Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx

Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity Atul Sharma 1, *, Ram G. Nitharwal 1, *, Bhupender Singh 2 , Ashraf Dar 1 , Santanu Dasgupta 2 and Suman K. Dhar 1 1 Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi, India 2 Department of Cell and Molecular Biology, Uppsala University, Biomedical Center, Sweden Helicobacter pylori causes gastric ulcer and gastric adenocarcinoma related diseases in humans [1,2]. Although there are effective therapies against these bacteria, an increasing incidence of antibiotic resistance and recurrent infection following treatment complicates the situation [3,4]. Considerable research has been conducted on the clinical aspects of H. pylori infection but the fundamental aspects of cell cycle and DNA replication are poorly understood. H. pylori can transform from the active helical bacil- lary form into the dormant coccoid form, which is the manifestation of a bacterial response towards anti- biotics, stress, aging and unfavorable conditions [5–8]. Almost nothing is known regarding the molecular mechanisms involved in vegetative to coccoid transi- tion and the biology of the dormant coccoid form. DNA replication requires the timely interplay of various proteins that co-ordinate initiation, elongation and termination. Although H. pylori fall into the king- dom of Gram negative bacteria, the sequence analysis of Helicobacter genome reveals interesting features that include the location of the dnaA gene, approximately 600 kb away from the dnaN-gyrB gene cluster and the absence of important genes such as recF and the Keywords DNA replication; helicase; Helicobacter pylori; replication foci; single-stranded DNA binding protein Correspondence S. K. Dhar, Special Centre for Molecular Medicine, JNU, New Delhi 110067, India Fax: +91 11 26741781 Tel: +91 11 26742572 E-mail: skdhar2002@yahoo.co.in *These authors contributed equally to this work (Received 7 October 2008, revised 10 November 2008, accepted 13 November 2008) doi:10.1111/j.1742-4658.2008.06799.x Helicobacter pylori, an important bacterial pathogen, causes gastric ulcer and gastric adenocarcinoma in humans. The fundamentals of basic biology such as DNA replication are poorly understood in this pathogen. In the present study, we report the cloning and functional characterization of the single-stranded DNA (ssDNA) binding protein from H. pylori. The N-ter- minal DNA binding domain shows significant homology with E. coli single-stranded DNA binding protein (SSB), whereas the C-terminal domain shows less homology. The overall DNA-binding activity and tetra- merization properties, however, remain unaffected. In in vitro experiments with purified proteins, H. pylori (Hp) SSB bound specifically to ssDNA and modulated the enzymatic ATPase and helicase activity of HpDnaB helicase. HpSSB and HpDnaB proteins were co-localized in sharp, distinct foci in exponentially growing H. pylori cells, whereas both were spread over large areas in its dormant coccoid form, suggesting the absence of active replication forks in the latter. These results confirm the multiple roles of SSB during DNA replication and provide evidence for altered replicative metabolism in the spiral and coccoid forms that may be central to the bacterial physiology and pathogenesis. Abbreviations dsDNA, double-stranded DNA; Ec, E. coli; FITC, fluoroscein isothicyanate; GST, glutathione S-transferase; Hp, Helicobacter pylori; IPTG, isopropyl thio-b- D-galactoside; P i , inorganic phosphate; SSB, single-stranded DNA binding protein; ssDNA, single-stranded DNA. FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 519 helicase loader dnaC [9,10]. We have shown recently that the H. pylori (Hp) DnaB helicase can bypass E. coli (Ec) DnaC function in vivo that may explain the absence of the dnaC gene in H. pylori [11,12]. The C-terminal region of HpDnaB is unique, with a 34 amino acid residue insertion region that is essential for its function [13]. Recently, a protein HobA, the struc- tural homolog of E. coli protein DiaA has been shown to interact with the initiator protein DnaA and this interaction is essential for DNA replication in Helicob- acter [14,15]. One protein that is central to the DNA replication, repair and recombination is single-stranded DNA binding protein (SSB) [16,17]. The N-terminal domain of SSB is highly conserved and forms an oligonucleo- tide binding fold, and this region is also responsible for oligomerization, typically homotetramerization in eubacteria. The C-terminal region is less conserved and is responsible for protein–protein interaction [18,19]. The proteins that may interact with SSB include DNA polymerase, RNA polymerase and DNA helicases [20– 22]. Although, no direct interaction has been shown between SSB and DnaB replicative helicase, the physi- cal interaction between SSB and PriA helicase, the major DNA replication restart protein, has been dem- onstrated recently [23]. The extreme C-terminal ten residues are essential for the interaction of EcSSB with PriA helicase and the deletion of these residues affects the stimulation of helicase activity of PriA mediated through SSB [23]. Interestingly, deletion of 10 amino acid residues from the extreme C-terminus affects in vivo function of EcSSB [24]. Taken together, these results suggest that the extreme C-terminal residues of SSB are important for protein–protein interaction. To understand the basic DNA replication machinery of H. pylori