14—parts of a tubular connection see 2 21
Bài 17 - Parts of a paragraph (Kết cấu của đoạn văn)-phần1 ppsx
... hundred years old These three landmarks are truly amazing and make my hometown a famous place Bạn quan sát xem câu kết, These three landmarks are truly amazing and make my hometown a famous place, ... several amazing natural features, có câu hỏi thường xuất đầu họ Ở trường hợp câu: "What are the natural features that make Wheaton famous?" ( Đặc điểm tự nhiên làm cho Wheaton tiếng?) Sau người ... famous because it is located by Wheaton River, which is very wide, and because it is built near an unusually steep hill called Wheaton Hill There are two reasons why some people like to buy cars...
- 23
- 527
- 1
Bài 17 - Parts of a paragraph (Kết cấu của đoạn văn)-phần2 pptx
... Chọn số câu sau để làm câu chủ đề: (1) Solar-powered cars are expensive (2) There are many advantages and disadvantages to solar energy (3) The future practicality of solar cars depends on ... stands clearly against the sky and can be seen from many miles away The third amazing feature is the Big Old Tree This tree stands two hundred feet tall and is probably about six hundred years ... is so near the sun there are no bodies of water on its surface Earth, the third closest planet to the sun, has a cooler atmosphere that sustains animals, plants and several bodies of water on...
- 22
- 1,201
- 3
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx
... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...
- 13
- 596
- 2
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx
... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... viết tắt "Esq." ) thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi...
- 7
- 475
- 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf
... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... viết tắt "Esq." ) thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi...
- 7
- 574
- 1
báo cáo khoa học: " Biological activity of a genetically modified BMP-2 variant with inhibitory activity" potx
... Examination of the implants After explantation the mineralisation of the scaffolds was investigated radiographically in a 2- dimensional manner (Faxitron, 22 kV, 35 s) The radiograms were digitalized ... alterations of amino acids at position 34 and 53: alanine was substituted by aspartate and aspartate by alanine, respectively The mutation at position 34 mediates the inhibitoric activity via ... formation Area of Area of bone formation Illustration of the mean area (mm2) of newly formed heterothopic bone (error bar: standard deviation) much more bone formation, not only at the margins...
- 5
- 384
- 0
Unit 14: Making Plans A 1-2
... place is this? The beach, Nha Trang Which place is this ? Ngoc Son Temple, Ha Noi Presentation Dialogue • • Listen, repeat then read in pairs ( A1 , page 140) Comprehension Questions ( A2 , page ... choosing a letter What does Peter in his free time ? A B D E F M L R PRESENTATION: Which place is this? The Citadel, Hue Which place is this ? Tuan Chau Island, Ha Which place is this ? Ben Thanh Market ... S1: What are you going to this summer ? • S2: I’m going to visit Hue Ha Noi Ha Long bay Nha Trang Ho Chi Minh City Word Cue Drill – Example Exchange with my aunt S1: Where are you going to stay...
- 14
- 882
- 1
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell
... is used to analyse and evaluate the performance of a planar and a tubular- shaped PEM fuel cell 2. 1 Computational domain The full computational domains for the planar and tubular- shaped PEM fuel ... external boundaries of the computational domain as well as boundaries for various mass and scalar equations inside the computational domain 2. 3.1 Inlets The inlet values at the anode and cathode are ... Issue 1, 20 13, pp.1 -26 (a) (b) Figure Three-dimensional computational domains of the planar and tubular- shaped PEM fuel cell: (a) planad and (b) tubular ISSN 20 76 -28 95 (Print), ISSN 20 76 -29 09 (Online)...
- 26
- 609
- 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch
... path enter dir flash: or show flash to display the contents as follows: ALSwitch#dir flash: Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.bin -rwx 26 9 Jan ... Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.old -rwx 26 9 Jan 01 1970 00:00:57 env_vars 2- 4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6 .2. 9 Copyright ... server ALSwitch#rename flash: c2950-c3h2s-mz. 120 -5.3.WC.1.bin flash: c2950c3h2s-mz. 120 -5.3.WC.1.old b Enter the following to verify that the renaming was successful: ALSwitch#dir flash: Directory of...
