2 1 a and b p 33
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... (19< /b> 96) molmol: a < /b> ¨ program for display and < /b> analysis of macromolecular structures J Mol Graph 14< /b> , 51< /b> 32 < /b> Supplementary material The following supplementary material is available online: Table S1 ... faint similarities of some parts of the polypeptide backbone folds could be observed Separate superpositions of stretches 3– 12< /b> ,< /b> 11< /b> 20< /b> and < /b> 18< /b> 28< /b> were also attempted For both domains, the first and < /b> ... structure family had a < /b> tar˚ get function of 0 .15< /b> ± 0 .11< /b> A2< /b> and < /b> rmsd values of ˚ ˚ 1.< /b> 51 < /b> ± 0 .27< /b> A < /b> and < /b> 2.< /b> 22 < /b> ± 0.30 A < /b> with respect to the mean structure for the backbone and < /b> all heavy atoms, respectively...
- 14
- 485
- 0
bài tập Tình huống: “Một nhà đầu tư Việt Nam dự định triển khai 1 dự án xây dựng bến phà nằm trên địa bàn 2 tỉnh A và B, nhằm đáp ứng nhu cầu vận chuyển hàng hóa và hành khách qua dòng sông nằm giữa địa bàn 2 tỉnh, kinh phí khoảng 1.000 tỷ đồng. Hãy tư vấ
... định 10< /b> 8 thì hồ sơ thẩm tra bao gồm những tài liệu sau đây: văn bản đề nghị câ p giấy chứng nhận đầu tư đối với dự a< /b> n xây dựng b ́n phá đi a < /b> bàn hai tỉnh A < /b> và B, văn bản xác ... dự a< /b> n bị kéo dài, hiệu quả dự a< /b> n thâ p, chi phí phát sinh lãi xuất bị đội lên thì toàn b ̣ việc chi phí đó đều tính vào giá thành dự a< /b> n và Nhà nước đều phải gánh ... quyền Vì dự a< /b> n xây dựng b n phá nói có tổng giá trị là 10< /b> 00 tỷ đồng và nằm đi a < /b> bàn hai tỉnh là tỉnh A < /b> và tỉnh B nên theo quy định tại Điều 3, nghị định 10< /b> 8/N 14< /b> CP /20< /b> 09 hướng...
- 20
- 2,059
- 7
ĐỀ tài LUẬT một NHÀ đầu tư VIỆT NAM dự ĐỊNH TRIỂN KHAI 1 dự án xây DỰNG bến PHÀ nằm TRÊN địa bàn 2 TỈNH a và b, NHẰM đáp ỨNG NHU cầu vận CHUYỂN HÀNG hóa và HÀNH KHÁCH QUA DÒNG SÔNG nằm GIỮA địa bàn
... đối với dự a< /b> n xây dựng b ́n phá đi a < /b> bàn hai tỉnh A < /b> và B, văn bản xác nhận tư cách pha p lí cu a < /b> nhà đầu Ketnooi.com nghi p giáo dục tư, báo cáo lực tài chính, giải trình kinh ... dự a< /b> n b ́n phà nằm đi a < /b> bàn hai tỉnh A < /b> và B nói thì nhu cầu sử dụng cu a < /b> nhà đầu tư là bao nhiêu, loại đất cần sử dụng là gì và tiến độ cu a < /b> quá trình sự dụng đất Ba ... thuộc b ́n phá thuộc hai tỉnh A < /b> và B nói thuộc lĩnh vực ch a < /b> có quy hoạch thì quan nhà nước quản lí đầu tư câ p tỉnh thuộc tỉnh A < /b> và tỉnh B phải lấy ý kiến các b ̣, ngành; mà...
- 6
- 1,163
- 13
Bài tập luật một nhà đầu tư việt nam dự định triển khai 1 dự án xây dựng bến phà nằm trên địa bàn 2 tỉnh a và b, nhằm đáp ứng nhu cầu vận chuyển hàng hóa và hành khách qua dòng sông nằm
... nghị câ p giấy chứng nhận đầu tư đối với dự a< /b> n xây dựng b ́n phá đi a < /b> bàn hai tỉnh A < /b> và B, văn bản xác nhận tư cách pha p lí cu a < /b> nhà đầu tư, báo cáo lực tài chính, giải ... dự a< /b> n b ́n phà nằm đi a < /b> bàn hai tỉnh A < /b> và B nói thì nhu cầu sử dụng cu a < /b> nhà đầu tư là bao nhiêu, loại đất cần sử dụng là gì và tiến độ cu a < /b> quá trình sự dụng đất Ba ... thuộc b ́n phá thuộc hai tỉnh A < /b> và B nói thuộc lĩnh vực ch a < /b> có quy hoạch thì quan nhà nước quản lí đầu tư câ p tỉnh thuộc tỉnh A < /b> và tỉnh B phải lấy ý kiến các b ̣, ngành; mà...