in detail, we have cloned, over-expressed and characterized the functional properties of HpSSB both in vitro and in vivo. We found that HpSSB is a true homolog of SSB in vivo because it can comple- ment the Ecssb mutant strain and is localized in the replisome assembly of E. coli. Furthermore, we show that HpSSB can modulate the enzymatic activities of HpDnaB significantly. Finally, we report that both HpSSB and HpDnaB are co-localized in distinct foci in replicating H. pylori but not in the dormant coccoid form, indicating an important difference between the two forms regarding bacterial physiology and growth. These results further enhance our knowledge on SSB proteins from a slow growing pathogenic bacteria and offer great potential to study DNA–protein and pro- tein–protein interaction that is central to the DNA replication machinery in prokaryotes. To the best of our knowledge, this is the first probe into the coccoid stage demonstrating its distinction from the vegetative, spiral stage in DNA replication activity. Results and Discussion Cloning, expression, purification and biochemical activity of HpSSB The coding region of the ORF, HP1245 (annotated as the putative HpSSB homlog) was amplified using spe- cific primers (as shown in the Experimental proce- dures) and genomic DNA from H. pylori strain 26695. The amplified PCR product was subsequently cloned in the expression vector pET28a and was sequenced completely. The deduced amino acid sequence was aligned with E. coli and Bacillus subtilis SSB sequences using the multiple sequence alignment program clustalw (Fig. 1A). Overall, HpSSB shows 30% iden- tity and 45% homology with EcSSB. The analysis shows more homology at the N-terminal DNA-binding domain ( 67%) compared to the C-terminal domain ( 34%), which is assumed to be the region responsi- ble for protein–protein interaction. Sequence compari- son reveals many interesting features that include the absence of some important residues in HpSSB com- pared to that of EcSSB. The tryptophan residues (Trp40 and Trp54 in EcSSB) have been replaced by phenyl alanine residues [25]. In vitro, mutations in these residues in EcSSB show a moderate effect on DNA binding. His55, a residue important for oligo- merization, is replaced by Ile in HpSSB. However, mutation of His55 to Ile does not affect in vitro oligomerization of EcSSB [26]. To purify recombinant HpSSB for biochemical char- acterization, the E. coli BL21 codon plus strain was transformed with pET28a-HpSSB construct, as described in the Experimental procedures, and the His-tagged fusion protein was purified using Ni-NTA agarose beads (Fig. 1B). The purified His 6 -HpSSB protein shows an apparent molecular mass of approxi- mately 25 kDa, which is very close to the deduced molecular mass of untagged HpSSB ( 20 kDa). Polyclonal antibodies were raised in mice using the purified His-HpSSB as antigens. These antibodies effectively recognized the purified HpSSB antigen (Fig. 1C). To prove that HpSSB is truly expressed in H. pylori, a western blot experiment was performed using the same antibodies against H. pylori bacterial lysate. A single band was detected in the lane contain- ing bacterial lysate confirming the expression of HpSSB in H. pylori (Fig. 1C). There is a difference in the migration of the recombinant protein and the endogenous protein because the recombinant protein is H. pylori SSB protein A. Sharma et al. 520 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS Fig. 1. Primary sequence analysis of HpSSB and biochemical properties. (A) The amino acid sequences of E. coli, B. subtilis and H. pylori were aligned using the CLUSTALW multiple sequence alignment programme. *Identical residues; ‘:’ and ‘.’ indicate strongly and weakly similar residues, respectively. (B) Coomassie gel showing the expression and purification of His-tagged HpSSB. The molecular mass is shown on the right. (C) In vivo expression of HpSSB in H. pylori. The western blot shows the expression of HpSSB in H. pylori lysate using polyclonal antibodies raised against HpSSB. These antibodies also recognize the recombinant protein efficiently, whereas the pre-immune sera fail to recognize any such band. (D) Size exclusion chromatography of HpSSB. HpSSB protein, along with the marker proteins, was passed through the Amersham Superdex 200 gel filtration column followed by elution of the proteins. The molecular masses of the standard proteins were plotted on a logarithmic scale against the fraction numbers respective to their elution pattern. The molecular mass of HpSSB was deduced from the plot. (E) HpSSB shows a strong affinity towards ssDNA over dsDNA. M13mp18 ssDNA or pUC18 dsDNA alone or a mixture of both was incubated either in the absence or presence of a different amount of HpSSB followed by separation of the DNA–protein complex using agarose gel electrophoresis. The retardation pattern of the ssDNA reveals the binding of HpSSB with ssDNA but not with dsDNA. (F) Electrophoretic mobility shift assay to show the binding of HpSSB to the short radiolabeled oligonucleotide. The intensity of the shifted band increased with an increasing protein concentration before reaching a saturation point. A. Sharma et al. H. pylori SSB protein FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 521 His-tagged. The pre-immune sera under the same experimental conditions fail to recognize any band, suggesting the specificity of these antibodies (Fig. 1C). EcSSB forms homotetramers in solution. The