- 4
- 337
- 0
unit 14 - lesson 1: Á,2
... practice Picture cue drill a - What are you going to this summer vacation? - I am going to visit Ha Long Bay III/ practice Picture cue drill Write about your vacation plan this summer (You can ... What you in the summer? go fishing UNIT 14 Making plans LESSON 1: A1 ,2 I NEW WORDS a vacation : kì nghỉ the citadel : thành nội/ thành luỹ lại to stay : stay with lại với (ai) stay for lại (bao ... to visit : thăm an uncle : chú, cậu, bác (trai) an aunt : cô, dì, bác (gái) II/ listen and read Listen and repeat Model sentences -What are you going to this summer vacation? - I am going to visit...
- 12
- 468
- 0
Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pdf
... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: ... CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2. 2 Are the keepalive messages being received? Copyright 20 03, Cisco Systems, Inc Step Enter privileged EXEC mode a Enter enable at the command ... CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2. 2 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface...
- 5
- 533
- 0
Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pptx
... the type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers ... interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2 Copyright 20 03, ... CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2...
- 5
- 494
- 0
Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx
... serial interface on the PC or dumb terminal is a DB -25 , an RJ-45 to DB -25 adapter will be needed Both of these adapters typically come with a Cisco router or switch Step Locate or build a rollover ... rollover cable Use a rollover cable If necessary, make one of adequate length to connect the router or switch to a workstation 2- 6 CCNA 1: Networking Basics v 3.0 - Lab 5 .2. 7 Copyright 20 03, Cisco ... HyperTerminal program: Start > Programs > Accessories > Communications > Hyper Terminal Step Name the HyperTerminal Session At the Connection Description” popup enter a name in the connection Name...
- 6
- 476
- 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc
... contents as follows: ALSwitch#dir flash: Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.bin -rwx 26 9 Jan 01 1970 00:00:57 env_vars drwx 1 024 0 Mar 01 1993 00 :21 :13 ... flash: c2950c3h2s-mz. 120 -5.3.WC.1.old b Enter the following to verify that the renaming was successful: ALSwitch#dir flash: Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.old ... - Lab 6 .2. 9 Copyright 20 03, Cisco Systems, Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch...
- 5
- 335
- 0
A contrastive analysis of metaphors relating to parts of human body in english and vietnamese
... # s # 96: :A 97AA7< " # ) z 97AAA< , ##5 ) 51mmm6 &+ - 97AA6< , • B 96:;:< , # / 96::?< " s ) • =3 & 96:::< ? "0B - D 2 96::F< C L * D 97AA8< , * ) s D 97AAA< " =L ) 96:::< ... I I I ! I I $ $ / ( ! # B 97AA8, 88< G * D L ( ! ! ! & ! ! ' # ( ' 9 < < + < D 7' 96::?, F8>< - ( " # ( ' ! , (2 ' ! - ' (2 % + ( , '9 $ 6::>< ( ' ( # ' < / 97AAA,8< (" + + ' $ $ < $ % & ( ' ... ] R V 2` /\( U ] KL Y , ( d " % ( * & O Z ' ] A LR K [ ^ M _ W V _ a P 6@MFM7AA>< P' / & ( ' - " * 4- & ' ( ' & * , - , 9& b !* D 6::8, ?;6< * ( ' ! / & ( ' % 52 " )& )& )& )& )& )& 2 k l Qm...
- 44
- 1,200
- 7
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...
- 10
- 647
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... [1 ,25 ] This DNAalkylating reagent binds to the minor groove of doublestranded DNA and then alkylates guanines at position N2 [26 ], favouring guanines flanked by purines [27 29 ] The covalent attachment ... detection of q° clones was not due to recovery and expansion of a residual population of nonalkylated mtDNA on removal 28 34 A M James et al (Eur J Biochem 27 0) of mitoDC-81 as a bulk culture of 143B ... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates...
- 10
- 638
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose