Tài liệu Báo cáo khoa học: The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site docx

Eur J Biochem 271, 3923–3936 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04330.x The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site ´ ´ ˇ´ ´ ˇ ´ ´ Rita Krumscheid1, Rudiger Ettrich2, Zofie Sovova2, Klara Susankova3, Zdenek Lansky3, ă Katerina Hofbauerova3,4, Holger Linnertz1, Jan Teisinger3, Evzen Amler3 and Wilhelm Schoner1 Institute of Biochemistry and Endocrinology, Justus-Liebig-University Giessen, Germany; 2Laboratory of High Performance Computing, Institute of Physical Biology USB and Institute of Landscape Ecology ASCR, Nove´ Hrady, Czech Republic; Institutes of 3Physiology and 4Microbiology, Czech Academy of Sciences, Prague, Czech Republic The structural stability of the large cytoplasmic domain (H4H5 loop) of mouse a1 subunit of Na+/K+ ATPase (L354– I777), the number and the location of its binding sites for 2¢-3¢-O-(trinitrophenyl) adenosine 5¢-triphosphate (TNPATP) and p-nitrophenylphosphate (pNPP) were investigated C- and N-terminal shortening revealed that neither part of the phosphorylation (P)-domain are necessary for TNP-ATP binding There is no indication of a second ATP site on the P-domain of the isolated loop, even though others reported previously of its existence by TNP-N3ADP affinity labeling of the full enzyme Fluorescein isothiocyanate (FITC)-anisotropy measurements reveal a considerable stability of the nucleotide (N)-domain suggesting that it may not undergo a substantial conformational change The Na+/K+ ATPase (EC 3.6.3.9) or sodium pump carries out the coupled extrusion and uptake of Na+ and K+ ions across plasma membranes of mammalian cells The enzyme is a heterodimer of a 100 kDa catalytic subunit and a heavily glycosylated b subunit of about 55 kDa [1–3] Ouabain, recently recognized as a mammalian steroid hormone [4], uses the sodium pump in the nanomolar concentration range as a signal transducer [5] but inhibits it at higher (toxic) concentrations [1–3] The ion pumping process is connected to a reaction cycle model with conformational changes of the catalytic a subunit Such changes become visible amongst others in the Na+ Correspondence to W Schoner, Institute of Biochemistry and Endocrinology, Justus-Liebig-University Giessen, Frankfurter Str 100, D-35392 Giessen, Germany Fax: +49 641 9938179, Tel.: +49 641 9938170, E-mail: wilhelm.schoner@vetmed.uni-giessen.de Abbreviations: DANSyl-ATP, 2¢(3¢)-O-(6-N¢,N¢-dimethylaminonaphthalenesulfonyl)ATP; FITC, fluorescein isothiocyanate; GST, glutathione S-transferase; N-domain, nucleotide domain; P-domain, phosphorylation domain; pNPP, para-nitrophenylphosphate; TNP-ATP, 2¢-3¢-O-(trinitrophenyl) adenosine 5¢-triphosphate; Tyr-P, O-phospho-L-tyrosine Enzyme: Na+/K+ exchanging ATPase (EC 3.6.3.9) Note: This work is part of the dissertation of R.K at Justus-LiebigUniversity Giessen, Germany (Received 27 May 2004, revised 27 July 2004, accepted 10 August 2004) upon ATP binding The FITC modified loop showed only slightly diminished phosphatase activity, most likely due to a pNPP site on the N-domain around N398 whose mutation to D reduced the phosphatase activity by 50% The amino acids forming this pNPP site (M384, L414, W411, S400, S408) are conserved in the a1)4 isoforms of Na+/K+ ATPase, whereas N398 is only conserved in the vertebrates’ a1 subunit The phosphatase activity of the isolated H4-H5 loop was neither inhibited by ATP, nor affected by mutation of D369, which is phosphorylated in native Na+/K+ ATPase Keywords: ATPase; H4-H5 loop; p-nitrophenylphosphate; protein expression; TNP-ATP dependent generation of an aspartyl (D369) phosphointermediate with different sensitivities towards the reaction product ADP or the second transport substrate K+ The observation of high and low affinity ATP sites with approximate Kd values of lM (E1ATP site) and 200 lM (E2ATP site) in the membrane-embedded Na+/K+ ATPase, and the finding that reaction inert MgATP complex analogues such as Cr(H2O)4ATP and Co(NH3)4ATP may react specifically with these ATP sites [6] as well as the complex kinetics with the fluorescent 2¢(3¢)-O-(6-N¢,N¢-dimethylaminonaphthalenesulfonyl)ATP (DANSyl-ATP) [7,8], lead to the suggestion that high and low affinity ATP sites coexist and that they interact during catalysis Consistent with this conclusion is the finding that the activity of a K+ activated phosphatase, which represents a partial function of the ATP site [9–12], was almost unaffected by the blockade of the ATP site due to modification of K501 with fluorescein isothiocyanate (FITC) [13], but was lost when the enzyme additionally reacted with Co(NH3)4ATP [14,15] or erythrosin isothiocyanate [16] The latter binds to C549 within the nucleotide (N)-domain of Na+/K+ ATPase [16] Molecular distance measurements after specific labeling of the high and low affinity ATP sites with these fluorescent probes gave evidence for the existence of an (ab)2 dimeric structure [17] The finding of full-site, half-site and quarter-site phosphorylation and reactivities, however, led Taniguchi et al [12] and Froehlich et al [18] to postulate the existence of a functional (ab)4 tetrameric structure of Na+/K+ ATPase Ó FEBS 2004 3924 R Krumscheid et al (Eur J Biochem 271) When the three-dimensional structure of the Ca2+ ATPase pump of sarcoplasmic reticulum became available [19], the possibility arose to deduce, by restraint-based comparative modeling, an analogous three-dimensional structure of the ATP-binding domain(s) of the H4-H5 loop of Na+/K+ ATPase [20] The overall structure for the loop between L354 and L773 excellently predicted the real structure which was obtained much later by crystallization and NMR spectroscopy [21,22] Some deviations from Hakanson’s crystal structure of a much shorter nucleotide loop (R378–D586) were noted, however Hence, some corrections were recently performed to interpret variations in the location of ATP and 2¢-3¢-O-(trinitrophenyl) adenosine 5¢-triphosphate, trisodium salt (TNP-ATP) binding within the N-domain (L354–I604) [23] In silico docking of ATP as well as NMR studies demonstrated that the H4-H5 loop consisting of the N- and phosphorylation (P)-domains contains a single ATP site only on the N-domain [20] Nevertheless, affinity labeling by [32P]8-azido-ADP[aP] of FITC-inactivated and membrane-embedded Na+/K+ ATPase revealed that an amino acid sequence residing on the P-domain C-terminally of K736 is involved in ADP recognition [24,25] K736 of the a subunit has formerly been shown to participate in ATP hydrolysis [26,27] So far it is unclear whether the P-domain’s ADP site may be used when ADP in the overall reaction leaves the active site, i.e after a bending of the N- toward the P-domain connected with the phosphorylation of D369, or whether the a subunit may contain two ATP sites In fact, structural analysis of Ca2+ ATPase crystals revealed the existence of at least three different conformers [19,28,29] It is generally assumed that the activity of a K+ activated phosphatase resides in or close to the ATP binding site and that upon blockade of the ATP site (for instance by modification with FITC [13]), the remaining K+ phosphatase reflects a property of the ATP site [12,30–33] The K+ activated phosphatase which is inhibited by cardiac glycosides presumably reflects the K+ activated step of the hydrolysis of the D369–phosphointermediate in the overall reaction cycle Acylphosphates and p-nitrophenylphosphate (pNPP) may phosphorylate the enzyme protein [10–12,33] With the demonstration that the isolated H4-H5 loop expressed in Escherichia coli retains both TNP-ATP binding [23,34–36] and phosphatase activity [36], the possibility arose to localize both activities within this loop and to study their properties This paper localizes by truncation, single site mutation and in silico docking experiments, the position of the binding site for ATP at the front side of the N-domain between I390 and L576 and reveals the separate existence of a p-nitrophenylphosphatase at the rear site of the N-domain Our studies gave no indication of a second ATP binding site in