Nghiên cứu tạo chủng vi khuẩn vibrio parahaemolyticus đột biến giảm độc lực nhằm phát triển vắc xin phòng bệnh hoại tử gan thận trên một số loài cá biển tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING HA NOI NATIONAL UNIVERSITY VU THI BICH HUYEN A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus STRAINS AND THEIR POTENTIAL AS LIVE VACCINE CANDIDATES AGAINST NEPHROTIC AND HEPATIC NECROSIS DISEASE IN SOME MARINE FISH Specialized: GENETICS Code: 9.42.01.21 SUMMARY OF BIOLOGICAL THESIS HANOI - 2020 The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology laboratory, Faculty of Biotechnology, Ha Noi Open University Science instructor: Assoc Prof Dr Nguyen Xuan Viet Assoc Prof Dr Pham Thi Tam Critical Reviewer 1: Assoc Prof Dr Khuat Huu Thanh Hanoi University of Science and Technology Critical Reviewer 2: Assoc Prof Dr Nguyen Thi Hong Van VNU University of Science - Vietnam National University, Hanoi Critical Reviewer 3: Assoc Prof Dr Duong Minh Lam Hanoi National University of Education The thesis will be presented before Assessment Council in Hanoi National University of Education at ………………………… The thesis can be found at the National Library, Hanoi or Library of Hanoi National University of Education PUBLISHED BY AUTHOR The articles were published Cao Thi Thanh Huong, Pham Thi Tam, Nguyen Manh Hung, Nguyen Xuan Viet, Vu Thi Bich Huyen (2015) The characteristics of Vibrio parahaemolyticus isolated from fish have hepatic and kidney necrosis Science and Technology Journal of Agriculture & Rural Development 8/2015: 72-78, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thị Tam, Man Hong Phuoc, Nguyen Dang Quang, Do Thanh Van, Dang Thi Hong Tham (2018) A study on creating an attenuated Vibrio parahaemolyticus mutant strain by treatment with rifampicin The 3nd National Scientific Conference on Biological Research and Teaching in Vietnam at Quy Nhon, Viet Nam 20th May: 1156 -1163, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Dang Thi Hong Tham, Man Hong Phuoc, Pham Thi Tam (2018) Assessment of stability and immunization response of Vibrio parahaemolyticus L4650 attenuated strain to support vaccine production against hepatic and kidney necrosis disease for marine fish, Science and Technology Journal of Agriculture & Rural Development 21/2018: 79-85, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Huynh Viet Tung, Pham Thi Tam, man Hong Phuoc (2019) Biochemical characteristics and genetics of Vibrio parahaemolyticus strains caused hepatic necrosis disease for groupers in Cat Ba, Hai Phong Veterinary Science and Techniques Journal Vol 26 No.7/2019: 62-73, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thi Tam, Man Hong Phuoc, Huynh Viet Tung, Nguyen Dang Quang, Do Thanh Van (2020) Development of attenuated Vibrio parahaemolyticus mutant strains as potential live vaccines Asia Pacific Journal of Molecular Biology and Biotechnology 28(1): 52-67 Sequences were published in NCBI: - Gen toxR of A3.3 strain with accession number MH047286 - Gen tlh of A3.3 strain with accession number MH047289 International Conference Vu Thi Bich Huyen, Chu Dinh Toi, Nguyen Xuan Viet, Man Hong Phuoc, Pham Thi Tam (2019) Isolation and evaluation the potential as live attenuated vaccine candidate of rifampicin-resistant Vibrio parahaemolyticus strains 2019 International Academic Conference for Graduate Student of Nanjing Agricultural University in October 2019, Nanjing, China INTRODUCTION Reason to choose the topic With the advantage of a long coastline (3,260 km) stretching from North to South, the potential for aquaculture development is huge According to the General Statistics Office, in 2018 the GDP of the whole fishery reached 190.123 billion VND, accounting for 3.43% of the whole economy and 23.57% of the whole agriculture sector, an increase of 6.46% compared to 2017, reaching the highest growth rate in agriculture, contributing 0.22 points