- 10
- 3,630
- 14
600 sentences of certificate A and B
... >d 18< /b> 0 I understand what you are saying a < /b> perfect b perfectly c perfection d imperfect > b 18< /b> 1 His promotion to manager was a < /b> popular ……………………………… a < /b> appoint b appointed c appointment d appointee ... > d 29< /b> 0 Always make sure your luggage has on it when you travel a < /b> a card b a < /b> cartel c a < /b> label d a < /b> traveling-bag > c 29< /b> 1 < /b> Last December the boss gave all his a < /b> bonus a < /b> employ b employable ... Nobel Peace Prize a < /b> receive b have c take d accept > a < /b> 26< /b> 3 The building of the new bridge will as planned a < /b> go up b put up c go out d go ahead > d 26< /b> 4 I see the price of bread has again a...
- 280
- 884
- 3
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... as LlCBP3 3A)< /b> ; and < /b> a < /b> family 20< /b> N-acetylhexosaminidase (LnbA) The chiA and < /b> yucG genes are separated by 19< /b> bp in an operon starting with a < /b> putative transcriptional regulator positioned 16< /b> 6 bp upstream ... chitin-binding protein 11< /b> 12< /b> < /b> 13< /b> 14< /b> 15< /b> 16< /b> 17< /b> 18< /b> 19< /b> 20< /b> 21 /b> 22< /b> 23< /b> G Vaaje-Kolstad et al protein CBP 21 < /b> from Serratia marcescens is essential for chitin degradation J Biol Chem 28< /b> 0, 28< /b> 4 922< /b> 8497 Robyt JF ... (GenBank ID: AAK06048 .1)< /b> and < /b> gene encoding a < /b> family 33 CBP (GenBank ID: AAK06049 .1)< /b> was amplied FEBS Journal 27< /b> 6 (20< /b> 09) 24< /b> 022< /b> 415< /b> ê 20< /b> 09 The Authors Journal compilation ê 20< /b> 09 FEBS G Vaaje-Kolstad...
- 14
- 683
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... the b subunit: hv ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv 1< /b> ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 ... 0.3 1.< /b> 0 10< /b> .2 < /b> ± 0.7 72.< /b> 3 ± 1.< /b> 4 11< /b> .8 ± 0 .2 < /b> 88 .2 < /b> ± 0 .2 < /b> 2.0 12< /b> .< /b> 9 ± 0.4 91 < /b> .2 < /b> ± 1.< /b> 0 11< /b> .8 ± 0.3 88 .2 < /b> ± 0.3 2.< /b> 0 19< /b> ± 90 ± 9 2 < /b> 91 < /b> ± 7.4 6.8 10< /b> 0 20< /b> M k a < /b> lM )1< /b> s )1 < /b> k b lM )1< /b> s )1 < /b> aa % ab % ca, daa 10< /b> )2,< /b> 10< /b> )2 < /b> ... ± 1.< /b> 8 26< /b> ± 74 ± Averageb .5 ± 4.5> aa % ab % cb, dba 10< /b> )2,< /b> 10< /b> )2 < /b> c, da 10< /b> )2,< /b> 10< /b> )2 < /b> 1.< /b> 1 ± 0 .2 < /b> [4.8 ± 1.< /b> 0] 1.< /b> 01 < /b> ± 0 .16< /b> [4.4 ± 0.9] 1.< /b> 3 ± 0 .2 < /b> [5.5 ± 1.< /b> 1] 2...
- 11
- 577
- 0
The a and b adapters are used as priming sites for both amplification
... FLX 20< /b> sequencer Step 1:< /b> Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A< /b> and < /b> B adapters are ligated to the blunt ... DNA ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A < /b> and < /b> B adapters are used as priming sites for both amplification ... luciferase, and < /b> packing beads used only to keep the DNA beads in place • Above the wells is a < /b> flow channel, passing nucleotides and < /b> apyrase in a < /b> timed schedule PYROSEQUENCING The Chemical Chain...
- 19
- 390
- 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx
... et al (20< /b> 04) Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp atroseptica and < /b> characterization of virulence factors Proc Natl Acad Sci USA 10< /b> 1, 11< /b> 105 11< /b> 110< /b> Supporting ... (20< /b> 07) Oxo-phytodienoic ¨ acid-containing galactolipids in Arabidopsis: jasmonate signaling dependence Plant Physiol 14< /b> 5, 16< /b> 58 16< /b> 69 44 72 < /b> 47 Buseman CM, Tamura P, Sparks AA, Baughman EJ, Maatta ... H 1a,< /b> b (4. 32 < /b> and < /b> 4 .18< /b> p. p.m.) and < /b> H2 (5 .19< /b> p. p.m.) are shifted downfield relative to signals of H 3a,< /b> b (3.89 and < /b> 3.68 p. p.m.) This indicates the presence of ester substituents at sn -1 < /b> and < /b> sn -2,< /b> and...
