10 atopic dermatitis as a model for the consequence of a chronically disturbed barrier
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... pruning may be regarded as the special case of our statistical model, since the maximum-matching algorithm of baseNP rules is only a simplified processing version of our statistical model Compared...
- 8
- 482
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ... suitable for a practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated that in the surf zone, the time scale ...
- 11
- 460
- 0
Báo cáo khoa học: " A predictive model for the level of sIgA based on IgG levels following the oral administration of antigens expressed in Sacchromyces cerevisiae" pdf
... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB( ... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi ... yassa nietorp ACB a gnisu derusaem erew elpmas hcae fo snoitartnecnoc nietorp latoT sisylana tneuqesbus rof Co02− ta derots dna detcelloc erew stnatanrepuS Co4 ta nim 01 rof g 000,21 ta noitagufirtnec...
- 5
- 443
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket ... depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... the gelatin block was evaluated After the centre of the gelatin block had been determined, the mean diameter of the permanent cavity was identified To this end, the length of the permanent cavity...
- 5
- 573
- 0
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... expression of caspase-3 was analyzed by flow cytometry In a limited number of experiments, analyses of specific mRNA of caspase-3 were also performed by reverse transcriptase – polymerase chain reaction ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized...
- 11
- 573
- 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
- 9
- 372
- 0
A model for the prediction of subgrade soil resilient modulus for flexible pavement design
... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... based and will consists of two major tasks Firstly, the collection of necessary data and information was done Most of the data was obtained from the seasonal monitoring program under the Strategic ... of base/subbase, and resilient modulus of the subgrade Among these material properties, those associated with asphalt concrete and subgrades are known to fluctuate seasonally Therefore seasonal...
- 104
- 423
- 0
Designing listening tasks using authentic materials on websites as supplementary materials for the teaching of listening skills
... lessons They also use ready-made tasks if they are suitable to their sts as they said that sometimes they not have time to modify the tasks All of them confirm that they have never assigned the recordings ... CHAPTER 5: CONCLUSION Authentic language can reflect a naturalness of form and an appropriateness of cultural and situational contexts Since authentic texts are generated by and for native speakers ... selecting information tend to be easier than tasks which require separating fact from opinion • Tasks that require information relevant to the main theme tend to be easier than tasks which ask for irrelevant...
- 36
- 1,009
- 5
Báo cáo y học: "In vitro model for the analysis of synovial fibroblast-mediated degradation of intact cartilage" pptx
... 60°C 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG AGCA-3' [GenBank: NM_174112] ... in all cases showing a massively reduced optical contrast of the collagen structures in areas near the cartilage surface (Figure 4k1 to k4) Invasion of synovial fibroblasts into the cartilage ... Human/bovine Aldolase A 5'TCATCCTCTTCCATGAG ACACTCTA-3' 5'ATTCTGCTGGCAGAT ACTGGCATAA-3' [GenBank: NM_000034] 58°C 88°C Human MMP-1 5'GACCTGGAGGAAATCT TGC-3' 5'GTTAGCTTACTGTCACA CGC-3' [GenBank: NM_002421]...
- 20
- 524
- 0
Báo cáo y học: "P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis" ppsx
... MD, Malfait AM, Arner E: The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation Osteoarthritis Cartilage 2001, 9:539-552 Samad TA, Moore KA, Sapirstein ... injectable saline as the vehicle After appropriate anesthesia each rat was positioned on its back and the left leg was flexed 90 degrees at the knee The patellar ligament was palpated below the patella ... animals were disarticulated and the tibial plateau imaged using an Optimas image analyzer The tibial plateau was used for image analysis because it provided a relatively flat surface compared...
- 8
- 461
- 0
Báo cáo y học: " Advantages of the single delay model for the assessment of insulin sensitivity from the intravenous glucose tolerance test" doc
... 160’ and 180’ through the contralateral arm vein Each sample was immediately centrifuged and plasma was separated Plasma glucose was measured by the glucose oxidase method (Beckman Glucose Analyzer ... ranges The facts that this behaviour is the same both for the HOMA and for the newer and more accurate HOMA2, and that the large variability of SI index values would in any case produce lack of ... comparisons and assess coherence among the model derived indices, as the EHC-derived M was not available for most of the evaluated subjects The HOMA insulin resistance index was computed as the...
- 20
- 284
- 0
An asthma allergen specific animal model for the study of responses to dust mite allergen induced asthma
... entirely applicable to asthma induced by these allergens Therefore, there is a need for an asthma model based on real aeroallergens There is a lack of tools to study T cells in allergic asthma inflammation ... be found in the upper layers of the epithelium and lamina propria of the airways These DCs are at an immature state Therefore, at steady state, uptake and presentation of antigen by these DCs would ... secretion as well as mediate the recruitment of other immune cells to the site (40, 51) The proteases in the mast cell granules such as tryptase and chymase may also affect the bronchial epithelium and...
- 254
- 302
- 0
Báo cáo y học: "Chiropractic as spine care: a model for the profession" pptx
... described as the ideology of chiropractic or the hypothesis of chiropractic, rather than as a philosophy This model of chiropractic has continued to advance a hypothetical model of health and disease ... "primary care," and "portal of entry," and that this confusion is at least partially responsible for the enthusiasm for the primary care model The American Chiropractic Association, in fact, ... • Chiropractic as conservative/minimalist healthcare provider • Chiropractic as a fully integrated part of the healthcare system, rather than as an alternative and competing healthcare system...
- 17
- 229
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... (micromolar) affinity As the bioassays on state, whereas [A1 0L]PnIA stabilizes a desensitized state fish and insects as well as intracranial injections into rats which, in the case of the a7 [L247] mutant, ... release in the rat striatum (A) Nicotine acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists ... subunits, an a6 /a3 chimera consisting of the extracellular ligand-binding domain of the a6 subunit and the transmembrane and intracellular domains of the a3 subunit was used in this study PIA selectively...
- 15
- 757
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Improving Recapitalization Planning - Toward a Fleet Management Model for the High-Mobility Multipurpose Wheeled Vehicle ppt
... Recapitalization Planning: Toward a Fleet Management Model for the HMMWV Table 4.1 Fleet Management Model Assumptions in Sensitivity Analyses and Base Case Replace Earlier Base Case Replace Later ... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... “replace-later” case Table 4.1 summarizes our base-case and sensitivity-analysis assumptions The model inputs and our assumptions for each of the three cases are discussed in the sections below As...
- 92
- 499
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae...
- 11
- 501
- 0
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx
... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... approximations as the average area of randomly adsorbed enzymes will be larger than the footprint, and only a certain fraction of the enzyme will be adsorbed in the initial stages Nevertheless, the analysis...
- 14
- 572
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... by an antigen vaccination strategy This has proven efficient in the NOD mouse model, as well as in other murine models of T1D [95-100] The feasibility of translating these therapies to humans ... responsible for a differential glycosylation pattern [24] As such, the presence of a proline rather than a serine at position of the mature IL-2 protein, is associated with an increased glycosylation and...
- 12
- 573
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008