the self-forming conformer of the isolated H4-H5 loop Experimental procedures All chemicals were of the highest purity available and were obtained from Applichem (Darmstadt, Germany), Bio-Rad (Munich, Germany), Boehringer-Mannheim (Mannheim, Germany), E Merck (Darmstadt, Germany), SigmaAldrich (Taufkirchen, Germany) Molecular Probes (Eugene, OR, USA) or Carl Roth (Karlsruhe, Germany) Pfu-polymerase was from Stratagene (La Jolla, CA, USA) and the restriction endonucleases BamHI and EcoRI were from Promega (Mannheim, Germany) The pGEX-2T expression vector was from Amersham Biosciences (Freiburg, Germany) DNA miniprep and DNA gel extraction kits were from peqLab (Erlangen, Germany) and Qiagen (Hilden, Germany) Supercompetent E coli XL1 blue cells were bought from Stratagene BL21DE3 cells were a generous gift from J Naprstek (Charles University, Prague, Czech Republic) DNA sequencing was performed on an ABI Prism automated sequencer at the facility of the Academy of Sciences of the Czech Republic Calculation and presentation of the data were performed with GRAPHPAD PRISM 3.0 (GraphPad Software, San Diego, CA, USA) Protein–protein amino acid sequence comparisons were performed by BLAST analysis (http://www.ncbi.nlm.nih.gov/ BLAST/Blast.cgi) using the SwissProt Data Bank Enzyme and assays Na+/K+ ATPase from pig kidney with a specific activity of 17 mg protein)1 [37] was quantitated by a coupled spectrophotometric assay [38] One enzyme unit (U) is defined as the amount of enzyme hydrolyzing lmol ATP per minute at 37 °C Protein concentration was determined by Lowry’s procedure for the membrane-bound Na+/K+ ATPase [39] but by the method of Bradford [40] for the H4-H5 loop–glutathione S-transferase (GST) fusion protein and its truncation products K+ activated p-nitrophenylphosphatase as a partial activity of Na+/K+ ATPase was measured as described previously [17] Statistical analysis of the comparison of the phosphatase activities in truncated H4-H5 loop was carried out with Student’s t-test Construction and purification of H4-H5 loop–GST fusion proteins The part of the DNA sequence of the a subunit of mouse brain Na+/K+ ATPase encoding for the large cytoplasmic loop (L354–I777) was amplified by PCR The purified PCR product was digested with BamHI and EcoRI The expression vector pGEX-2T (Amersham Pharmacia) was opened with the restriction endonucleases BglII and EcoRI The insert was ligated into the multiple cloning site of the doubly digested vector downstream of the GST coding sequence With the pGEX-2T–H4H5 construct, supercompetent E coli XL1 blue cells (Stratagene) or BL21DE3 cells were transformed Starting with this vector, loops of different lengths were designed by the insertion of stop codons into the sequence at the positions of K605, R589, C577, G542 and K528, respectively The N-terminal shortened construct I390–S601 was made by subcloning the corresponding DNA sequence into the multiple cloning site of an empty pGEX-2T vector between BamHI and EcoRI sites as described above The following primers were used for the amplification of different constructs, with the relevant site underlined in each case: L354–I777 sense with BglII site: 5¢-CGTAGATCT CTGGAAGCTGTGGAGACC-3¢; antisense with EcoRI site: 5¢-ATGAATTCCAATGTTACTTGTTAGGGT-3¢; L354–I604 sense with stop codon: 5¢-CAGCGCTGG GATTTAGGTCATCATGGTC-3¢; antisense with stop Ĩ FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3925 codon: 5¢-CTCCTGTGACCATGATGACCTAAATCCC AGC-3¢; I390–S601 sense with BglII site: 5¢-GCGTAGA TCTATCCATGAAGCTGACACCACAG-3¢; antisense with EcoRI restriction site: 5¢-ATGAATTCGCGCTGCG GCATTTGCCCACAGC-3¢; L354–P588* sense with stop codon: 5¢-ATTGACCCTCCTTGAGCTGCTGTCCCCG ATGCTGTG-3¢; L354–L576* sense with stop codon: 5¢-CCCGTGGATAACCTCTGATTCGTGGGTCTTAT CTCC-3¢; L354–L541* sense with stop codon: 5¢-GGCC TTGGATAGCGTGTGCTAGGTTTCTGCCACCTC-3¢; L354–L527* sense with stop codon: 5¢-CCCCTGGACGA AGAGCTGTAAGACGCCTTTCAGAATGCC-3¢; the * means that antisense primers of the C-terminally shortened constructs were usually complementary The primer sequence of the N398D construct was GCTGACACCA CAGAGGATCAGAGTGGGGTCTCC and that of the D369A construct CCACCATCTGCTCCGCCAAGACT GGAACTCTGAC The underlined nucleotides encode the mutated amino acid Expression and purification of the GST fusion proteins was performed according to Kubala et al [41] The purity of the expressed protein was controlled by 12% SDS/PAGE and its concentration was determined by the method of Bradford [40] using diluted protein standard (80 gỈL)1) from Sigma All experiments described below were performed with protein samples that had been dialyzed extensively overnight at °C against an excess of 20 mM Tris/HCl, pH 7.8, with one buffer change Phosphatase assay of the H4-H5 loop fusion proteins The assay was performed in variation of the procedure described by Tran & Farley [36]: GST fusion proteins (about 50 lg per sample) were incubated in a buffer containing 64 mM Tris/HCl, 3.2 mM MgCl2, mM KCl and 0.8 mM Na4EDTA, pH 7.4, at 37 °C with increasing concentrations of pNPP (0–2 mM) in a total volume of mL The reaction was stopped after 24–48 h by addition of M NaOH Proteins were sedimented and the absorption of the supernatant was monitored at 405 nm Background (hydrolysis of pNPP under the same conditions in the absence of protein) was substracted The velocity of substrate cleavage was calculated assuming a molar absorption coefficient of 18 500 LỈmol)1Ỉcm)1 Data were fitted to the Michaelis– Menten equation Test for protein tyrosine phosphatase activity The assay was performed using the EnzCheck Phosphate Assay Kit (Molecular Probes, Eugene, OR, USA) The GST fusion proteins L354–I777 and L354–I604 were tested for their ability to release phosphate from O-phospho-L-tyrosine (Tyr-P) The proteins were incubated under the conditions of the phosphatase assay with mM Tyr-P After 22–42 h of reaction time, the following reagents were added to 500 lL of each reaction mix: 345 lL H2O, 50 lL 20· reaction buffer, 100 lL 2-amino-6-mercapto-7-methyl-purine riboside, lL purine nucleoside phosphatase The samples were mixed and incubated for 30 at room temperature Detection of the released phosphate was recorded at 360 nm Controls were without protein/Tyr-P and were run in parallel Determination of TNP-ATP binding to the fusion proteins Steady-state fluorescence of TNP-ATP was measured in 20 mM Tris/HCl, pH 7.8, at 37 °C using a PerkinElmer LS50B fluorometer H4-H5–GST fusion proteins (2 mL; lM GST fusion protein in a · cm quartz cuvette) were titrated with increasing concentrations of TNP-ATP Excitation and emission wavelengths were recorded at 405 nm and 545 nm, respectively, after of incubation at 37 °C in the dark and gentle stirring TNP-ATP binding to the protein was detected as an increase of fluorescence intensity in the presence of protein compared to the fluorescence intensity in its absence [23,42] Determination of eosin binding to the fusion proteins Interaction of eosin Y with GST fusion proteins was studied in similarity to Skou & Esman [43] in 20 mM Tris/HCl, pH 7.8, at 37 °C Excitation (480–530 nm with kEmm ¼ 538 nm) and emission (530–580 nm with kExc ¼ 518 nm) spectra in the presence and absence of lM or 10 lM (L354–P588)–GST fusion protein were recorded on a Hitachi F-3000 Fluorescence Spectrophotometer with nm bandpass Steady-state fluorescence studies were performed with the (L354–I777)–GST fusion protein in the same buffer at 37 °C on a PerkinElmer LS50B Luminescence Spectrometer exciting the probe at 518 nm and recording the emitted fluorescence at 530 nm (5 nm band passes each) and using an emission filter of 530 nm The following ligands were tested with respect to their influence on the steady-state fluorescence of 100 nM eosin Y in 20 mM Tris/HCl, pH 7.8, in the presence of the H4-H5 loop: 10 mM Na+, mM Mg2+, mM PO43–, 1.5 mM and mM ATP Calculation of the dissociation constants for TNP-ATP The signal of buffer and protein (if present) was collected before the addition of TNP-ATP, and this value was subtracted from all further raw data as a background Volume corrections were applied and background values of TNP-ATP fluorescence in the absence of GST fusion proteins were subtracted Fluorescence intensity was normalized so that a fluorescence of lM TNP-ATP (i.e in the absence of protein) was equal to unity The dependence of fluorescence intensity on the concentration of TNP-ATP was fitted to Eqn (1) [44], describing a model with one binding site per protein molecule: F ẳ ẵP ỵ c 1ị  q ẵP ỵ ẵE ỵ Kd ẵP ỵ ẵE ỵ Kd ị2 4ẵPẵE ð1Þ or to Eqn (2) [44], describing a model with n identical, noninteracting, noncooperative binding sites per protein molecule: Ó FEBS 2004 3926 R Krumscheid et al (Eur J Biochem 271) F ẳ ẵP ỵ c 1ị  q ẵP ỵ nẵE ỵ Kd ẵP ỵ nẵE ỵ Kd ị2 4nẵPẵE 2ị where F is the normalized fluorescence, [P] is the concentration of TNP-ATP, [E] is the concentration of the enzyme, c is the enhancement of fluorescence intensity of the bound probe relative to the free probe, and Kd is the dissociation constant The value of the quantum yield enhancement factor c was assessed according to [44] and determined as ± 0.7 for the H4-H5 loop [41] All parameters except Kd were kept constant during the fitting procedure Data are presented as mean ± SEM from the indicated number of independent measurements Modification of the ATP binding site by FITC labeling for phosphatase studies Na+/K+ ATPase from pig kidney (6 U; 300 lg; lM) was incubated in a total volume of mL for 30 in the dark at room temperature in a solution of 40 mM Tris/HCl, pH 9, and 10 lM FITC Excess fluorophore was removed by sedimentation of the protein at 100 000 g in an ultracentrifuge Modification of lM of the (L354–I604)–GST fusion protein proceeded for h in 40 mM Tris/HCl, pH 9, in the presence of 10 lM FITC Free fluorophore was removed by dialysis overnight at °C against a large volume of 40 mM Tris/HCl, pH 7.4 Binding of FITC was determined as the molar ratio of FITC bound per H4-H5 loop or per the a subunit of Na+/K+ ATPase [17] K+ activated phosphatase activity of the ATPase as well as the phosphatase activity of the H4-H5 loop protein were tested as described above [14,17] Labeling and purification of loop protein without the GST tag for fluorescence anisotropy studies GST fusion protein L354–P588 (15 lM) in 20 mM Tris/HCl, pH 9, was labeled for 30 with 30 lM FITC in the dark at room temperature Residual free FITC was removed by dialysis over night against a large excess of 50 mM Tris/HCl, 150 mM NaCl, 2.5 mM CaCl2, pH 7.8 The GST tag was split off by 10 U of human thrombin per mg of GST fusion protein for h at room temperature with gentle shaking The GST protein was removed by incubation of the mixture with mL of pre-equilibrated glutathione Sepharose (see above) This procedure was repeated once more Finally, thrombin and buffer components were removed by size exclusion chromatography on a mL Sephadex G-25 column preequilibrated with 20 mM Tris/HCl, pH 7.8 The concentration of the FITC labeled loop was 145 lgỈmL)1 (2.88 lM), the molar ratio of FITC bound to peptide was 1.2 Molecular modeling Molecular modeling of the H4-H5 cytoplasmic loop of the a subunit of Na+/K+ ATPase ranging from L354 to L773 has been reported previously [20] Models of the cytoplasmic loop of mouse brain Na+/K+ ATPase from L354–I604, L354–L541, L354–L527 and I390–S601 were generated in parallel to Ca2+ ATPase (PDB code 1EUL) [19] with the MODELLER6 package [45] The tertiary structure models were checked with PROCHECK [46], showing g-factors in the same range as reported in [41] for the pig kidney loop A model of the N-domain of mouse brain a1 subunit Na+/K+ ATPase (R378–D586) was generated by analogy to the crystal structure of the corresponding sequence of porcine a2 sodium pump [21,47] The latter, recently published structure lacks three parts of 6, 10 and amino acid residues that exist in the mouse brain a1 subunit Hence, the three-dimensional structure of these three peptides was additionally modeled according to the procedure published previously for the H4-H5 loop of pig kidney Na+/K+ ATPase [20] The primary structure of the mouse brain Na+/K+ ATPase from R378 to D586 was aligned with the template sequences by CLUSTALX [48] The threedimensional model constituted by all nonhydrogen atoms was built and examined by the MODELLER6 package [45,48] The tertiary structure model was checked with PROCHECK [46] Ligand docking The crystal structure of pNPP was extracted from the PDB coordinates file, 1D1Q [49], deposited in the Protein Data Bank (http://www.pdb.org) Hydrogens were added using the BIOPOLYMER module included in INSIGHT II (Accelrys Inc., San Diego, CA, USA) Docking of ATP, TNP-ATP and pNPP was explored with AUTODOCK [50] To complete modeling of the truncated peptides, energy minimization and docking procedure was performed using exactly the parameters and methods published for pig kidney Na+/K+ ATPase [20,23] Several dynamics runs were set up for a canonical ensemble One dynamics run was a single interval of 120 ps at 300 K, and 343 K, respectively, with a femtosecond time step result being recorded every 25 fs The shake technique was applied to all bonds Force field parameters were the same as for the minimization FITC was connected to K501 via a covalent bond using the BUILDER module included in INSIGHT II and its position in the binding site was optimized Results Effects of truncation of the cytoplasmic H4-H5 loop of the a subunit of Na+/K+ ATPase on TNP-ATP binding and p-nitrophenylphosphatase activity Molecular modeling of the H4-H5 loop according to the E1-Ca2+ ATPase [20] gives almost identical results for the N- and P-domains as with its crystal structure or NMR analysis [21,22] In silico docking of ATP and TNP-ATP to the H4-H5 loop showed a single ATP binding site only [41] (Fig 1A,B) In the active site residing between I390 and L576 (Table 1), eight amino acids interact with ATP [41] To ensure that docking experiments in fact reflect properties of the loop in solution, we analyzed TNP-ATP equilibrium binding to the (L354–I777)–GST fusion protein that contains both the N- and P-domains Titration in fact revealed that TNP-ATP binds to a single site only, as fitting Ó FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3927 ATP N-Domain E505 K480 K501 TNPATP S477 I604 D369 F475 Q482 E446 L354 B L527 L354 P-Domain L773 A C L354 Fig C-Terminal truncation of the H4-H5 loop leads to loss of TNP-ATP binding due to unfolding of the N-domain as revealed by molecular modelling Molecular modeling was performed as described previously [20] (A) The complete H4-H5 loop starting at L354 and ending at L773 contains the nucleotide (N)-domain interacting with TNP-ATP and the phosphorylation (P)-domain (D369 shown in blue) The amino acid sequence ALLK known to interact with ankyrin [60] is colored in green (B) The size of the isolated H4-H5 loops shortened by the C-terminal part of the P-domain to L354–I604 is without effect on TNP-ATP binding (C) The stability of the N-domain and its ability to bind TNP-ATP with high affinity is lost, however, when the sequence C-terminally of L527 is removed, although all the amino acids known to interact directly with ATP [41,60–63], and shown in purple are still present (E446, Q482, F475, S477, K480, K501, E505) The mobility of the structure in the residual N-domain of L354–L527 forming the ATP binding site is indicated by red arrows Each of the displayed proteins contains an unaltered Mg2+ dependent p-nitrophenylphosphatase activity Table TNP-ATP binding to and p-nitrophenylphosphatase of H4-H5 loop–GST fusion proteins of different lengths The increase of the intensity of fluorescence by TNP-ATP binding was recorded using various H4-H5 loop–GST fusion proteins of different lengths as described in Experimental procedures The Kd values were calculated using eqn (1) The number of binding sites for ATP/loop was for all investigated proteins The activity of p-nitrophenylphosphatase was measured at 37 °C as described in Experimental procedures Mean values ± SEM are given from two to six independent experiments Mg2+ activated phosphatase Amino acid sequence or mutation Length/amino acids (without GST) TNP-ATP binding Kd (lM) Km (lM) Vmax (nmolỈh)1Ỉmg)1) L354–L777 L354–I604 I390–S601 L354–P588 L354–L576 L354–L541 L354–L527 N398D (L354–I604) D369A (L354–I604) 324 251 212 235 222 188 174 251 251 3.55 3.30 3.50 2.95 3.60 4.73 10.05 3.30 3.50 0.76 0.83 0.57 0.88 0.83 0.88 1.10 0.93 1.17 10.35 11.28 5.22 11.36 11.42 9.18 8.75 5.65 8.96 ± ± ± ± ± ± ± ± ± 0.35 0.06 0.07 0.05 0.07 0.19 0.95 0.2 0.50 ± ± ± ± ± ± ± ± ± 0.05 0.07 0.08 0.03 0.08 0.22 0.18 0.10 0.15 ± ± ± ± ± ± ± ± ± 0.73 0.72 1.08 0.48 2.42 1.00 1.30 0.53 0.24 3928 R Krumscheid et al (Eur J Biochem 271) Ó FEBS 2004 Mg2+ activated phosphatase activity was more than 50% reduced as compared to the corresponding construct L354– I604 containing the N-terminal part of the P-domain Studies on the structural stability of the N-domain by FITC anisotropy decay and eosin fluorescence Overall Na+/K+ ATPase activity may start with ATP binding to the N-domain This process may eventually induce its bending towards the P-domain and thereby explain the amino acid labeling of the P-domain found with 8-N3-TNP-ADP [25] The same consideration may apply to the labeling of P668 by 4-N3-2-NO2-phenylphosphate [51] It was therefore of interest to learn more on the rigidity of the N-domain This issue was investigated by FITC fluorescence anisotropy decay and lifetime measurements as well as by steady-state eosin fluorescence studies Fig Binding of TNP-ATP to the (L354–I777)–GST fusion protein, and fit of the data to equations for or TNP-ATP binding sites The (L354–I777)–GST fusion protein (1.6 lM) was titrated with TNP-ATP in 50 mM Tris/HCl, pH 7.5 at 37 °C Excitation and emission wavelengths were 462 nm and 527 nm, respectively Regression analysis according to the Eqns (1) and (2) (solid line: Eqn (1); broken line: Eqn (2); also Table 1) demonstrates that the equation describing the properties of a single TNP-ATP binding site gives the best fit of the fluorescence enhancement to a single site nucleotide binding model (Fig 2), gave no indication for a second site TNP-ATP binding was suppressed by the presence of ATP and ADP but not by AMP, as previously reported [34,35] (data not shown) A further means to search for a second ATP and phosphatase binding site is to prepare shorter loop constructs and to look for their abilities to bind TNPATP and to hydrolyze pNPP Consequently, a number of GST fusion proteins starting at L354 and ending at varying C-terminal ends were expressed and purified The constructs without the C-terminal part of the P-domain showed unaltered Kd values of the loop–TNP-ATP complexes (oscillating around a mean value of 3.35 lM) as well as unaltered properties of a Mg2+ dependent phosphatase activity, as long as C-terminal shortening did not exceed L576 (Table 1) The TNP-ATP binding properties changed drastically, however, when C-terminal shortening down to L527 took away parts of the N-domain that apparently stabilized its backbone (Fig 1C) We observed an approximately 40% increase of the dissociation constant Kd for the shortened construct, L354–L541 (Kd ¼ 4.73 lM), but a sharp significant increase of the Kd for TNP-ATP for the shortest construct, L354–L527 (200%, Kd ¼ 10.05 lM; Table 1) We should add that shorter constructs could not be purified because they showed an increasing tendency to precipitate in solution This shortest construct L354–L527 still contained all amino acids known to be necessary to bind ATP (Fig 1C) [46] Amino terminal shortening of the loop protein was also tested We prepared the construct I390–S601 which lacks the phosphorylation site at D369 This construct showed a single TNP-ATP binding site as well The protein had the same TNP-ATP binding properties as the longest protein L354–I777 with Kd ¼ 3.50 lM (Table 1) Interestingly, its FITC fluorescence anisotropy decay measurement FITClabeled L354–P588 loop protein with a molar ratio of fluorophore/protein of 1.2 was prepared as described in Experimental procedures Its steady-state fluorescence anisotropy of r ¼ 0.25 was quite high for a soluble protein, indicating a low flexibility of the N-domain This value is, however, significantly lower than the r ¼ 0.34 of the FITClabeled and membrane-embedded Na+/K+ ATPase [52] Additionally, to have a closer look to the rigidity of the FITC-labeled L354–P588 H4-H5 loop, the lifetime of the excited state and the anisotropy decay of the labeled protein were determined using a phase domain fluorometer with modulation frequencies from 10 MHz to 200 MHz We observed a two-component fluorescence intensity decay with the major lifetime component s1 ¼ 3.5 ns (f1 ¼ 0.77) and the minor component s2 ¼ 1.7 ns (f2 ¼ 0.23) The average lifetime of the excited state was determined as s ¼ 3.1 ns The anisotropy decay of FITC-labeled L354–P588 H4-H5 loop was determined in L-format over the range of modulation frequencies from 10 MHz to 200 MHz A two-component decay with a longer component of q1 ¼ 11.3 ns and a shorter component of q2 ¼ 1.2 ns, seemed to satisfactorily fit the collected data The shorter component is short enough to be ascribed to the wobbling of the fluorophore around its binding site The longer component, on the other hand, is long enough to reflect the motion of the whole FITC-labeled H4-H5 loop and not only segmental motions Consequently, we have to conclude that the N-domain containing the ATP-binding site is rigid without any flexible segments Eosin binding to the H4-H5 loop–GST fusion proteins Eosin Y is a well studied fluorescence label competing with ATP for its binding site in the membrane-embedded enzyme It has been used to demonstrate ATP competition as well as Mg2+ and K+ induced conformational changes in Na+/K+ ATPase [43,53,54] The largest construct, the (L354–I777)–GST fusion protein, and the C-terminally shortened construct L354–P588 were used for a comparative study In contrast to results reported for the membraneembedded Na+/K+ ATPase [43,54], we observed neither a change of the excitation nor of the emission fluorescence spectra in the presence of any of these H4-H5 loop–GST Ó FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3929 Fig Recognition of FITC by amino acids forming the ATP binding site of the N-domain (A) Model of the whole loop in analogy to the E1-Ca2+ ATPase structure (N- and P-domains, L354–L773) [20] Covalent coupling of FITC to K501 is accomplished by a hydrophobic interaction of the benzoyl-group within FITC with F548 The tricyclic residue of FITC covers most of the space of the nucleotide binding site (B) Model based on the N-domain crystal structure of a2 Na+/K+ ATPase (N-domain only, R378–D586) [23] F548 is buried under the surface of the protein and therefore not able to interact with ligands in the nucleotide binding pocket Both models imply an ionic interaction of the carboxyl-group of E446 with the e-amino-group of the modified K501 The covalent bound label seems to be stabilized by interaction with the aromatic side chain of F475 fusion proteins No detectable influence of Na+, Mg2+, PO43– or ATP on the eosin Y steady-state fluorescence was seen in the presence of lM GST fusion protein L354–I777 (data not shown) This is rather surprising as Costa et al reported on an eosin interference with MgATP in the dimer formation of a H4-H5 loop protein of Na+/K+ ATPase [55] In conclusion, neither method revealed any indication of a conformational change of the N-domain upon ligand binding in the investigated GST fusion protein It is quite evident that the N-domain of the isolated loop forms a rigid structure, unless essential parts of the backbone are removed (Fig 1C) Characterization of the three-dimensional structure of the complete and truncated H4-H5 loops by molecular modeling The interpretation of the above reported data on the truncation of the H4-H5 loop is considerably facilitated by the availability of a molecular model [20] Molecular modeling of the truncated H4-H5 loop revealed that a big part of the N-domain can be removed without any loss in TNP-ATP binding properties (compare Table with Fig 1A–C) The increase in Kd value of the TNP-ATP protein complex by the extreme C-terminal shortening to the L354–L527 construct could be described by dynamic and energy minimization runs to be the result of an increased mobility of parts of the loop structure (Fig 1C) The location of FITC within the ATP site obtained either by in silico docking to the previously described full H4-H5 loop model [20] or to the N-domain model according to Hakansson’s crystal structure [21,23] revealed that both models shows an ionic interaction of the carboxyl-group of E446 with the e-amino group of the modified K501 (Fig 3) Both models also show that F475 interacts with the aromatic moiety of the FITC label, similarly to ATP and TNP-ATP [23,41,56] There is, however, a distinct difference with respect to the location of F548: the model created according to Hakansson’s crystal structure (R378–D586) [23] (Fig 3B) shows F548 buried under the surface of the ATP binding pocket, while the model for the bigger H4-H5 loop (L354–L773) (Fig 3A) allowed aromatic interactions with substrates and inhibitors Studies on the localization of a p-nitrophenylphosphatase activity within H4-H5 loop–GST fusion proteins Consistent with a previous report [36], shortening of the C-terminal part of the H4-H5 loop down to amino acid number 600 revealed no change in phosphatase activity (Table 1) This may mean that the phosphatase is located on a part of the N-domain Because a transfer of the phosphate group of pNPP to the protein has been reported for the membrane-embedded enzyme [11,33], a possible participation of the phosphorylation site D369 in the isolated H4-H5 loop’s p-nitrophenylphosphatase activity was tested Mutation of D369 to A had no significant effect on the Vmax of substrate hydrolysis (Fig 4) We therefore conclude that the isolated loop does not form a phosphointermediate during catalysis Interestingly, when the amino terminal part of the P-domain was deleted, the resulting (I390–S601)–GST fusion protein showed significantly lower Vmax and Km values for pNPP (Table 1, Fig 4) Because the Mg2+ dependent phosphatase of the H4-H5 loop shows a very low turnover rate, attempts were made to build up a more 3930 R Krumscheid et al (Eur J Biochem 271) Ó FEBS 2004 Fig Truncation of the residual P-domain, mutation of the phosphorylation site D369, and N398 as part of the putative phosphatase site Effects on Vmax and Km of Mg2+ dependent p-nitrophenylphosphatase activity The effect of single site mutation or N-terminal truncation of the (L354–I604)– GST fusion proteins of the H4-H5 loop on the activities and properties of the p-nitrophenylphosphatase activity was studied The properties of the control refer to the mean values of six different constructs of carboxy terminally truncated H4-H5 loop starting at L354 and ending carboxy terminally between L527 and I777 (Fig 3) The Vmax and Km values of the Mg2+ dependent p-nitrophenylphosphatase activity as a function of the phosphorylation site D369, the presence or loss of the residual P-domain (L354–Q389), and the function of N398 in the putative phospatase site are shown The significance of the differences in activity was evaluated by two-tailed student’s t-test as: * P < 0.05, ** P < 0.01, *** P < 0.001 sensitive assay using 3-O-methyl-fluorescein phosphate; this substrate has formerly been shown to be hydrolyzed K+-dependently by Na+/K+ ATPase [30,57] Unfortunately, however, it was impossible to use this substrate to investigate the phosphatase activity of the isolated loop due to its high rate of autohydrolysis Phosphotyrosine was also tested but not hydrolyzed by the (L354–I777)– and (L354– I604)–GST fusion proteins Surprisingly, FITC-labeling of the loop protein in the H4-H5 loop had only a small effect on Mg2+ dependent phosphatase activity (Table 2) The observed effect is in the same range as for the K+ activated, Mg2+ dependent phosphatase activity in the membrane-embedded full enzyme (Table 2) Hence, it seemed possible that a pNPP binding site might exist separately from the ATP site Tran & Farley had reported that N398 is labeled by radioactive 4-azido-2-nitrophenylphosphate and that this labeling leads to an inactivation of Na+/K+ ATPase [51] pNPP docking experiments to the H4-H5 loop Table Effect of FITC-labeling on the phosphatase activities of Na+/ K+ ATPase and a H4-H5 loop–GST fusion protein Labeling of pig kidney Na+/K+ ATPase as well as the purified L354–I604 loop protein was performed with 10 lM FITC at pH for 30 and the labeled protein was handled as described in Experimental procedures Phosphatase activity of the L354–I604 loop protein was tested at mM pNPP NA, not applicable Molar binding ratio of FITC Na+/K+ ATPase (control) L354–I604 (control) Na+/K+ ATPase + FITC L354–I604 + FITC Phosphatase activity NA 1.54 lmolỈmg)1Ỉmin)1 (100%) 7.84 nmolỈmg)1Ỉh)1 (100%) 1.23 lmolỈmg)1Ỉmin)1 (80%) 6.58 nmolỈmg)1Ỉh)1 (84%) NA 0.8 ± 0.2 0.9 ± 0.1 indicated that this substrate may interact with the nucleotide binding site as well as with a strand of three b sheets at the rear surface (pNPP site, Fig 5) A closer look at these areas revealed that within the ATP site, the aromatic ring of pNPP may interact with the phenyl residues of F475 and, if accessible, also with F548 (Fig 6A,C) The NO2 group of pNPP, however, may interact with Q482 and K501 of the nucleotide binding site in both models (Fig 6A,C) The calculated docking energies were )6.7 kcalỈmol)1 for the structure of L354–L773 derived from E1-Ca2+ ATPase (Fig 6A) and )6.4 kcalỈmol)1 for the N-domain analogy model according to Hakansson (R378–D586) [21] (Fig 6C) These estimations of interaction energies neglect solvation and desolvation The phosphate group of pNPP is about 2.8 nm from the phosphorylation site D369 The location of the putative pNPP binding sites on the rear part of the loop differed significantly depending on the presence or absence of the N-terminal part of the Pdomain (Fig 5B,D) The calculated interaction energies for both models were )7.5 (Fig 5B) and )6.8 kcalỈmol)1 (Fig 5D), respectively In the Ca2+ ATPase derived model [20], a hydrophobic environment was formed by M384, L414, W411, which may stabilize the substrate’s phenyl ring from both sides (Fig 4, Table 1) The NO2 group of pNPP seems to interact with N398, while the phosphate group may be stabilized by interaction with S400 and S408 (Fig 6B) Docking to a model based on Hakansson’s crystal structure [21,23] missing the Nterminal part of the P-domain (R378–D586), however, ˚ showed a different pNPP binding site 16 A away from N398 with an estimated 10% lower interaction energy as compared to the full loop (Fig 5B,D) In this case, the NO2 group seems to point to the direction of S408, while the phosphate group may lie between S401 and Q389 The only hydrophobic interaction of the phenyl ring in this model is achieved by H517 In the Ca2+ ATPase-derived model (Fig 5A), the phosphate group of pNPP is 3.2 nm from the phosphorylation Ó FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3931 Fig p-Nitrophenylphosphate can be docked to the ATP site as well as to a phosphatase site at the rear surface of the N-domain (overview) (A) Docking of pNPP to the ATP binding site of the model containing N- and P-domains [20] The amino acids interacting with the adenine ring of ATP may also interact weekly with p-nitrophenylphosphate (pNPP) (B) pNPP docked to a surface around N398 at the rear site of the N-domain (pNPP site) of the same model (C) Docking of pNPP to the ATP binding site of the model containing the N-domain only, modeled according to Hakansson’s crystal structure [21,23] Comparison of (A) and (C) show little structural difference in the environment of the docked ligand The final docking energies without solvation and desolvation effects were estimated as )6.7 kcalỈmol)1 for (A) and )6.4 kcalỈmol)1 for structure (C), respectively (D) Docking attempts of pNPP to the rear side of the model of the isolated N-domain [23] revealed that this structure does not contain a binding site around N398 as in (B) (full loop) The interaction of the substrate with the N-terminally shortened loop structure is lower as compared to the E1-Ca2+ ATPase derived structure of the full H4-H5 protein [20] [) 6.8 kcalỈmol)1 for (B), ) 7.5 kcalỈmol)1 for (D)] site D369 (not shown) To test the hypothesis of an additional phosphatase site and to locate this site, N398 was mutated to aspartate The mutation led to an approximately 50% decrease of the p-nitrophenylphosphatase activity connected with a slight decrease in the affinity (Fig 4) TNP-ATP binding was not affected by this mutation (Table 1) Even millimolar concentrations of ATP did not inhibit the phosphatase activity (data not shown), indicating that the pNPP site is unable to bind ATP and that within the isolated H4-H5 loop protein, binding of ATP to the nucleotide binding site does not lead to a conformational change of the N-domain, or to an alteration of the pNPP site 3932 R Krumscheid et al (Eur J Biochem 271) Ó FEBS 2004 Fig A closer look at the ATP and pNPP sites on the N-domain of the H4-H5 loop of Na+/K+ ATPase The models used for (A–D) are the same as in Fig (A) and (C) This comparison of pNPP binding to the ATP sites of both models shows that in the N- and P-domains containing model [20] (A) a hydrophobic interaction of the pNPP’s phenyl residue with F475 and F548 exists The nitro-group of the substrate interacts with K501 and Q482 in both models (B) In the model containing N- and P-domains [20], recognition of pNPP by the pNPP site at the rear surface of the N-domain is due the formation of an hydrogen bond of the NO2-group of pNPP with the amino group of N398 The hydrophobicity of the binding pocket is achieved by W411 and L414 The phosphate group seems to form a hydrogen bridge with the OH-group of S408 (D) In the structure based on the ˚ crystal of the a2 structure of the N-domain [21,23], the N398 does not interact with the substrate pNPP may bind 16 A away from this amino acid residue and with a lower interaction energy as compared to the model in (B) Discussion Consistent with recently reported data on NMR analysis [22], TNP-ATP binding studies [34,41] and in silico docking experiments [20], the above reported data show (Figs and 2, Table 1) that the isolated H4-H5 loop of Na+/K+ ATPase contains a single ATP site only Former reports on the existence of two ATP and phosphatase binding sites on the N- as well on the P-domains [51,58] in the membraneembedded sodium pump must reflect the existence of other protein conformations [7,8] differing from that of the isolated H4-H5 loop in solution Former studies with pyrene isothiocyanate indicated a rigid structure of the ATP binding site in the membraneembedded sodium pump [59] Conformational stability of the N-domain is also evident from the high steady-state fluorescence anisotropy of r ¼ 0.25 for the FITC-labeled H4-H5 loop and from its long anisotropy decay of q1 of 11.3 ns favoring the view that the whole loop tumbles in solution Additional support for this conclusion comes also from the fact that the loop does not, in contrast to the membrane-embedded Na+/K+ ATPase, respond to eosin Y by fluorescence changes upon addition of ATP, Na+ or Mg2+ [43] Thus, the N-domain of the isolated H4-H5 loop is unable to twist down to the P-domain [3] Such a conformational change is needed in the membrane embedded Na+/K+ ATPase to enable both, 8-N3-TNP-ADP [58] and 4-azido, 2-nitro-phenylphosphate [51] to label the P-domain at an amino acid C-terminal of K736 [58] and at P668 [51] No indications for binding sites of ATP or pNPP were detectable in the C-terminal part of the Pdomain of the isolated H4-H5 loop (Figs and 2, Table 1) K+ activated phosphatase activities in Na+/K+ ATPase and H+/K+ ATPase supposedly reflect the K+ activated step of the hydrolysis of an acyl-phosphointermediate formed from ATP in both enzymes [12,31] Kinetic experi- Ó FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3933 Table Comparison of the primary structures of isoforms of Na+/K+ ATPase and H+/K+ ATPase in the range of the binding site for pNPP Bold, amino acids interacting with pNPP (see Fig 6B); italic, amino acids not conserved in the compared sequences; dashes, amino acids not present in the sequence ments in the membrane-embedded enzyme could not decide whether Na+/K+ ATPase and phosphatase sites overlap [60] or reside on separate sites [51] In favor for the latter assumption are reports that a blockade of the ATP site by FITC modification of K501 inactivates the overall Na+/ K+ ATP hydrolysis, but not the K+ activated phosphatase [13,17] Because the ATP site is blocked by FITC (Fig 3), an additional phosphatase site outside the ATP site might exist in the isolated loop protein In fact, in silico docking experiments revealed that the H4-H5 loop may contain separate binding sites for ATP and pNPP (Figs and 6) Within the isolated H4-H5 loop, the ATP site of the N-domain retains no ATPase activity [34,36] Most likely this is due to the fact that the Mg2+ binding site necessary for the phosphorylation of D369 [10–12,33] from both substrates resides on the P-domain’s C-terminal part [61] and that N- and P-domains not bend together when the H4-H5 loop is disconnected from the transmembrane helices Removal of the C-terminal sequence of the P-domain is without effect on the p-nitrophenylphosphatase activity (Table 1) Although pNPP may interact with the adenosine subsite of the ATP site (Figs 5A,C and 6A,C), modification of this site by FITC (Fig 3) had only a minor effect on the pNPP activity (Table 2) Additionally, and contrary to the expectations from the literature reporting an inhibition of K+ activated phosphatase by ATP in the full enzyme [31,60], even millimolar concentrations of ATP did not affect the phosphatase (data not shown) All these findings support the conclusion that in the isolated H4-H5 loop, pNPP is not hydrolyzed via the ATP site although it may be able to bind there (Figs 5A and 6A) Structural models describing the three-dimensional folding of the a subunit forming the H4-H5 loop greatly facilitate the interpretation of experimental findings Unfortunately, the structure of the H4-H5 loop seems to vary depending on the presence of the phosphorylation domain A model based on the E1 crystal structure of Ca2+ ATPase [19] and respecting the N- and C-terminal parts of the P-domain [20], shows F548 as part of the ATP site (Fig 3A), while in a model based on the crystal structure of the N-domain of Na+/K+ ATPase and not including the P-domain [21] (Fig 3B), F548 is buried under the surface of the ATP site The influence on F548 on ATP and TNP-ATP binding has been investigated [44,56,62] The effect of mutation of this specific amino acid on the nucleotide binding property of the isolated H4-H5 loop is rather drastic [41] It remains, however, unclear whether F548 directly interacts with ligands or whether its importance lies in the formation of the structural backbone of the ATP binding pocket The adjacent amino acid residue C549, was shown to be labeled by erythrosin isothiocyanate in the membraneembedded Na+/K+ ATPase after blocking of the E1 ATP binding site with FITC [16] Modification of this site with the sulfhydryl-reactive 8-thiocyano-ATP forming a mixed disulfide bridge may inactivate Na+/K+ ATPase [63] In the H4-H5 loop model of Na+/K+ ATPase [20] obtained analogously to E1-Ca2+ ATPase [19], F548 is part of the ATP binding site and C549 is accessible by induced fit [7]; whereas in the crystal structure derived exclusively from the N-domain [21], both amino acids are hidden under the surface as part of the structural backbone Hence, the model respecting the P-domain-forming peptide extensions of the N-domain [20] seems to fit better to the experimental data (see below) The preferred binding site for pNPP was found at a specific surface at the rear side of the ATP binding pocket on the N-domain (pNPP site; Fig 5B,D) Docking experiments revealed that pNPP binds to this site with a slightly higher interaction energy than to the nucleotide binding site Unexpectedly, however, in silico docking of pNPP to a model based on the crystal structure of the N-domain of Na+/K+ ATPase [21,23] (Figs 5D and 6D) gave a different location of the binding site than a model including the P-domain [20] (Figs 1A, 5B and 6B) Docking of the substrate to the latter model [20] revealed that pNPP binds Ó FEBS 2004 3934 R Krumscheid et al (Eur J Biochem 271) to a site in close vicinity to N398, a residue that has been affinity-labeled by 4-azido-2-nitrophenylphosphate in the membrane-embedded Na+/K+ ATPase [51] The model showing exclusively the isolated N-domain [21,23] (Figs 5D and 6D), refused to dock pNPP close to N398 The new ˚ position found for pNPP binding is 16 A away from N398 and shows a lower interaction energy than to the site in the other model Apparently, the model respecting N- and C-terminal peptide extensions of the N-domain [20] describes more adequately the experimental findings (Figs 5B and 6B): mutation of N398 to aspartate and truncation of the P-domain’s N-terminal part, caused a drop of the phosphatase activity (Fig 4) The latter finding points to a stabilizing effect of the N-terminal sequence in forming the pNPP site in the neighborhood of N398 The hydrolysis of pNPP does not need the phosphorylation site D369 (Fig 4) The finding of a phosphatase site around N398 outside of the ATP binding site, which is involved in the overall Na+/K+ ATPase [51], is puzzling A comparison of the amino acid sequences between N377 and L414 for various a subunit isoforms of Na+/K+ ATPase and H+/K+ ATPase revealed that N398 is conserved in the a1 subunit in vertebrates only but not in insects and invertebrates (Table 3) N398 probably interacts with the nitro group of pNPP within the pNPP site This amino acid residue, however, is not present in the a2, a3 and a4 isoforms of Na+/K+ ATPase and does not seem to be necessary for the phosphatase activity in H+/K+ ATPase [31] (Table 3) Tyrosine phosphorylation can generally be achieved from pNPP [49], but phosphotyrosine is not hydrolyzed by the isolated H4-H5 loop Because Mg2+ is needed for pNPP hydrolyis by the isolated H4-H5 loop, the pNPP site close to N398 seems to recognize this divalent cation It is an open question whether it participates in the recently reported MgATP dependent interaction of isolated H4-H5 loops [55] In conclusion, our data show that the isolated H4-H5 loop of Na+/K+ ATPase contains a single ATP site only and an additional pNPP site around N398 that hydrolyzes pNPP in a Mg2+ dependent manner The properties of this additional site for pNPP served as a tool to compare two different structure models of the isolated H4-H5 loop of Na+/K+ ATPase The model derived from the crystal structures of E1-Ca2+ ATPase [19] and respecting peptide extensions of the N-domain forming the phosphorylation domain [20], describes in a better way the effects of truncation and single amino acid mutations on the pNPPase (Figs and 6B, Table 1) than a model [23] referring to the crystal structure of N-domain alone [21] (Fig 5D) Acknowledgements ˚ We thank Dr K.O Hakansson for providing the atomic coordinates of the Na+/K+ ATPase N-domain crystal structure This work was supported by the German and Czech Governments through TSR-088-97, and CZE 00/33, by the Ministry of Education, Youth and Sports of the Czech Republic (LN 00A141), by grants no 204/01/0254, 204/01/1001, 206/03/D082, 309/02/1479 and MSMT 113100003 and the research projects no AVOZ11922 of the Grant Agency of the Czech Republic and the Deutsche Forschungsgemeinschaft, Bonn Scho 139/21-2+3 The contributions of Drs T Obsˇ il and M Kubala to this work are gratefully acknowledged References Kaplan, J.H (2002) Biochemistry of Na,K-ATPase Ann Rev Biochem 71, 511–535 Lingrel, J.B & Kuntzweiler, T (1994) Na+,K+-ATPase J Biol Chem 269, 19659–19662 Jorgensen, P.L., Hakansson, K.O & Karlish, S.J.D (2003) Structure and mechanism of Na,K-ATPase: Functional Sites and Their Interactions Ann Rev Physiol 65, 817–849 Schoner, W (2002) Endogenous cardiac glycosides, a new class of steroid hormones Eur J Biochem 269, 2440–2448 Xie, Z & Askari, A (2002) Na+/K+-ATPase as a signal transducer Eur J Biochem 269, 2434–2439 Serpersu, E.H., Bunk, S & Schoner, W (1990) How MgATP analogues differentially modify high-affinity and low-affinity ATP binding sites of Na+/K+-ATPase? Eur J Biochem 191, 397–404 Thoenges, D & Schoner, W (1997) 2¢-O-Dansyl analogs of ATP bind with high affinity to the low affinity ATP site of Na+/K+ATPase and reveal the interaction of two ATP sites during catalysis J Biol Chem 272, 16315–16321 Thoenges, D., Amler, E., Eckert, T & Schoner, W (1999) Tight binding of bulky fluorescent derivatives of adenosine to the low affinity E2ATP site leads to inhibition of Na+/K+-ATPase Analysis of structural requirements of fluorescent ATP derivatives with a Koshland-Nemethy-Filmer model of two interacting ATP sites J Biol Chem 274, 1971–1978 Bader, H & Sen, A.K (1966) K+-Dependent acyl phosphatase as part of the (Na+ + K+)-dependent ATPase of cell membranes Biochim Biophys Acta 118, 116–123 10 Bond, H., Bader, H & Post, R.L (1971) Acetyl phosphate as a substitute for ATP in (Na+ + K+)-ATPase Biochim Biophys Acta 241, 57–67 11 Inturrisi, C.E & Titus, E (1970) Ouabain-dependent incorporation of 32P from p-nitrophenylphosphate into a microsomal phosphatase Mol Pharmacol 6, 99–107 12 Taniguchi, K., Kaya, S., Abe, K & Mardh, S (2001) The oligomeric nature of Na+/K+-transport ATPase J Biochem (Tokyo) 129, 335–342 13 Karlish, S.J.D (1980) Characterization of conformational changes in (Na,K)-ATPase labeled with fluorescein at the active site J Bioenerget Biomembr 12, 111–136 14 Linnertz, H., Thonges, D & Schoner, W (1995) Na+/K+ă ATPase with a blocked E1ATP site still allows backdoor phosphorylation of the E2ATP site Eur J Biochem 232, 420–424 15 Schoner, W., Mertens, W., Helms, M & Fortes, G (1998) Binding of the Co(NH3)4 derivative of (2¢)3¢-O-[N-methyl-anthraniloyl]ATP to the E2ATP site of Na+/K+-transporting ATPase lowers the conformational flexibility of its E1ATP site Eur J Biochem 253, 245–250 16 Linnertz, H., Kost, H., Obsil, T., Kotyk, A., Amler, E & Schoner, W (1998) Erythrosin 5¢-isothiocyanate labels Cys549 as part of the low-affinity ATP binding site of Na+/K+-ATPase FEBS Lett 441, 103–105 17 Linnertz, H., Urbanova, P., Obsil, T., Herman, P., Amler, E & Schoner, W (1998) Molecular distance measurements reveal an (ab)2 dimeric structure of Na+/K+-ATPase High affinity ATP binding site and K+-activated phosphatase reside on different alpha-subunits J Biol Chem 273, 28813–28821 18 Froehlich, J.P., Bamberg, E., Kane, D.J., Mahaney, J.E & Albers, R.W (2000) Contribution of quarternary protein interactions to the mechanism of energy transduction in Na+/K+-ATPase In Na/K-ATPase and Related ATPases (Taniguchi, K & Kaya, S., eds), pp 349–356 Elsevier Science, Amsterdam 19 Toyoshima, C., Nakasako, M., Nomura, H & Ogawa, H (2000) Crystal structure of the calcium pump of sarcoplasmic reticulum at 2.6 Angstrom resolution Nature 405, 647655 ă ể FEBS 2004 Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3935 20 Ettrich, R., Melichercik, M., Teisinger, J., Ettrichova, O., Krumscheid, R., Hofbauerova, K., Kvasnicka, P., Schoner, W & Amler, E (2001) Three-dimensional structure of the large cytoplasmic H4-H5-loop of Na+/K+-ATPase deduced by restraintbased comparative modeling shows only one ATP-binding site J Molec Model 7, 184–192 21 Hakansson, K.O (2003) The Crystallographic Structure of Na, ˚ K-ATPase N-domain at 2.6 A Resolution J Mol Biol 332, 1175– 1182 22 Hilge, M., Siegal, G., Vuister, G.W., Guntert, P., Gloor, S.M & ă Abrahams, J.P (2003) ATP-induced conformational changes of the nucleotide-binding domain of Na,K-ATPAse Nature Struct Biol 10, 468–474 ´ ´ 23 Lansky, Z., Kubala, M., Ettrich, R., Kuty, M., Plasˇ ek, J., Tei´ ´ singer, J., Schoner, W & Amler, E (2004) The hydrogen bond between Arg423 and Glu472 and another key residues Asp443, Ser477 and Pro489 are responsible for forming and a different positioning of TNP-ATP and ATP within the nucleotide binding site of Na+/ K+-ATPase Biochemistry 43, 8303–8311 24 Ward, D.G & Cavieres, J.D (1998) Photoinactivation of fluorescein isothiocyanate-modified Na,K-ATPase by 2¢(3¢)-O-(2,4,6trinitrophenyl) 8-azidoadenosine 5¢diphosphate Abolition of E1 and E2 partial reactions by sequential block of high and low affinity nucleotide sites J Biol Chem 273, 14277–14284 25 Ward, D.G & Cavieres, J.D (1998) Affinity labeling of two nucleotide sites on Na,K-ATPase using 2¢(3¢)-O-(2,4,6-trinitrophenyl) 8-azidoadenosine 5¢-[a32]diphosphate (TNP-8N3[a-32P]ADP) as a photoactivatable probe Label incorporation before and after blocking the high affinity ATP site with fluorescein isothiocyanate J Biol Chem 273, 33759–33765 26 Ohta, T., Nagano, K & Yoshida, M (1986) The active site structure of Na+/K+-transporting ATPase: Location of the 5¢-(pfluorosulfonyl) benzoyaladenosine binding site and soluble peptides release by trypsin Proc Natl Acad Sci USA 83, 2071–2075 27 Ovchinnikov, Y.A., Dzhandzhugazyan, K.N., Lutsenko, S.V., Mustayev, A.A & Modyanov, N.N (1987) Affinity modification of E1-form of Na+,K+-ATPase revealed Asp-710 in the catalytic site FEBS Lett 217, 111–116 28 Toyoshima, C & Nomura, H (2002) Structural changes in the calcium pump accompanying the dissociation of calcium Nature 418, 605–611 29 Xu, C (2002) A structural model for the catalytic cycle of Ca2+-ATPase J Mol Biol 316, 201–211 30 Davis, R.L & Robinson, J.D (1988) Substrate sites of (Na+ + K+)-ATPase: pertinence of the adenine and fluorescein binding sites Biochim Biophys Acta 953, 26–36 31 Schuurmans Stekhoven, F & Bonting, S.L (1981) Transport Adensone Triphosphatses: Properties and Function Physiol Rev 61, 1–76 32 Schoner, W., Thonges, D., Hamer, E., Antolovic, R., Buxbaum, ă E., Willeke, M., Serpersu, E.H & Scheiner-Bobis, G (1994) Is the sodium pump a functional dimer? In The Sodium Pump (Bamberg, E & Schoner, W., eds), pp 332–341 Springer Verlag, New York 33 Robinson, J.D (1971) K+-stimulated incorporation of 32P from nitrophenyl phosphate into a (Na+ + K+)-activated ATPase preparation Biochem Biophys Res Commun 42, 880–885 34 Gatto, C., Wang, A.X & Kaplan, J.H (1998) The M4M5 cytoplasmic loop of the Na,K-ATPase, overexpressed in Escherichia coli, binds nucleoside triphosphates with the same selectivity as the intact native protein J Biol Chem 273, 10578–10585 ´ 35 Obsil, T., Merola, F., Lewit-Bentley, A & Amler, E (1998) The isolated H4-H5 cytoplasmic loop of Na,K-ATPase overexpressed in Escherichia coli retains its ability to bind ATP FEBS Lett 426, 297–300 36 Tran, C.M & Farley, R.A (1999) Catalytic actvivity of an isolated domain of Na,K-ATPase expressed in Escherichia coli Biophys J 77, 258–266 37 Jorgensen, P.L (1974) Purification and characterization of (Na+ + K+)-ATPase Purification from the outer medulla of mammalian kidney after selective removal of membrane components by sodium dodecyl sulphate Biochim Biophys Acta 356, 36–52 38 Schoner, W., Ilberg, C.V., Kramer, R & Seubert, W (1967) On the mechanism of Na+- and K+-stimulated hydrolysis of adenosine triphosphate Purification and properties of a Na+and K+-activated ATPase from ox brain Eur J Biochem 1, 334– 343 39 Lowry, O.H., Rosebrough, N.J., Farr, A.L & Randall, R.J (1951) Protein measurement with the Folin phenol reagent J Biol Chem 293, 235–275 40 Bradford, M.M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 ´ 41 Kubala, M., Teisinger, J., Ettrich, R., Hofbauerova, K., Kopecky, ´ V., Baumruk, V.J.P., Schoner, W & Amler, E (2003) Eight amino acids are forming the ATP recognition site of Na+/K+-ATPase Biochemistry 42, 6446–6452 42 Moczydlowski, E.G & Fortes, P.A.G (1981) Characterization of 2¢,3¢-O-(2,4,6-trinitrocyclohexadieneylidine) adenosine 5¢-triphosphate as a fluorescent probe of the ATP site of sodium and potassium adenosine triphosphatse Determination of nucleotide binding stoichiometry and ion-induced changes in affinity for ATP J Biol Chem 256, 2346–2356 43 Skou, J.C & Esmann, M (1988) Eosin as a fluorescence probe for measurement of conformational states of Na+, K+-ATPase Methods Enzymol 156, 278–281 44 Kubala, M., Plasek, J & Amler, E (2003) Limitations in linearized analyses of binding equilibria: binding of TNP-ATP to the H4-H5 loop of Na/K-ATPase Eur Biophys J 32, 363–369 45 Sali, A & Blundell, T.L (1993) Comparative protein modeling by satisfaction of spatial restraints J Mol Biol 234, 779–815 46 Laskowski, R.A., McArthur, M.W., Moss, D.S & Thornton, J.M (1993) PROCHECK: a program to check the stereochemical quality of protein structures J Appl Crystallogr 26, 283–291 47 Haue, L., Pedersen, P.A., Jorgensen, P.L & Hakansson, K.O (2003) Cloning, expression, purification and crystallization of the N-domain from the a2 subunit of the membrane-spanning Na,KATPase protein Acta Cryst D59, 1259–1261 48 Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F & Higgins, D.G (1997) The Clustal–Windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 49 Wang, S., Taberno, L., Zhang, M., Harms, E., Van Etten, R.L & Staufacher, C.V (2000) Crystal structure of a low-molecular weight protein tyrosine phosphatase from Saccharomyces cervisiae and its complex with the substrate p-nitrophenyl phosphate Biochemistry 39, 1903–1914 50 Morris, G.M., Goodsell, D., Huey, R & Olson, A.J (1996) Distributed automated docking of flexible ligands to proteins: Parallel applications of AutoDock 2.4 J Comp Aided Mol Design 10, 293–304 51 Tran, C.M & Farley, R.A (1996) Photoaffinity labeling of the active site of the Na+/K+-ATPase with 4-azido-2-nitrophenyl phosphate Biochemistry 35, 47–55 52 Amler, E., Abbott, A & Ball, W.J.J (1992) Structural dynamics and oligomeric interactions of Na,K-ATPase monitored using fluorescence energy transfer Biophys J 61, 553–568 53 Skou, J.C & Esmann, M (1983) Effect of magnesium ions on the high-affinity binding of eosin to the (Na+ + K+)-ATPase Biochim Biophys Acta 727, 101–107 3936 R Krumscheid et al (Eur J Biochem 271) 54 Esmann, M (1994) Influence of Na+ on conformational states in membrane-bound renal Na,K-ATPase Biochemistry 33, 8558–8565 55 Costa, C.J., Ghatto, C & Kaplan, J.H (2003) Interactions between Na,K-ATPase a-subunit ATP binding domains J Biol Chem 278, 9176–9184 ´ 56 Hofbauerova, K., Kopecky,V., Jr Ettrich, R., Kubala, M., Tei´ singer, T & Amler, E (2003) ATP-binding is stabilized by a stacking interaction with the binding site of Na+/K+-ATPase Biochem Biophys Res Commun 306, 416–420 57 Huang, W & Askari, A (1975) (Na+ + K+)-activated adenosinetriphosphatase: Fluorimetric Determination of the associated K+-dependent 3-O-methylfluorescein phosphatase and its use for the assay of enzyme samples with low activities Anal Biochem 66, 265–271 58 Cavieres, J.D., Lilley, K.S & Ward, D.G (2000) Dissecting and mapping two nucleotide binding sites in Na,K-ATPase In Na/KATPase and Related ATPases (Taniguchi, K & Kaya, S., eds), pp 115–122 Elsevier Science, Amsterdam Ó FEBS 2004 59 Linnertz, H., Miksik, I., Kvasnicka, P., Bertoli, E., Mazzanti, L., Schoner, W & Amler, E (1998) Binding of pyrene isothiocyanate to the E1ATP site makes the H4-H5 cytoplasmic loop of Na+/K+ATPase rigid Eur J Biochem 251, 522–527 60 Robinson, J.D (1976) Substrate sites of the (Na+ + K+)ATPase Biochim Biophys Acta 429, 1006–1019 61 Pedersen, P.A., Jorgensen, J.R & Jorgensen, P.L (2000) Importance of conserved alpha-subunit segment 709-GDGVND for Mg2+ binding, phosphorylation, and energy transduction in Na,K-ATPase J Biol Chem 275, 37588–37595 ´ 62 Hofbauerova, K., Kopecky, V.J., Ettrich, R., Ettrichova, O & Amler, E (2002) Secondary and tertiary structure of nucleotidebinding domain of a subunit of Na+/K+-ATPase Biopolymers 67, 242–246 63 Scheiner-Bobis, G., Mertens, W., Willeke, M & Schoner, W (1992) Synthesis and biochemical characterization of the new sulfhydryl-reactive ATP analogue 8-thiocyano-ATP Its interaction with Na,K-ATPase and kinases Biochemistry 31, 2107– 2113  ... Mapping of ATP and pNPP binding sites of the Na pump (Eur J Biochem 271) 3933 Table Comparison of the primary structures of isoforms of Na+/K+ ATPase and H+/K+ ATPase in the range of the binding site. .. and its position in the binding site was optimized Results Effects of truncation of the cytoplasmic H4-H5 loop of the a subunit of Na+/K+ ATPase on TNP -ATP binding and p-nitrophenylphosphatase activity. .. Table 1) that the isolated H4-H5 loop of Na+/K+ ATPase contains a single ATP site only Former reports on the existence of two ATP and phosphatase binding sites on the N- as well on the P-domains