- 10
- 387
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... Hsp90 [16< /b> ] Results PP30[hHsp9 0a]< /b> and < /b> PP30[hHsp9 0b] ) yeast strains that express human Hsp9 0a < /b> or Hsp9 0b as their sole Hsp90 S cerevisiae strains PP30[pHSC8 2b] , PP30[pHSP 82]< /b> and < /b> PP30[hHsp9 0b] are ... efficiencies, both of the yeast and < /b> both of the human isoforms of Hsp90 indicated that the levels of Hsp90 expression in strains PP30[pHSC8 2b] , PP30[pHSP 82]< /b> , PP30[hHsp9 0a]< /b> and < /b> PP30[hHsp9 0b] were comparable, ... Regan L, Panaretou B, Ladbury JE, Piper PW & Pearl LH (19< /b> 99) Regulation of Hsp90 ATPase activity by tetratricopeptide repeat (TPR)-domain co-chaperones EMBO J 18< /b> , 754–7 62 < /b> Prodromou C, Panaretou...
- 11
- 427
- 0
IBM CloudBurst 2.1 on Systems x & p Cl on Syste stemAn integrated Private Cloud Service Delivery Platform docx
... Redundant 10< /b> Gb Ethernet Networking: x BNT Virtual Fabric Switch Module 1 < /b> 2 < /b> Redundant 10< /b> Gb Ethernet Rack Switch: x BLADE G8 12< /b> 4< /b> 10< /b> GbE Rack Switch : Not applicable Not applicable Not applicable 7 .2 < /b> 14< /b> .4 ... 4 0B- 4 40 Port Switch (supports up to two racks) 1 < /b> Not applicable Number of VMs supported *Based on standard support of 1/< /b> 10 of processor per LPAR on Power servers Raw Storage Capacity (TB) if using ... track, allocate and < /b> invoice by department, user and < /b> many additional criteria •Collect, analyze and < /b> bill based on usage and < /b> costs of shared assets •Deliver detailed information and < /b> reports about...
- 50
- 494
- 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... Protochlorophyllide-independent import of two NADPH:Pchlide oxidoreductase proteins (PORA and < /b> 10< /b> 80 14< /b> 15< /b> 16< /b> 17< /b> 18< /b> 19< /b> 20< /b> 21 /b> 22< /b> 23< /b> 24< /b> 25< /b> PORB) from barley into isolated plastids Physiol Plant 10< /b> 9, 29< /b> 8–303 Kim C & Apel ... of PORA and < /b> PORB of barley and < /b> POR from pea are homologous, and < /b> that Pchlide cannot bind to the PORA transit peptide of pPORA as recently proposed [22< /b> ] Results Acetylation of the POR protein and < /b> ... & Apel K (19< /b> 95) Identification of NADPH:protochlorophyllide oxidoreductases A < /b> and < /b> B: a < /b> branched pathway for light-dependent chlorophyll biosynthesis in Arabidopsis thaliana Plant Physiol 10< /b> 8, 15< /b> 05 15< /b> 17...
- 8
- 362
- 0
www.daykemquynhon.ucoz.com Trung tâm bồi dưỡng kiến thức văn hóa cho học sinh cấp 3TRƯỜNG THPT NGÔ SỸ LIÊN TP BẮC GIANG Mã đề thi: 121Đ T I T ỬT Á GL N1 Ề H H HN ẦN M Ọ 2 1 -2 1 Ă H C 01 02 MÔN : HÓA HỌC - 12(Thời gian làm bài 90 phút không kể thời ppt
... h p A < /b> A 4, 625< /b> gam B 5,55 gam C 1 < /b> ,27< /b> 5 gam D 2,< /b> 20 gam Câu 42 < /b> Cho dung dịch Ba(HCO3 )2 < /b> vào dung dịch: CaCl2, Ca(NO3 )2,< /b> NaOH, Na2CO3, KHSO4, Na2SO4, Ca(OH )2,< /b> H2SO4, HCl Số trường h p có tạo kết t a < /b> ... www.daykemquynhon.ucoz.com Trung tâm b i dưỡng kiến thức văn h a < /b> cho học sinh c p A < /b> Propen và but -1-< /b> en B Etylen và propen C Propen và but -2-< /b> en D Propen và 2-< /b> metylpropen Câu 12< /b> < /b> Hoà tan hết 2,< /b> 08 ... (4) Phenol có tính axit mạnh crezol Số kết luận sai là: A < /b> B C D Câu 22< /b> Cho nguyên tố có cấu hình electron hạt vi mô sau: X : [Ne] 3s2 3p1 Y2+ : 1s2 2s2 2p6 Z : [Ar] 3d5 4s2 M2-: 1s2 2s2 2p6 3s2...
- 4
- 1,372
- 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... Forssman synthetase Human Rat Pig Mouse Human Platyrrhini Marmoset Cow Pig Mouse Rat Human Rat Human Dog J0 517< /b> 5 AF264 018< /b> AF05 017< /b> 7 AB0 410< /b> 39 M650 82 < /b> S 713< /b> 33 A5< /b> 6480 J04989 L3 61 < /b> 52 < /b> M8 515< /b> 3 AF 520< /b> 589 AL 513< /b> 327< /b> ... TMAP and < /b> TOPPRED2 programs Determination of the exon/ intron boundaries were obtained by analysis of the rat genomic sequences available in the NCBI database The programs used are all available ... transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea...
- 8
- 499
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... to amplify 1 < /b> 3 21 /b> bp TPa fragment containing E 1b & E2; lane 4, Kin130/Kin 21 < /b> predicted to amplify 11< /b> 90 bp TPb fragment containing E 1b & E2; lane 5, Kin45/Kin75 predicted to amplify 10< /b> 40 bp TPa fragment ... 1,< /b> Kin 12< /b> 9< /b> /Kin75 predicted to amplify 13< /b> 10 bp TPa fragment containing E1 and < /b> E2; lane 2,< /b> Kin 12< /b> 9< /b> /Kin 21 < /b> predicted to amplify 11< /b> 88 bp TPb fragment containing E1 & E2; lane 3, Kin130/Kin75 predicted ... Enhancer vectors to generate the recombinant plasmids pGL 3b: Prm1; pGL 3b: Prm2 and < /b> pGL 3b: Prm3, each in pGL3Basic and < /b> pGL3e:Prm1; pGL3e:Prm2 and < /b> pGL3e:Prm3, each in pGL3Enhancer The fidelity of all...
- 16
- 321
- 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... EcoRI BamHI (20< /b> 65) pK9 Pol I EB (20< /b> 72)< /b> Consensus ( 21 /b> 07) 21 /b> 07 21 /b> 20 21 /b> 30 21 /b> 40 21 /b> 50 21 /b> 60 21 /b> 70 21 /b> 80 21 /b> 90 22< /b> 00 22< /b> 10< /b> 22< /b> 20 22< /b> 34 GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT ... XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18< /b> S rRNA Gene MDCK Eco RI 7 .1 < /b> kb Fragment B M C M Probe ... GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726< /b> , 713< /b> 553, 500 427< /b> , 417< /b> , 413< /b> 311< /b> 24< /b> 9 20< /b> 0 GCGGGTTCAAAAACTACTATAGGTAGGCAG Human TTTTTTGTTGCCAGGTAGGTGCTGACACGT MDCK...
- 12
- 567
- 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... EcoRI BamHI (20< /b> 65) pK9 Pol I EB (20< /b> 72)< /b> Consensus ( 21 /b> 07) 21 /b> 07 21 /b> 20 21 /b> 30 21 /b> 40 21 /b> 50 21 /b> 60 21 /b> 70 21 /b> 80 21 /b> 90 22< /b> 00 22< /b> 10< /b> 22< /b> 20 22< /b> 34 GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT ... XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18< /b> S rRNA Gene MDCK Eco RI 7 .1 < /b> kb Fragment B M C M Probe ... GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726< /b> , 713< /b> 553, 500 427< /b> , 417< /b> , 413< /b> 311< /b> 24< /b> 9 20< /b> 0 GCGGGTTCAAAAACTACTATAGGTAGGCAG Human TTTTTTGTTGCCAGGTAGGTGCTGACACGT MDCK...
- 12
- 627
- 0
2000 Test exam with A and B docx
... c perfection d imperfect > b 18< /b> 1 His promotion to manager was a < /b> popular ……………………………… a < /b> appoint b appointed c appointment d appointee > c 1 < /b> 82 < /b> A < /b> holiday in America can be cheap a < /b> surprise b ... it when you travel a < /b> a card b a < /b> cartel c a < /b> label d a < /b> traveling-bag > c 29< /b> 1 < /b> Last December the boss gave all his a < /b> bonus a < /b> employ b employable c employee d employees > d 29< /b> 2 Are you sure we're ... are tall a < /b> the b a < /b> c an d no article > d 54 Hoa is good pupil a < /b> the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class...
- 281
- 349
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008