USA 96, 4279–4284. 18 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K, Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S (2004) Structural basis for octameric ring formation and DNA interaction of the human homologous-pairing protein Dmc1. Mol Cell 14, 363–374. 19 Sehorn MG, Sigurdsson S, Bussen W, Unger VM & Sung P (2004) Human meiotic recombinase Dmc1 pro- motes ATP-dependent homologous DNA strand exchange. Nature 429, 433–437. 20 Yang S, Yu X, Seitz EM, Kowalczykowski SC & Egel- man EH (2001) Archaeal RadA protein binds DNA as both helical filaments and octameric rings. J Mol Biol 314, 1077–1085. 21 Shin DS, Pellegrini L, Daniels DS, Yelent B, Craig L & Bates D., YuDS, Shivji MK, Hitomi C, Arvai AS, Volkmann N, Tsuruta H, Blundell TL, Venkitaraman AR & Tainer JA (2003) Full length archaeal Rad51 structure and mutants: mechanisms for Rad51 assem- bly and control by BRCA2. EMBO J 22,.4566– 4576. 22 Kagawa W, Kurumizaka H, Ishitani R, Fukai S, Nureki O & Shibata T & Yokoyama S (2002) Crystal structure of the homologous-pairing domain from the human Rad52 recombinase in the undecameric form. Mol Cell 10, 359–371. 23 Singleton MR, Wentzell LM, Liu Y, West SC & Wigley DB (2002) Structure of the single-strand annealing domain of human Rad52 protein. Proc Natl Acad Sci USA 99, 13492–13497. 24 Pellegrini L,. Yu DS, Lo T, Anand S, Lee M, Blundell TL & Venkitaraman AR (2002) Insights into DNA recombination from the structure of a Rad51-BRCA2 complex. Nature 420, 287–293. 25 Story RM, Weber IT & Steitz TA (1992) The structure of the E.coli recA protein monomer and polymer. Nature 355, 318–325. 26 Morrical SW & Cox MM (1985) Light scattering studies of the recA protein of Escherichia coli: relationship between free recA filaments and the recA X ssDNA complex. Biochemistry 24, 760–767. 27 Masui R, Mikawa T, Kato R & Kuramitsu S (1998) Characterization of the oligomericstates of RecA pro- tein: Monomeric RecA protein can form nucleoprotein filament. Biochemistry 37, 14788–14797. 28 Lee MH, Leng CH, Chang YC, Chou CC, Chen YK, Hsu FF, Chang CS, Wang AH & Wang TF (2004) Self- polymerization of archaeal RadA protein into long and fine helical filaments. Biochem Biophys Res Commun 323, 845–851. 29 Yu DS, Sonoda E, Takeda S, Huang CL, Pellegrini L & Blundell TL & Venkitaraman AR (2003) Dynamic con- trol of Rad51 recombinase by self association and inter- action with BRCA2. Mol Cell 12, 1029–1041. 30 Buchhop S, Gibson MK, Wang XW, Wagner P, Stur- zbecher HW & Harris CC (1997) Interaction of p53 with the human Rad51 protein. Nucl Acids Res 25, 3868–3874. Disassembly and recruitment of hRad51 and hRad52 proteins V. M. Navadgi et al. 206 FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 31 Jackson D, Dhar K, Wahl JK, Wold MS & Borgstahl GE (2002) Analysis of thehuman replication protein A: Rad52 complex: evidence for crosstalk between RPA32,RPA70, Rad52 and DNA. J Mol Biol 321, 133–148. 32 Brenner SL, Zlotnick A & Griffith JD (1988) RecA pro- tein self-assembly. Multiple discrete aggregation states. J Mol Biol 204, 959–972. 33 Tombline G, Heinen CD, Shim KS & Fishel R (2002) Biochemical characterization of the human Rad51 pro- tein. Modulation of DNA binding by adenosine nucleo- tides. J Biol Chem 277, 14434–14442. 34 Song B & Sung P (2000) Functional Interactions among yeast Rad51 recombinase, Rad52 mediator, and replica- tion protein A in DNA strand exchange. J Biol Chem 275, 15895–15904. 35 Navadgi VM, Dutta A & Rao BJ (2003) Human Rad52 facilitates three-stranded pairing that follows no strand exchange: A novel pairing function of the protein. Biochemistry 42, 15237–15251. 36 Kurumizaka H, Aihara H, Kagawa W, Shibata T & Yokoyama S (1999) Human Rad51 amino acid residues required for Rad52 binding. J Mol Biol 291, 537–548. V. M. Navadgi et al. Disassembly and recruitment of hRad51 and hRad52 proteins FEBS Journal 273 (2006) 199–207 ª 2005 The Authors Journal compilation ª 2005 FEBS 207 . DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 Vasundhara M. Navadgi,. with the aggregation states of hRad51 and hRad52 in the presence of 121-mer ssDNA and hRad52 mediated assembly of the ssDNA hRad51 complex. The changes