26 disabling automatic site coverage for a domain controller
Báo cáo hóa học: " Research Article Automatic Threshold Determination for a Local Approach of Change Detection in Long-Term Signal Recordings" doc
... itself In addition, these thresholds are learned automatically [1] R A Obrecht, A new statistical approach for the automatic segmentation of continuous speech signals,” IEEE Transactions on Acoustics, ... the probability of false alarm for a given detection probability CONCLUSION The local approach of change detection allows a local estimation of the distribution parameters before and after the ... False alarm probability Figure 7: Comparison of DCS and MDCS methods by ROC curves computed from simulated data x-axis: false alarm probability, yaxis: detection probability for the classical...
- 7
- 279
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... [23], indicates that the mechanism may be similar to that of Co2+ The fact that the equilibrium constants for the a domain are greater than those for the b domain may be a factor in explaining the ... (Aldrich, Oakville, ON, Canada); isopropyl-b-d-thiogalactoside (Sigma-Aldrich, Oakville, ON, Canada); ammonium hydroxide (BDH Chemicals ⁄ VWR, Mississauga, ON, Canada); formic acid (J T Baker Chemical ... columns (Amersham Biosciences ⁄ GE Healthcare, Piscataway, NJ, USA), superfine G-25 Sephadex (Pharmacia ⁄ Pfizer, Oakville, ON, Canada) and a stirred ultrafiltration cell (Amicon Bioseparations ⁄...
- 9
- 533
- 0
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc
... negative sentiment) given a small set of labeled data for the source domain, and unlabeled data for both source and target domains In particular, no labeled data is provided for the target domain ... techniques In EMNLP 2002, pages 79– 86 Patrick Pantel and Deepak Ravichandran 2004 Automatically labeling semantic classes In NAACLHLT’04, pages 321 – 328 Sunita Sarawagi and Alok Kirpal 2004 Efficient ... spectral feature alignment technique of Pan et al (2010) Both the LSA and FALSA techniques are based on latent semantic analysis (Pan et al., 2010) For the Within -Domain baseline, we train a binary...
- 10
- 555
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... CCCAAGCTTGATGATGTCAGC CCCAAGCTTGAACGCCTTCATAGTGTC BamHI SmaI BamHI SmaI BamHI SmaI BamHI SmaI a Restriction sites used for cloning are shown in italic b Nucleotides changed for site- directed mutagenesis...
- 13
- 514
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A FEBS Journal 273 (2006)...
- 11
- 548
- 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc
... document retrieval track: A success story In Proc Content-Based Multimedia Information Access Conf., apr J Kupiec, D Kimber, and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence ... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above ... orthographic forms would be trickier to implement but could also improve recall For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia...
- 4
- 276
- 0
Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf
... Lexical Chain Features Chain starts and ends We follow (Chan et al 2007) to model the lexical chain starts and ends at a story boundary with a statistical distribution We apply a window around ... We have presented a Bayesian decision framework that performs automatic story segmentation based on statistical modeling of one or more lexical chain features, including lexical chain starts, ... approach in (Chan et al 2007) based on the training data The optimal value is found to be 130.9sec for long programs We make use of three lexical chain features: chain starts, continuations and...
- 4
- 402
- 1
Báo cáo khoa học: "A Comparison of Head Transducers and Transfer for a Limited Domain Translation Application" pptx
... of a word and acceptor to start an entire derivation Monolingual Relational Models We can characterize the language models used for analysis and generation in the transfer system as quantitative ... Probabilistic Model of Link Grammar" In Proceedings of the 1992 AAAI Fall Symposium on Probabilistic Approaches to Natural Language, 89-97 References Alshawi, H and A. L Buchsbaum 1997 "StateTransition ... UMIST, Manchester, UK Alshawi, H 1996b "Head Automata for Speech Translation" In Proceedings of the International Conference on Spoken Language Processing, Philadelphia, Pennsylvania Sata, G and...
- 6
- 324
- 0
Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx
... divergence similarity function) Evaluation We evaluated the performance of our models automatically, and also by eliciting human judgments Our automatic evaluation was based on Translation Edit Rate (TER, ... pages 1002–1009 Feng, Yansong and Mirella Lapata 2008 Automatic image annotation using auxiliary text information In Proceedings of the 46th Annual Meeting of the Association of Computational ... human motion and interleave them with a concept hierarchy of actions to create a case frame from which a natural language sentence is generated Yao et al (2009) present a general framework for...
- 11
- 464
- 0
Báo cáo khoa học: " A Practical Korean Question Answering Framework for Restricted Domain" pptx
... stochastic part-of-speech tagger and dependency parser(Chung and Rim, 2004) for the Korean language are trained on a general domain corpus and are used for the analyzer Then, several domain- specific ... K-QARD framework, we built restricted domain question answering systems for the several domains: weather, broadcast, and traffic For the adaptation of QA system to each domain, we rewrote the domain ... of about 100 questions for the each domain All information for the question answering was automatically extracted using the Web IE module of K-QARD, which was also learned from training examples...
- 4
- 243
- 0
Báo cáo hóa học: " Research Article A Domain-Specific Language for Multitask Systems, Applying Discrete Controller Synthesis" pdf
... Delaval and E Rutten 11 s2 ∧ a3 s2 ∧ a3 ∧ a1 s1 a2 ∧ a1 s1 s2 ∧ a3 ∧ a1 a2 ∧ a1 a1 ∧ a3 s1 ¬s1 ∧ a2 a3 a3 ∧¬s1 a1 ∧ ¬s2 Err Err Err (a) Always t1 between (t2,t3) s2 s2 ∧ ¬s1 (b) Always t1 before ... control automaton can be constructed Each declared application has a name, and is launched on the occurrence of a signal req name The automaton of an application named A is shown in Figure 8 (a) On ... “protoautomata,” an intermediary form of automata, to represent each statement translated, and which will be composed together A protoautomaton is an automaton as shown in Figure 8(b), with a labelled...
- 17
- 288
- 0
Báo cáo khoa học: "Port site metastasis following diagnostic laparoscopy for a malignant Gastro-intestinal stromal tumour" pot
... event leading up to presentation Malignant tumours often have a palpable mass at diagnosis and response to Glivec (although somewhat variable) can be dramatic Generally speaking, pre-operative ... mesenchymal tumour affecting the GI tract They may present in a variety of ways, can range from small to very large and demonstrate a great diversity in their malignant potential Tumours are often ... interests As far as the authors are aware, there is only one previously documented case of port site metastasis (PSM) following laparoscopy for a stromal tumour [8] Although an extremely rare phenomenon,...
- 4
- 233
- 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... initiation codon, using the primer 5'-TGCAAATAAATGGATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000) Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA3' (nt 6113 to 6134) and 5'-TATCAACCCCAGCTAAGTAAGCAA-3' ... were Mar52 (5'-TAATCTGTGCAATACCAGAGCGGCT-3'; nt 131 to 155; forward primer) and M3b Primer pair MarN (5'-CAGCAAGGTAAGTATCAACCCCAG-3'; nt 6117 to 6140; forward primer) and M3b was used in a second ... Forward primer M5e (5'-GGAATTCATGGATGCTGGGGCCAGATAC-3'; nt 6012 to 6032) and reverse primer M3b (5'-CGGGATCCGCAAGCAGCAAGCTTCTCCTTATATA-3'; nt 9098 to 9073) contained EcoRI and BamHI sites at their...
- 17
- 422
- 0
caregivers' experiences of caring for a child with cardiac arrhythmia who has an automatic external defibrillator
... Caring for a Child with Cardiac Arrhythmia who has an Automatic External Defibrillator: An Exploratory Study using Interpretative Phenomenological Analysis Sonia Anker-Petersen Mental Health and ... with cardiac arrhythmia and an ICD, however, will arguably have a different experience from parents of children with cardiac arrhythmia and an AED A qualitative study carried out in the USA (Farnsworth ... manage their daily experiences It 40 became apparent that caring for a child with cardiac arrhythmia can lead to feelings of distress and worry for caregivers, especially because there is a large...
- 132
- 279
- 0
Write a report for a university lecturer describing the information in the graphs below
... research funding, diarrhoea 60 million dollars in research funding, malaria 50 million dollars and TB 20 million dollars in research funding In conclusion it is clear that funding allocation for ... model answer: The graphs compare the number of deaths caused by six diseases in Someland in 1990 with the amount of research funding allocated to each of those diseases It can be clearly seen that ... deaths from leprosy, 0.3 million deaths from tropical diseases, 0.5 million deaths from diarrhoea, 0.4 million deaths from malaria and 1.8 million deaths from TB These figures can be contrasted...
- 2
- 1,573
- 0
Write a report for a university lecturer describing the information in the two graphs below
... situation had changed radically by 1995 In 1995, 90% of women in Someland had completed secondary education and of those, half had graduated from an initial degree and 20% had gone on to postgraduate ... postgraduate studies At the other end of the scale we can see that by 1995 all girls were completing lower secondary, although 10% ended their schooling at this point This is in stark contrast with ... girls completed primary school, 35% had no schooling at all and 35% only completed the third grade In conclusion, we can see that in the 50 years from 1945 to 1995 there have been huge positive...
- 2
- 1,560
- 2
Business Plan for a Startup Business
... Use a startup expenses and capitalization spreadsheet as a guide to preparing a balance sheet as of opening day Then detail how you calculated the account balances on your opening day balance ... and financial management A balance sheet shows what items of value are held by the company (assets), and what its debts are (liabilities) When liabilities are subtracted from assets, the remainder ... appear in the cash flow at all because you never write a check for it Opening Day Balance Sheet A balance sheet is one of the fundamental financial reports that any business needs for reporting and...
- 27
- 903
- 10
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008