critical residue for EcSSB homotetramer formation (His55) is not conserved in HpSSB [26]. To investigate whether HpSSB forms homotetramers in solution, gel filtration analysis was performed using different marker proteins as standards followed by HpSSB. A standard curve was plotted using the log molecular mass values of various standard proteins against the fraction numbers of the proteins at which they are eluted (Fig. 1D). From this standard curve, the molecular mass of HpSSB was calculated to be approximately 80 kDa. These results suggest that HpSSB forms a tetramer in solution because the molecular mass of monomeric HpSSB is approximately 20 kDa. Finally, we investigated the DNA-binding property of HpSSB. For this purpose, single-stranded M13mp18 DNA or double-stranded pUC18 DNA, or a mixture of both, was incubated in the absence or presence of different quantities of HpSSB followed by resolving the DNA–protein complexes using agarose gel electro- phoresis (Fig. 1E). The band corresponding to the M13mp18 ssDNA is retarded significantly with an increasing amount of HpSSB protein, whereas pUC18 double-stranded DNA (dsDNA) band is not retarded at all under the same experimental conditions, indicat- ing that HpSSB shows a strong affinity towards ssDNA compared to dsDNA. Furthermore, the affin- ity of HpSSB towards ssDNA was documented by per- forming gel retardation assay using a small oligonucleotide single-stranded radiolabeled probe. No shift was observed in the absence of HpSSB, whereas an increasing amount of HpSSB resulted in a more intense shifted band, finally reaching a saturation point due to the exhaustion of the free probe (Fig. 1F). The above results indicate that, although HpSSB shows some differences with EcSSB at the amino acid level, overall, HpSSB shows oligomeric properties and ssDNA binding activities similar to that of EcSSB. Complementation of E. coli Dssb strain with HpSSB and in vivo localization of HpSSB in E. coli Although HpSSB showed oligomerisation and ssDNA binding activity in vitro typical of SSB related proteins, we further analyzed its function as a true SSB homo- log in vivo. For this purpose, we performed plasmid bumping experiments where we tried to replace an Ecssb containing plasmid (pRPZ150, ColE1 ori, Tc R ) in E. coli RDP317 (Dssb::kan) (a kind gift from U. Varshney, IISC, Bangalore, India) with plasmids (Amp R ) containing either Ecssb or HpssbWt or HpssbDC20 (deletion of 20 amino acid residues from the C-terminus) or pTRC vector (ColE1 ori, Amp R ) alone where the above genes have been cloned [27]. The details of the bacterial strains and plasmid con- structs are shown in Table 1. It is important to note that SSB is an essential protein. Therefore, if the incoming Amp R plasmids containing test SSB coding Table 1. Bacterial strains and plasmids. Strain ⁄ plasmid Genotype ⁄ relevant characteristics Reference DH10b F-mcrAD(mrr-hsdRMS-mcrBC)u80lacZDM15 DlacX74 recA1 endA1 araD139 D(ara, leu)7697 galU galK k- rpsL nupG Invitrogen pET28a T7, his, kan R Novagen pET28a HpSSBWt and HpSSB DC20 pET28 a derivative containing 540 bp and 480 bp of H. pylori SSB full length and C-terminal deletion mutant This study pET28a HpDnaB pET28a derivative containing 1.5 kb of H. pylori dnaB Soni et al. [11] pGEX-2T HpDnaB pGEX derivative containing 1.5 kb of H. pylori dnaB Soni et al. [12] BL21 (DE3) F ± ompT hsdSB (rB ± mB) gal dcm (DE3) Novagen E. coli RDP317 strain Carries a deletion in its chromosomal ssb gene (ssb::Kan) and a wild-type copy of the ssb gene on a support plasmid, pRPZ150 (ColE1 ori, Tc R ) Gift from U. Varshney (IISC, Bangalore, India) pTRC E. coli SSB Wt Plasmid expressing E. coli SSB ColE1 ori, Amp R Gift from U. Varshney pTRC HpSSBWt and HpSSB DC 20. Plasmid expressing HpSSBWt and DC20. ColE1 ori, Amp R This study pET28a HpSSB-mCherry pET28a derivative expressing fusion protein of Wt HpSSB and mCherry This study H. pylori 26695 Gift from A. Mukhopadhyay (NICED, Kolkata, India) H. pylori SSB protein A. Sharma et al. 522 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS genes are capable of complementing the Dssb E. coli strain, Tc R plasmids will show the Tc S , Amp R pheno- type. Using this strategy and Ecssb as a positive con- trol, we found that continuous subculture of the bacteria in the media containing Amp and Kan but lacking Tc helps to replace the Tc R plasmid with the incoming Amp R plasmid with greater than 90% effi- ciency. Similarly HpssbWt shows very high efficiency ( 87%) compared to that of HpssbDC20 or vector alone control. The results are summarized in Table 2 and clearly indicate that Hpssb can complement E. coli Dssb strain in vivo. Moreover, the data suggest that the last twenty amino acid residues are important for in vivo function of HpSSB because HpssbDC20 cannot complement the E. coli mutant strain. It is important to note that the amino acid residues at the extreme C-terminal residues of EcSSB have been reported to be essential because they may be involved in protein–pro- tein interaction [24]. EcSSB, HpSSBWt and HpSSBDC20 were expressed efficiently in the E. coli mutant strain as shown by SDS ⁄ PAGE and Coomassie staining of the bacterial lysate from the transformed cells (Fig. 2A). Complementation of E. coli Dssb strain using HpSSB ensures that it can take over EcSSB function in vivo. It has been shown recently using green fluores- cent protein-SSB that replisome machinery containing replication proteins assemble at the replication origin [28]. To investigate whether HpSSB can take part in replisome machinery, we made a His-HpSSB-mCherry fusion construct where His-tagged HpSSB is fused at the N-terminus of fluorescent mCherry protein. The protein was expressed and purified from E. coli BL21 strain and the purified protein was used for DNA binding activity. mCherry-HpSSB shows DNA-binding activity that is similar to the Wt HpSSB, suggesting that the fusion of mCherry does not affect the DNA binding property of HpSSB (Fig. 2B,C). Subsequently, we performed in vivo localization experiments using either lag phase or log phase or stationary phase E. coli BL21 cells transformed with mCherry-HpSSB where the expression of mCherry-HpSSB could be induced using isopropyl thio-b-d-galactoside (IPTG) if required. The in vivo localization experiments to local- ize fluorescent mCherry proteins indicate that the expression of mCherry-HpSSB is poor in the majority of the lag phase cells, with somewhat diffused staining pattern (data not shown). Interestingly, the majority of the cells from the logarithmic phase show moderate expression of mCherry-HpSSB with distinct foci (Fig. 2D, upper panel). At the stationary phase of growth, these cells show expression of mCherry all over the cell without foci formation (Fig. 2D, upper panel). Green fluorescent protein-SSB fusion has recently been used to label replication forks in E. coli in time-lapse microscopy to demonstrate the dynamics of replication fork movement during a round of repli- cation of the bacterial chromosome [28]. We strongly believe that these distinct foci are the replisome foci because the foci are not present in the bacteria from the control stationary phase. These results clearly indi- cate that HpSSB can take part in the replisome foci in E. coli, which is consistent with the complementation of EcSSB mutant strain with HpSSB. Effect of HpSSB on HpDnaB enzymatic activity We have shown that HpSSB is a true homolog of SSB both in vitro and in vivo. SSB interacts with many pro- teins at the replication fork and modulates their activi- ties. One of these proteins is DnaB helicase whose activity can be modulated by SSB [22]. We have recently cloned, characterized, purified and performed structure–function analysis of the major replicative helicase DnaB from H. pylori [13]. We were interested to see whether HpSSB would modulate the enzymatic activities of HpDnaB. One of the hallmarks of the replicative helicases is its DNA-dependent ATPase activity, which is central to the helicase activity because it provides energy for the DNA unwinding and forward translocation on the replication fork. We have recently shown that the ATPase activity of HpDnaB can be stimulated many times in the presence of ssDNA [13]. It has been reported that DNA-dependent ATPase activity of DnaB helicase can be inhibited in the presence of SSB protein [22]. We also found that the ssDNA-dependent ATPase activity of HpDnaB can be inhibited signifi- Table 2. Complementation analysis of HpSSB. E. coli RDP 317 Dssb strain was transformed with various Amp R plasmids (as indi- cated) and, subsequently, they were grown in continuous subcul- tures in liquid media in the presence of Amp and Kan. Samples after four subcultures were streaked on agar plates and the resul- tant single colonies were further patched on agar plates containing Amp or Amp and Tc. The ability of the patches to grow on the different plates was monitored and the efficiency of plasmid replacement was counted. Amp, ampicillin; Tc, tetracyclin. Test SSB genes No. of colonies (Amp resistant) No. of colonies (Amp, Tc resistant) Efficiency of plasmid replacement Tc(R) to Tc(S) (%) EcSSB 60 5 91 HpSSB 60 8 86.6 HpSSBDC20 52 50 3.8 pTRC vector 50 50 0 A. Sharma et al. H. pylori SSB protein FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 523 cantly in the presence of HpSSB (Fig. 3A,B). The inhi- bition of ssDNA-dependent ATPase activity of HpDnaB by HpSSB is likely to be due to the inability of DnaB to bind the SSB-bound DNA. EcSSB also shows an inhibitory effect on DNA dependent ATPase activity of EcDnaB when ssDNA is taken as substrate [22]. Furthermore, we investigated the effect of HpSSB on the helicase activity of HpDnaB. For this purpose, the release of a radiolabeled 29 mer ssDNA oligo from an annealed substrate containing M13mp18 ssDNA was monitored using HpDnaB and different amount of HpSSB. We found that, initially, HpSSB stimulates the helicase activity of HpDnaB at a lower concentra- tion. However, at a higher concentration of HpSSB, the helicase activity was inhibited completely (Fig. 3C,D). It is possible that, at a lower concentra- tion of HpSSB, the released ssDNA from the annealed substrate may become stabilized following binding with HpSSB, thereby preventing rehybridization of the unwound oligo with the M13mp18 ssDNA. However, at a higher concentration of HpSSB, the excess multi- meric HpSSB in the vicinity of fork structure may Fig. 2. In vivo function of HpSSB. (A) Expression of EcSSB and HpSSB (wild-type and mutant forms) proteins in the E. coli SSB mutant strain was checked by SDS ⁄ PAGE analysis of bacterial lysate obtained from un-induced and IPTG induced bacterial culture in each case fol- lowed by Coomassie staining. *Position of the respective proteins. (B) Purification of His-HpSSB-mCherry protein. mCherry was fused with Wt HpSSB at the C-terminus in pET28a with a His 6 -tag as described in the Experimental procedures. The fusion protein was purified using Ni-NTA agarose and the quality of the protein was checked by SDS ⁄ PAGE and Coomassie staining. His-HpSSB is also shown. (C) DNA bind- ing property of mCherry-HpSSB protein is shown as described earlier for the HpSSB protein. The arrowhead indicates the position of the ssDNA in the absence of SSB protein and the subsequent retardation of the band with an increasing amount of SSB is also shown. *Position of the double-stranded control DNA. (D) Localization of mCherry-HpSSB in growing E. coli cells. E. coli strain BL21 was trans- formed with pET28a vector containing mCherry-HpSSB and the bacteria culture was grown in liquid media in the presence of 0.1 m M IPTG. D 600 was monitored at different time points and glass slides were made to check the fluorescence under the microscope from different growth phases. Bright red fluorescent spots were observed from cells obtained from the log phase of the growth (as indicated by arrow- heads) but not from the stationary phase bacteria. H. pylori SSB protein A. Sharma et al. 524 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS affect the loading of HpDnaB by preventing the access of HpDnaB to the fork structure. Finally, we were interested in determining whether HpSSB has any affinity towards HpDnaB. We per- formed co-precipitation experiments in the presence of ammonium sulfate as described previously [29]. We found that HpSSB is precipitated completely in the presence of ammonium sulfate because most of it can be seen in the pellet fraction following precipitation and SDS ⁄ PAGE analysis. Interestingly, most of the HpDnaB can be found in the supernatant fraction following precipitation in the presence of ammonium sulfate under the same experimental conditions (Fig. 3E). However, when we performed co-precipita- tion experiments using both HpDnaB and HpSSB under the same experimental conditions, most of the HpDnaB was found in the pellet fraction along with HpSSB (Fig. 3E). These results suggest that HpSSB has an affinity towards HpDnaB that allows their coprecipitation. Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other. To substantiate this issue further under more physiological conditions, we performed a pull-down assay using beads of gluta- thione S-transferase (GST)-HpDanB beads or GST A C D B E F Fig. 3. (A) Effect of HpSSB on ATPase activity of HpDnaB in the presence of ssDNA. The release of radiolabeled P i from (c- 32 P)ATP was monitored in the absence and presence of different concentrations of HpSSB in a mixture containing HpDnaB and ssDNA by thin-layer chro- matography. The positions of ATP and released Pi are shown. (B) The amount of released P i in each case was quantified using densitometric scanning and the values were plotted accordingly. (C) The effect of HpSSB on helicase activity of HpDnaB. The release of unwound oligo from radiolabeled substrate by HpDnaB was monitored in the absence and presence of different concentrations of HpSSB. (D) The amount of released oligo in each case was quantified using densitometric scanning and the values were plotted accordingly. (E) Co-precipitation of HpSSB and HpDnaB. The retention of HpSSB or HpDnaB alone or a mixture containing both the proteins in the pellet (P) and supernatant (S) fraction was monitored following ammonium sulfate precipitation and subsequent SDS ⁄ PAGE analysis. The positions of both the proteins are indicated. (F) GST pull-down experiments either using GST-HpDnaB or GST proteins in the presence of purified HpSSB proteins at a low salt concentration (50 m M NaCl) followed by washing the beads and SDS ⁄ PAGE and western blot analysis of the released proteins using anti-SSB sera. HpSSB binds specifically to HpDnaB but not to GST alone under the same experimental conditions. A. Sharma et al. H. pylori SSB protein FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 525 alone in the presence of HpSSB protein. The pull- down experiments were carried out at a low salt concentration (50 mm NaCl) followed by washing the beads first using the binding buffer and, finally, at high stringency (300–500 mm salt concentration). The pull- down experiments indicate that HpSSB interact specifi- cally with GST-HpDnaB but not with control GST protein under the same experimental conditions (Fig. 3F). Thus, association of HpDnaB and HpSSB both at the low and high salt concentrations suggests that these proteins may physically interact with each other. A similar interaction has been reported between replication restart helicase PriA and SSB protein in E. coli [23]. The interaction of SSB with DnaB helicase appears to be biologically relevant because the loading of the HpDnaB helicase may be facilitated by SSB bound to single-stranded moiety at the fork structure. In chro- mosomal DNA replication, initiation of Okazaki frag- ments requires SSB coating of the lagging strand; similar coating plays a critical function in the restart of paused replication forks where SSB–DnaB interac- tions might play critical, although yet undefined roles [22]. Unlike EcDnaB, HpDnaB does not require a heli- case loader (EcDnaC) [12]. Hence, HpSSB might have a closer and more specific interaction with the HpSSB C-terminal that shows poor homology compared to that of the EcSSB C-terminal region. Comparison of localization of replication proteins between the active helical bacillary form and the dormant coccoid form of H. pylori As discussed earlier, H. pylori undergoes morphologi- cal transition from the spiral shape to the coccoid form under physiologically unfavorable conditions. It is reported that the coccoid form is the degenerate form of the bacteria leading to cell death [30]. There are also reports indicating the presence of bacterial enzymatic activities in the dormant form, suggesting the continuation of metabolic activity at this stage [31– 33]. We compared the DNA replication machinery in H. pylori in the helical bacillary form and in the coc- coid stage by attempting to detect and localize active replication forks. For this purpose, we used two inde- pendent markers of active growing replication forks (HpSSB and HpDnaB, respectively) and followed their localization pattern in the above two forms by immu- nofluorescence microscopy using specific antibodies against these markers. We obtained striking results, where the majority of the active bacillary forms show clear distinct foci of HpDnaB and HpSSB (wherever A C B Fig. 4. Immunolocalization of HpDnaB and SSB proteins in H. pylori bacillary and coccoid forms. (A) Glass slides containing either the bacil- lary form (upper panel) or coccoid form (lower panel) were treated for immunofluorescence (as described in the Experimental procedures) using HpSSB antibodies (mice, 1 : 500 dilution) followed by FITC conjugated anti-mice sera as secondary antibodies. Green fluorescence was detected using a fluorescence microscope. (B) Localization of HpDnaB in the above two stages of H. pylori. HpDnaB antibodies (rabbit, 1 : 500) were used as primary antibodies and Alexafluor594 conjugated anti-rabbit sera were used as secondary antibodies. (C) Co-localiza- tion of HpDnaB and HpSSB proteins in the bacillary form. Both the HpDnaB and HpSSB antibodies were used in combination as primary antibodies. Alexafluor594 conjugated anti-rabbit and FITC conjugated anti-mice secondary sera were used in combination. H. pylori SSB protein A. Sharma et al. 526 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS staining was obtained) that are the manifestation of active replication forks in these bacteria (Fig. 4A,B, upper panels). HpDnaB and HpSSB foci also co-local- ized completely with each other, confirming the pres- ence of active replication forks in the bacillary form (Fig. 4C). These results also suggest that these proteins are the components of the replisome complex in vivo and validate our in vitro co-precipitation and pull- down results (Fig. 3E,F). Interestingly, the coccoid forms showed diffused staining pattern for both the proteins (Fig. 4A,B, lower panels). The absence of dis- tinct replication foci in the coccoid forms clearly sug- gests that these forms are physiologically different from the bacillary form. It has been reported previ- ously that the DNA content of the coccoid forms is very low compared to the bacillary forms [30]. Taken together, these results suggest that either very low or no DNA replication takes place in the coccoid forms. In summary, we have reported the functional char- acterization of the SSB protein from an important pathogen H. pylori. Although it shows divergence from the EcSSB at the key residues involved in DNA bind- ing and oligomerization for EcSSB, surprisingly, it can complement an Ecssb mutant strain and is localized at the replisome containing growing replication fork in E. coli and also in H. pylori. Moreover, both DNA- dependent ATPase and helicase activity of HpDnaB can be modulated by HpSSB. Whether the modulation effect is due to the titration of ssDNA in the presence of HpSSB, or due to the possible interaction between the two proteins, remains to be elucidated. However, co-precipitation of HpSSB and HpDnaB, in vitro pull- down experiments and in vivo co-localization of these proteins in the bacillary form raise the possibility that these two proteins may have an affinity with each other. Finally, the absence of distinct replication foci in the coccoid form clearly indicates a physiological difference from the active bacillary form. Experimental procedures Bacterial strains The bacterial strains and plasmids used in the present study are listed in Table 1. E. coli strains were grown in LB media (supplemented with 100 mgÆmL )1 ampicillin or 50 mgÆmL )1 kanamycin wherever needed) either at 37 or 22 °C, as required. H. pylori culture H. pylori strain 26695 was grown on brain heart infusion agar (Difco, Sparks, MD, USA) supplemented with 7% horse blood serum, 0.4% IsoVitaleX and the antibiotics amphotericin B (8 mgÆmL )1 ), trimethoprim (5 mgÆmL )1 ) and vancomycin (6 mgÆmL )1 ). The plates were incubated at 37 °C under microaerobic conditions (5% O 2 , 10% CO 2 ) for 36 h. The coccoid form of H. pylori cells was obtained from the culture plates kept for prolonged periods of 10–14 days, as described previously [34,35], at 37 °C under the same conditions. The morphology of bacteria was observed under the microscope and cells from both the bacillary and coccoid form cultures were harvested and used for the immunofluorescence assay. DNA preparation methods E. coli plasmids DNA were prepared by the alkaline lysis method [36]. Bacteriophage M13mp18 single-stranded circular DNA was prepared as per the protocol described previously [37]. H. pylori genomic DNA was isolated from confluent culture grown on BHI agar using the cetyl trimethyl ammonium bromide-phenol method [38]. DNA manipulation In the H. pylori genomic database, an ORF (HP1245) was annotated as the putative HpSSB homolog. The 540 bp long DNA fragment representing the ORF was amplified by PCR using H. pylori strain 26695 genomic DNA as tem- plate with forward and reverse primers having BamHI restriction sites using Pfu DNA polymerase. Similarly, a fragment with a deletion of 60 bp representing the last 20 amino acids at the C-terminus of the Hpssb gene was amplified by PCR. The PCR-amplified HpssbWt (540 bp) and HpssbDC20 (480 bp) DNA fragments were cloned in the expression vector pET28a (Novagen, Madison, WI, USA) at the BamHI site and subsequently sequenced. For the complementation assay, wild-type and Hpssb DC20 genes were subcloned from the respective pET28a recombinant clones into pTRC vector at the NcoI–HindIII restriction sites. For pET28a-HpSSB-mCherry constructs, the Hpssb gene was amplified using the same forward primer, but a reverse primer without a stop codon and with a SacI site, and cloned into pET28a at the BamHI–SacI site followed by cloning of PCR amplified mCherry gene from P RSET-B- mCherry [39] at the SacI–XhoI site [HpSSB full length for- ward BamHI, 5¢-CG GGATCCATGTTTAATAAAGTGA TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG ATCCCTTCATCAATATTGATTTCAGG-3¢; HpSSBDC20 reverse BamHI, 5¢-CGGGATCCTCACTGTGCTTGTAA ATTCTC-3¢; SSB reverse SacI (without stop codon), 5¢-CG AGCTC AAA GGG GAT TTC TTC TTC-3¢; mCherry forward SacI, 5¢-CGAGCTC ATG GTG AGC AAG GGC GAG-3¢; mCherry reverse XhoI, 5¢-CCGCTCGAG TTA CTT GTA CAG CTC GTC C-3¢]. A. Sharma et al. H. pylori SSB protein FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 527 Purification of His-tagged Wt and DC20 HpSSB protein E. coli strain BL21 (DE3) (Novagen) harboring pET28a HpSSB (Wt), DC20 SSB and SSB-mCherry constructs was grown at 37 °C in LB media containing 50 mgÆmL )1 kana- mycin. The bacterial cultures were induced for the expres- sion of the recombinant proteins using 0.25 mm IPTG at 22 °C for 4 h. His-tagged proteins were purified using Ni-NTA agarose beads (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions. The eluted proteins were dialyzed against dialysis buffer containing 50 mm Tris–Cl (pH 7.5), 1 mm EDTA, 100 mm NaCl, 100 mm phenylmethanesulfonyl fluoride and 10% glycerol. For helicase and ATPase assays, HpSSB (Wt) and DC20SSB were dialysed against MonoQ and MonoS buf- fers and subjected to ion exchange chromatography using MonoQ and MonoS ion-exchange columns (GE Health- care, Uppsala, Sweden) in accordance with the manu- facturer’s instructions. The fractions of ion exchange chromatography were then checked on 10% SDS ⁄ PAGE and pooled and dialysed against dialysis buffer. Protein concentrations were determined by the Brad- ford method (Bio-Rad, Hercules, CA, USA) in accor- dance with the manufacturer’s instructions with BSA as standard. Western blot analysis was carried out following standard procedures to check the proteins. Agarose gel retardation assay ssDNA binding activity of Wt HpSSB, DC20 and HpSSB- mCherry was checked by incubating the Wt and DC20 SSB protein in varying concentrations (0, 0.45, 0.9, 1.8, 2.7 and 3.6 lg, respectively) with 300 ng of M13mp18 single-stranded circular DNA and ⁄ or 300 ng of pUC18 double-stranded circular DNA in binding buffer (20 mm Tris–HCl, pH 8.0, 1 mm MgCl 2 , 100 mm KCl, 8 mm dithiothreitol, 4% sucrose and 80 lgÆmL )1 BSA) in a 20 lL reaction mixture. After 30 min of incubation on ice, reaction mixtures were resolved in 0.7% agarose gel along with M13mp18 ssDNA alone, as a control. The increas- ing retardation of the nucleoprotein complex with increas- ing concentrations of SSB indicates the ssDNA binding activity of test proteins. BSA was taken as a negative control. Electrophoretic mobility shift assay Thirty-two nucleotide ssDNA oligo (CGGGA CCATGCG CCAAAAAATGCCTAAAGAC) from Microsynth (Balgach, Switzerland) was radiolabeled using ( 32 P)ATP(cP) with the help of polynucleotide kinase enzyme and the purified labeled oligos were incubated in the absence or presence of HpSSB (20, 60, 100, 140 and 180 ng) in binding buffer (20 mm Tris–HCl, pH 8.0, 1 mm MgCl 2 , 100 mm KCl, 8mm dithiothreitol, 4% sucrose, 80 lgÆmL )1 BSA) for 30 min at room temperature (25 °C) and separated on a 6% native PAGE. The native gel was run at 150 V for 2 h in 1 · TBE buffer (Tris 89 mm, pH 8, boric acid 89 mm, EDTA 2 mm). The complex and the free DNA were visual- ized by autoradiography. Oligomerization status Wt HpSSB (500 lg) was subjected to size-exclusion chromatography on a Pharmacia Superdex 200 gel filtration column (Amersham Biosciences, Uppsala, Sweden) in a buffer containing 50 mm Tris–HCl (pH 7.4), 1 mm EDTA, 100 mm phenylmethanesulfonyl fluoride, 10% glycerol, 10 mm b-mercaptoethanol and 100 mm NaCl. The column was previously calibrated using Pharmacia low- and high- molecular weight standards as indicated. Fractions (0.3 mL) were collected and checked for the presence of proteins by SDS ⁄ PAGE. ATP hydrolysis assay The ATPase activity of HpDnaB with and without SSB was measured in a reaction mixture (20 lL) containing 20 mm Tris–HCl (pH 8.0), 1 mm MgCl 2 , 100 mm KCl, 8mm dithiothreitol, 4% sucrose, 80 lgÆmL )1 BSA, 1 mm ATP, 3.4 fmol of (c- 32 P)ATP and the required amount of DnaB (50 ng), along with 1 pmol of M13mp18 ssDNA and various concentrations of SSB. The reaction mixtures were incubated at 37 °C for 30 min and the reactions were stopped by putting the tubes on ice. Released inorganic phosphate (P i ) was separated by thin-layer chromatography on a poly ethylenemine cellulose strip (Sigma-Aldrich, St Louis, MO, USA) in 0.5 m LiCl and 1 m formic acid at room temperature for 1 h. The thin-layer chromatography plate was dried, autoradiographed and analyzed by a phos- phorimager (FujiÒlm-BAS-1800; Fuji, Tokyo, Japan) for quantitation. Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 single-stranded circular DNA. This annealed substrate has a six bases long 5¢ tail. Helicase assay was carried out in a 20 lL reaction mixture contain- ing 20 mm Tris–Cl (pH 8.0), 8 mm dithiothreitol, 2.5 mm MgCl 2 ,2mm ATP, 80 lgÆmL )1 BSA, 10 mm KCl, 4% sucrose and 10 fmol of helicase substrate and the indicated amount of HpDnaB and HpSSB. HpDnaB protein (3.0 ng) was incubated in above buffer for 15 min (on ice) and then the indicated amount of HpSSB was added to the reaction. This mixture was incubated at 37 °C in a water bath for H. pylori SSB protein A. Sharma et al. 528 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS [...]... Physical and functional interaction of the archaeal single-stranded DNA- binding protein SSB with RNA polymerase Nucleic Acids Res 32, 106 5–1 074 22 Biswas EE, Chen PH & Biswas SB (2002) Modulation of enzymatic activities of Escherichia coli DnaB helicase by single-stranded DNA- binding proteins Nucleic Acids Res 30, 280 9–2 816 23 Cadman CJ & McGlynn P (2004) PriA helicase and SSB interact physically and functionally... 637 8–6 387 24 Curth U, Genschel J, Urbanke C & Greipel J (1996) In vitro and in vivo function of the C-terminus of Escherichia coli single-stranded DNA binding protein Nucleic Acids Res 24, 270 6–2 711 25 Khamis MI, Casas-Finet JR, Maki AH, Murphy JB & Chase JW (1987) Investigation of the role of individual tryptophan residues in the binding of Escherichia coli single-stranded DNA binding protein to single-stranded. .. Helicobacter pylori DnaB helicase Nucleic Acids Res 31, 682 8–6 840 12 Soni RK, Mehra P, Mukhopadhyay G & Dhar SK (2005) Helicobacter pylori DnaB helicase can bypass Escherichia coli DnaC function in vivo Biochem J 389, 54 1–5 48 13 Nitharwal RG, Paul S, Dar A, Choudhury NR, Soni RK, Prusty D, Sinha S, Kashav T, Mukhopadhyay G, Chaudhuri TK et al (2007) The domain structure of Helicobacter pylori DnaB helicase: ... properties of Mycobacterium tuberculosis single-stranded DNA binding protein and its functional characterization in Escherichia coli Nucleic Acids Res 28, 382 3–3 829 28 Reyes-Lamothe R, Possoz C, Danilova O & Sherratt DJ (2008) Independent positioning and action of Escherichia coli replisomes in live cells Cell 133, 9 0–1 02 29 Genschel J, Curth U & Urbanke C (2000) Interaction of E coli single-stranded DNA binding. .. R (1997) A common core for binding single-stranded DNA: structural comparison of the single-stranded DNA- binding proteins (SSB) from E coli and human mitochondria FEBS Lett 411, 31 3–3 16 18 Murzin AG (1993) OB(oligonucleotide ⁄ oligosaccharide binding) -fold: common structural and functional solution for non-homologous sequences EMBO J 12, 86 1–8 67 FEBS Journal 276 (2009) 51 9–5 31 ª 2008 The Authors Journal... Terradot L (2007) Structural similarity between the DnaA -binding proteins HobA (HP1230) from Helicobacter pylori and DiaA from Escherichia coli Mol Microbiol 65, 99 5–1 005 16 Shamoo Y, Friedman AM, Parsons MR, Konigsberg WH & Steitz TA (1995) Crystal structure of a replication fork single-stranded DNA binding protein (T4 gp32) complexed to DNA Nature 376, 36 2–3 66 17 Webster G, Genschel J, Curth U, Urbanke... for failure of amoxycillin–omeprazole treatment of Helicobacter pylori infection Aliment Pharmacol Ther 12, 63 5–6 39 4 Niv Y (2008) H pylori recurrence after successful eradication World J Gastroenterol 14, 147 7–1 478 5 Catrenich CE & Makin KM (1991) Characterization of the morphologic conversion of Helicobacter pylori from bacillary to coccoid forms Scand J Gastroenterol 26(Suppl 181), 5 8–6 4 6 Cellini... Shimizu M (1997) Functional domains of Escherichia coli single-stranded DNA binding protein as assessed by analyses of the deletion mutants Biochemistry 36, 673 2– 6738 20 Kelman Z, Yuzhakov A, Andjelkovic J & O’Donnell M (1998) Devoted to the lagging strand-the subunit of DNA polymerase III holoenzyme contacts SSB to promote processive elongation and sliding clamp assembly EMBO J 17, 243 6–2 449 21 Richard... sequence of the gastric pathogen Helicobacter pylori Nature 388, 53 9–5 47 10 Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan B, Guild BC, deJonge BL et al (1999) Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori Nature 397, 17 6–1 80 11 Soni RK, Mehra P, Choudhury NR, Mukhopadhyay G & Dhar SK (2003) Functional characterization of Helicobacter. .. binding protein to single-stranded polynucleotides A study by optical detection of magnetic resonance and site-selected mutagenesis J Biol Chem 262, 1093 8–1 0945 26 Curth U, Bayer I, Greipel J, Mayer F, Urbanke C & Maass G (1991) Amino acid 55 plays a central role in tetramerization and function of Escherichia coli singlestranded DNA binding protein Eur J Biochem 196, 8 7–9 3 27 Handa P, Acharya N, Thanedar . Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity Atul Sharma 1, *, Ram G. Nitharwal 1, *, Bhupender. understood in this pathogen. In the present study, we report the cloning and functional characterization of the single-stranded DNA (ssDNA) binding protein from H. pylori. The N-ter- minal DNA binding. analysis of the major replicative helicase DnaB from H. pylori [13]. We were interested to see whether HpSSB would modulate the enzymatic activities of HpDnaB. One of the hallmarks of the replicative