to the overall growth of agriculture and the whole country [187] However, the aquaculture industry in Vietnam as well as in the world always faces difficulties and challenges, especially the losses caused by diseases According to the Food and Agriculture Organization of the United Nations (FAO), the diseases costs the global aquaculture industry more than USD billion a year, occurring in most developing countries In Vietnam, it is estimated that each year the seafood industry has lost nearly USD billion due to the disease [22] Hepatic and kidney necrosis disease in fish detected in 14 countries, in 48 species of fish, is known to be caused by the bacterium Vibrio parahaemolyticus [112] Diseased fish have symptoms such as red spots, skin sores, flakes, truncated fins, hemorrhagic organs, especially in liver and kidney, diseased fish can die in series, the death rate is up to 90% [112, 138] V parahaemolyticus causes massive liver necrosis and mortality in large numbers for fish annually reported in Quang Ninh, Hai Phong, Quang Ngai, Phu Yen, Khanh Hoa, Ba Ria-Vung Tau provinces [184, 185, 186] Until now, to control and to treat nephrotic and kidney necrosis disease for fish, farmers has mainly used antibiotics to kill V parahaemolyticus [34, 61] However, use regularly and no strict control of antibiotics have led to the resistance development in many bacterial strains [26] and accumulation of residual antibiotics in fish tissue, which is food for human [107] Therefore, vaccination is an effective disease control method to reduce using antibiotic in aquaculture Bacterial vaccines for fish include inactivated vaccines, live attenuated vaccines, recombinant vaccines, sub-unit vaccines, DNA vaccines [125] Most of the commercially available bacterial vaccines for fish in the world are inactivated vaccine because of their high safety However, the inactivated vaccine is considered to have a short protection period [152] Although there have been a few studies on making inactivated, recombinant or DNA vaccines to prevent the disease caused by V parahaemolyticus in fish has been published, but so far such vaccines are licensed for commercial use in fishes A attenuated vaccine using a attenuated bacterium is a promising research path for commercial production of fish vaccines due to its high relative survival percent and long protection periods Creating a strain of V parahaemolyticus that has the ability to cause an immune response in fish is important and decisive for the success or failure of developing a attenuated vaccine Therefore, the study of creating a attenuated strain for the production of attenuated vaccine to prevent necrosis of the liver and kidney is very necessary Therefore, the study of creating a attenuated strain for the production of attenuated vaccine to prevent necrosis of the liver and kidney is very necessary, consistent with the trend and offers a high potential for prevention nephrotic and kidney necrosis disease Based on the theoretical and practical basis, the project: “A study on creating of attenuated mutant Vibrio parahaemolyticus strains and their potential as live vaccine candidate against nephrotic and hepatic necrosis disease in some marine fish” has been carried out Objectives 2.1 General objectives Creating of attenuated mutant Vibrio parahaemolyticus strains causing immune response for fish to develop production of vaccines against nephrotic and hepatic necrosis disease for some marine fish 2.2 Specific objectives - Isolate attenuated strains of V parahaemolyticus from the bacterial virulence strains isolated causing nephrotic and hepatic necrosis disease by treating with rifampicin - Determine nucleotide sequence changes in genes that encode virulence proteins (tdh, trh, tlh, toxR) and rpoB genes in Vibrio attenuated strains - Determine the protection ability of the attenuated bacteria strain selected Research content - Isolation and identification of strains of V parahaemolyticus from a marine fish suffering from nephrotic liver and kidney disease cultured in the Northern Viet Nam - Isolation attenuated strains of V parahaemolyticus from pathogenic wild-type strains by treatment rifampicin and analyzing nucleotide sequence changes in genes (toxR, tdh, trh, tlh rpoB) of attenuated strains compareing wild-type strains - Evaluation of the ability to create an immune response of the potential attenuated mutant strain in orange-spotted grouper (Epinephelus coioides) and selection V parahaemolyticus attenuated strains to be vaccine candidate Objects Strains of V parahaemolyticus cause hepatic and kidney necrosis disease for marine fish The research scopes Strains of V parahaemolyticus bacteria isolated from marine fish farmed around Cat Ba island, Lan Ha bay, Cat Hai (Hai Phong); Dong Chau sea area (Thai Binh); Hai Thinh sea (Nam Dinh) and the attenuated mutant lines were isolated The scientific and practical significance of the topic Scientific significance Provide a database of pathogenic V.parahaemotycus isolates for fish cultured in the Northern Viet nam for morphological, biochemical and antibiotic resistance characteristics Detecting mutations in the virulence gene and ropB gene of rifampicn-resistant V parahaemolyticus strains are of scientific significance for the direction of further studies for the development of live attenuated vaccines used in preventing diseases for cultured marine fish The results of evaluating the protection ability of attenuated V parahaemolyticus strain in orange-spotted grouper is the scientific basis for immunological research for marine fish 6.2 Practical significance The mutant strain of V parahaemolyticus, which has the potential to cause a protective immune response, offers the prospect of producing vaccines against hepatic and kidney necrosis disease for orange-spotted grouper as well as some other marine fish New contributions of the thesis - The thesis is one of the first studies on creating attenuated V parahaemolyticus strains by treatment with rifampicin, to support the production of vaccines against hepatic and kidney necrosis disease in marine fish - Analysis the difference in nucleotide sequence in virulence tlh genes and rpoB genes of attenuated strains comparing wild-type strains provided the genetic basis for the relationship between mutation changes in these genes and attenuation of strains V paraheamolitycus - Selection V paraheamolitycus L4650 strain being potential vaccine candidate for development live attenuated vaccine for hepatic and kidney necrosis disease in marine fish The L4650 strain was stable virulence level, the survival rate of orange-spotted grouper (Epinephelus coioides) injected with a dose of 100 µl/fish, 105 CFU/ml reached 100% The relative percent survival (RPS) of groupers vaccinated L4650 reaches 96.91 - 100% after 15 days post-vaccination; 93.33 - 100% after months post-vaccination, Location and study time Location: The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology laboratory, Facultof Biotechnology, Ha Noi Open University Study time: from 11/2014 to 4/2019 CHAPTER I: OVERVIEW OF RESEARCH 1.1 Overview of Vibrio parahaemolyticus cause hepatic and kidney necrosis disease in marine fish 1.1.1 Morphological, biochemical and growth characteristics of Vibrio 1.1.2 Genome of V parahaemolyticus 1.1.3 Virulence and genes regulating haemolysin tvirulence There are three haemolysin protein: TDH (thermostable direct haemolysin), TRH (TDH-related haemolysin) and TLH (thermolabile haemolysin) are encoded by tdh, trh and tlh genes, respectively The toxR gen is in the toxRS operon (Vp-toxRS), encodes for regulatory proteins that play an essential role in regulating the survival and virulence of bacteria 1.1.4 The rpoB gene and resistance to rifampicin The rpoB gene coding for b-subunit of RNA polymerase that related to Rifampicin resistance Rifampicin is a broad-spectrum antibiotic that can hinder DNA-directed RNA polymerase, and thereby, blocking the initiation of transcription and killing bacterium 1.1.5 Antigen of Vibrio parahaemolyticus 1.2 Hepatic and kidney necrosis disease in marine fish 1.2.1 Symptom 1.2.2 Diagnosis and treatment 1.3 Vaccines and active immune mechanism 1.3.1 Vaccines and vaccine types for fish 1.3.2 Specific immunity in bone fish 1.3.3 Fish vaccine delivery 1.4 Study on creating attenuated strains for production of attenuated vaccines against hepatic and kidney necrosis disease 1.4.1 Creating attenuated strains with physical agents 1.4.2 Creating attenuated strains with chemical agents 1.4.3 Creating attenuated strains by genetic engineering 1.5 Research situation on vaccine production to prevent hepatic and kidney necrosis disease in fish 1.5.1 Research situation in the world 1.5.2 Research situation in Vietnam Currently, studies to create vaccines against V parahaemolyticus are focusing on inactivated and recombinant vaccines with the outer membrane proteins and DNA vaccines However, commercially licensed vaccines against V parahaemolyticus are not available for fish, including the attenuated vaccines for hepatic and kidney necrosis disease in fish In this study, we created attenuated strain and assessed the potential of the strain to select several strains to use as a material for the production of attenuated vaccines against V parahaemolyticus CHAPTER II: OBJECTS, MATERIALS AND RESEARCH METHODS 2.1 Objects and materials 2.1.1 Objects V parahaemolyticus causes hepatic and kidney necrosis disease in marine fishes 2.1.2 Materials 2.1.2.1 Diseased fish Marine fish (grouper, snapper, seabass, cobia ) have symptoms hepatic and kidney necrosis disease collected in aquaculture areas in Cat Ba Island, Lan Ha Bay, Cat Hai (Hai Phong); Đồng Chau (Thai Binh); Hai Thinh (Nam Dinh)… 2.1.2.2 Experimental fish Zebrafish (Danio rerio) length - 3,5 cm and tilapia (Oreochromis niloticus) length - 6,5 cm from Research Institute for Aquaculture No1 (Tu Son, Bac Ninh) Orange spotted grouper (Epinephelus coioides) length 5,5 - cm from Aquatic Breeding Center Hai Phong 2.1.2.3 Bacteria: The type strain V parahaemolyticus VTCC 12233 purchased from the Institute of Microbiology and Biotechnology, Vietnam National University, Hanoi, Vietnam was included as a control 2.1.2.4 Chemicals 2.1.2.5 Equipment 2.2 Research methods 2.2.1 Diagram of the main steps Disease marine fishes Isolation V parahaemolyticus strains isolated Inject into orange-spotted grouper Treatment of rifampicin from 10 to 250 μg/ml Rifampicin-resistant V parahaemolyticus strains Assessment, selection Attenuated strains of V parahaemolyticus Selecte potential attenuated strain Evaluation of stability, ability to create immune response of potential attenuated strains Figure 2.1 Diagram of the main steps 2.2.2 Method of isolating Vibrio strain from suspected infected fish The liver, kidneys, skin, fins of suspected disease fish are crushed in 1.5% saline solution, dilute this solution, and spread evenly over the surface of the TCBS medium Select colonies with morphology: round, glossy, convex, dark green on TCBS medium 2.2.3 The method to hold bacterial strains 2.2.4 Gram stain method 2.2.5 Method for determining the growth of bacteria 2.2.6 Methods of assessing biochemical characteristics and antibiotic resistance characteristics of strains (a) Assessing biochemical characteristics: fermentation, indole production, catalase generation, mobility, gas production and H2S generation and haematopoietic capacity (b) Antibiotic resistance characteristics: with ampicillin (25 µg), gentamycin (30 µg), norfloxacin (10 µg), enrofloxacin (5 µg) erythromycin (15 µg) 2.2.7 Methods of assessing virulence of isolated strains Groupers are injected with the V parahaemolyticus isolates Determine survival rates of fish 2.2.8 Method of treating bacteria with rifampicin Bacterial culture on rifampicin-containing media with increasing rifampicin concentration from 10 to 250 µg/ml Selection rifampicin-resistant strains 2.2.9 Methods of assessing virulence of rifampicin-resistant strains (a) Survival rate of fish after infection: Rifampicin-resistant bacteria strains were evaluated for virulence by bacterial infection on zebrafish and tilapia Determine survival rate of fish after infection (b) LD50 value 2.2.10 Molecular biology methods 2.2.10.1 Primer design method Using CLC Genomics Workbench 8.5 (QIAGEN Bioinformatics) to design primar for toxR, tdh, trh, tlh genes of V parahaemolyticus 2.2.10.2 Methods of total DNA extraction: Total DNA was extracted by i-genomic BYF DNA Extraction Mini kit (iNtRON, Korea) 2.2.10.3 PCR, sequencing and analyzing sequences of virulence and rpoB genes (a) PCR to amplify virulence genes and rpoB gene Bảng 2.1: Sequence and characteristics of primers used in PCR Genes Primer target toxR-4 toxR toxR-7 toxR2 toxR toxR4 tlhF tlh tlhR tlh1 tlh tlh3 tdhF tdh tdhR tdh1 tdh tdh2 trhF trh trhR trh1 trh trh2 Primer sequence (5’ – 3’) GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG ACTCTACCCCCCTAAAAGCA CTGCCCCAGTACAACCAACC AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGCG TGTCGTGGCCATTTTGCTT CCGTGATGCCAAAATCAAAA GTAAAGGTCTCTGACTTTTGGAC TGGAATAGAACCTTCATCTTCACC ACTGGACTGTGGTTGGT CCTCGAATTACGCAACAA TTGGCTTCGATATTTTCAGTATCT TTGGCTTCGATATTTTCAGTATCT TCGCATTTTTTCACCATTCCC TAAGTTCACGCATTGAG Tm (℃) 54,1 55,0 55,5 58,5 58,0 56,1 55,7 52,0 53,3 54,5 56,7 50,3 52,2 52,8 54,2 49,6 1110F GTAGAAATCTACCGCATGATG 54,1 CM32b CGGAACGGCCTGACGTTGCAT 53,3 rpoB Size of products (bp) Source 368 Kim Y.B et al (1999) 1070 In this study 450 Bej A.K et al (1999) 1484 In this study 269 Bej A.K et al (1999) 865 In this study 500 Bej A.K et al (1999) 772 In this study 984 Tarr C.L et al (2007) Mollet C et al (1997) (b) Sequencing method: PCR products sent for sequencing at First BASE Laboratories, Malaysia 2.2.11 Bioinformatics method: Results of gene sequencing were analyzed with software BLAST (https://blast.ncbi.nlm.nih.gov/Blast) CLC Genomics Workbench 8.5 Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) Swiss model (https://swissmodel.expasy.org/interactive) 2.2.12 Methods for evaluating virulence stability and the safety of attenuated strain in orange-spotted grouper (a) Evaluating virulence stability of attenuated strain (b) Evaluating the safety of attenuated strain 2.2.13 Method of evaluating the immune response of the attenuated strain on groupers (a) Assessing the immune response to fish Relative survival percent (RPS) is calculated by the formula of Amend (1981) RPS (%) = [1-(% dead vaccinated fish /% dead control fish)] x 100 (b) Evaluate immune length: assess relative survival percent of fish after 1, 2, 4, and months of vaccination 2.2.14 Data processing methods Data were processed statistically in Excel and Stata 2.0 software 10 Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH334; LBT6; M: Marker 100 bp Figure 3.8 The PCR product (450 bp) of tlh gene of 11 isolates Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6; M: Marker 100 bp, M1: Marker kb 3.1.4 Evaluation of pathogenicity of V parahaemolyticus strains to grouper Observing the symptoms of infected fish and recording the survival rate of the groupers after 14 days of injection with V parahaemolyticus strains isolated showed that: 100% of the infected fish manifested hemorrhagic symptoms, hemorrhagic fin, flake of fish scales, skin ulcer, the muscular area around the injection site and skin are darker, severe necrosis of the liver and kidney The survival rate of grouper after 14 days of infection (Table 3.5) ranged from 2,22% to 22,22%, of which, fish injected with B5M3 and N9.2 strains had the lowest (2,22%) survival rate Thehighest survival rate recorded in fish infected with the B13M1 strain (22,22%) These rates in fishes infected with LBT6, B3.13, A3.3, B5M2, B5M4 strains were 13,33%; 6,67%; 10%; 18,9%; 18,9%, respectively The survival rate 16,67% was observed in fish infected with one of three strains of bacteria B20M2, N13.1.1, HH3-34 High mortality rates was in the first week, especially on day to day after infection In the following week, the mortality rate was lower and the change range of this rate was less among days Anatomy and observation the internal organs of the fish showed severe necrosis in the liver and kidney Isolation bacteria from dead fishes on TCBS medium determmined 30/30 (100%) diseased fish samples detected with bacteria having characteristics of V parahaemolyticus: colonies were dark green , glossy surface, round shape, Gram-negative bacteria Especially, groupers infected with LBT6, A3.3 and B3.13 had the seriously damaged phenomenon in liver and kidney, decomposed Based on the results of the virulence assessment of the isolated V parahaemolyticus strains, disease symptoms of fish, we selected 3/7 strains of highly virulent bacteria, including LBT6, A3.3 and B3.13, and be used these strains to select and create mutation strains 11 Table 3.5 Survival rate (%) of groupers infected with 11 strains Strains LBT6 B3.13 A3.3 B5M2 B5M3 B5M4 B13M1 B20M2 N9.2 N13.1.1 HH3-34 PBS Day Day Survival rate of fish after infection (%) Day Day Day Day 11 Day 13 Day 14 82,22 ± 1,25 81,11 ± 1,70 78,89 ± 0,67 85,56 ± 0,47 55,56 ± 0,47 74,44 ± 1,25 82,22 ± 0,82 71,11 ± 0,47 55,56 ± 0,47 60,00 ± 1,41 62,22 ± 0,94 100 55,56 ± 0,47 53,33 ± 1,24 70,00 ± 0,00 67,78 ± 0,47 27,78 ± 0,82 47,78 ± 0,47 55,56 ± 0,47 55,56 ± 2,05 45,56 ± 0,47 48,89 ± 1,25 48,89 ± 1,25 100 28,89 ± 0,47 35,56 ± 0,47 48,89 ± 0,47 45,56 ± 0,47 17,78 ± 0,47 38,89 ± 0,94 35,56 ± 1,25 44,44 ± 2,05 35,56 ± 0,47 30,00 ± 0,82 28,89 ± 0,47 100 13,33 ± 0,82 6,67 ± 0,00 11,11 ± 0,00 18,89 ± 0,47 2,22 ± 0,47 18,89 ± 0,47 22,22 ± 0,47 16,67 ± 0,00 2,22 ± 0,47 17,78 ± 0,47 20,00 ± 1,25 100 13,33ab ± 0,47 6,67ab ± 0,00 10,00ab ± 0,00 18,89b ± 0,47 2,22a ± 0,47 18,89b ± 0,47 22,22b ± 0,47 16,67ab ± 0,00 2,22a ± 0,47 16,67ab ± 0,00 20,00b ± 1,41 100c 17,78 ± 0,47 14,44 ± 0,47 31,11 ± 0,47 33,33 ± 0,00 8,89 ± 0,47 26,67 ± 0,82 25,56 ± 0,47 30,00 ± 1,63 13,33 ± 0,82 23,33 ± 1,41 23,33 ± 0,82 100 13,33 ± 0,00 7,78 ± 0,47 13,33 ± 0,47 22,22 ± 1,25 4,44 ± 0,00 20,00 ± 0,0 24,44 ± 0,47 21,11 ± 0,47 4,44 ± 0,47 18,89 ± 0,94 21,11 ± 1,63 100 14,44 ± 0,47 6,67 ± 0,00 11,11 ± 0,47 20,00 ± 0,82 2,22 ± 0,47 18,89 ± 0,47 22,22 ± 0,47 18,89 ± 0,47 2,22 ± 0,47 17,78 ± 0,47 20,00 ± 1,41 100 Figure 3.9 Grouper died after days post-infection with LBT6 (A) and after days postinfection with LBT6 with seriously visceral damage (B) 3.1.5 Isolation and sequencing of toxR, tlh genes and rpoB gene of isolated bacteria strains (a) Determine the full-length sequence of toxR and tlh genes toxR gene Using toxR2-toxR4 primers, which was designed in this study basing on the sequence of V parahaemolyticus in NCBI, amplify PCR products which had size of ~1000 bp (Figure 3.10) and been sequenced in Malaysia This sequences of the three 12 strains were analyzed by BLAST The similarity of these gene sequences of 03 bacterial strains isolated from the sequences announced on Genbank is 99% The toxR2-toxR4 primer pair designed in this study is specific Figure 3.10 The electrophoresis of the PCR product with toxR2-toxR4 primers of strains Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6; M: Marker kb Analysis complete genome of V parahaemolyticus has been published shows that the full-length gene sequence of toxR gene is 879 bp and the 368 bp sequence published in the previous report is just a segment of full-length gene (Figure 3.11) With the toxR2-toxR4 primer, we amplified the PCR product with ~1000 bp size Hình 3.11 Comparing two sequences of toxR gene of LBT6 strain amplified by two pairs of toxR2toxR4 primers (LBT6-toxR-seqA) and toxR-4, toxR-7 (LBT6-toxR-seqB) Analysis of length, coverage of toxR sequence of LBT6 as well as the remaining strains (B3.13; A3.3) with these gene sequences in NCBI showed in Figure 3.12 The 879 bp sequence is the full-lenghth of toxR gene, from the ATG code to TAA code The toxR gene sequence of the A3.3 strain was registered on NCBI with accession number MH047286 The polypeptide sequences deduced from the full-length toxR sequence includes 292 amino acids 13 Figure 3.12 Diagram illustrating sequences of toxR gene sequences of V parahaemolyticus strains on NCBI with corresponding sequences on full-length toxR gene of BLT6/A3.3/B3.13 strains (A) Full-length toxR gene of A3.3/LBT6/B3.13 strain were amplified by toxR2-toxR4 primers; (B) toxR toxS gene fragments of KP34 strain with accession number DQ845170.1 and toxR gene fragments of (C) CECT611 strain with accession number FM202714.1, (D) ATCC 17802 strain with accession number GQ228073.1 [154], (E) C1 strain with accession number JQ929913.1 A3.3/B3.13/LBT6 strains were amplified by toxR-4, toxR-7 primers tlh gene PCR products of tlh gene in bacterial strains were 1500 bp (Figure 3.13) Analysis of the tlh sequence (1254 bp) of LBT6 strain amplified by primers tlh1-tlh3 It had high proportion of similarity (99%) with the sequences of V parahaemolyticus in NCBI The tlh gene sequences which previously published by other authors cover only part of full-length gene (Figure 3.15) The 1254 bp sequence is the full-lenghth of tlh gene, from the ATG code to TAA code The tlh gene of strain A3.3 has been registered on Genbank with accession number MH047289 The polypeptide sequences deduced from the full-length tlh sequence includes 417 amino acids Figure 3.13 The electrophoresis of the tlh gene PCR product (~1500 bp) with tlh1-tlh3 primer of strains Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6; M: Marker kb 14 Figure 3.15 Diagram illustrating of tlh gene sequences of V parahaemolyticus strains on NCBI with corresponding sequences on full-length tlh gene of BLT6/A3.3/B3.13 strains (A) Full-length tlh gene of A3.3/LBT6/B3.13 strains were amplified by tlh1-tlh3 primers and tlh gene fragments of (B) C1 strain with accession number JQ929914.1 and A3.3/B3.13/LBT6 strains were amplified by tlhF-tlhR (C) VP strain with accession number AY829372.1 (D) KVp5 strain with accession number HM195239.1 (b) Determine the rpoB gene sequence of isolated strains The gene rpoB encodes the subunit β of the RNA polymerase enzyme with a size of 4029 bp Using primers 1110F and CM32b amplified a rpoB sequence with PCR product size ~984 bp in 11 bacterial strains and VTCC12233 strain (Figure 3.16) These sequences were analyzed with the BLAST tool at 99% similarity with V parahaemolyticus strains in NCBI PCR products of B3.13; A3.3 and LBT6 strains were sequenced from the nucleotide site 1121 to 2050 of full-length gene sequence Figure 3.16 The electrophoresis of PCR product (~984 bp) rpoB gene with primers 1110F and CM32b of strains Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6; M: Marker kb 3.2 Creating attenuated V parahaemolyticus strains 3.2.1 Assessment of the rifampicin-resistant strains Three strains (LBT6, A3.3 and B3.13) was wild-type strains because they are isolated from diseased fish tissue They were cultured and selected in BHI and TCBS agar media supplemented with increasing rifampicin concentration up to 250 µg/ml In total, 13 strains 15 Survival rate of fish (%) of rifampicin-resistant bacteria were selected from three wild-type strains: strains were selected from wild-type A3.3 strain (symbol A400, A500 and A650); 06 strains (L1380, L2100, L3600, L3900, L4200, L4650) from wild-type LBT6 strain and strains (B7900, B7050, B5700, B5250) from wild-type B3.13 strain (a) Assessment of the rifampicin-resistant strains A400, A500, A650 strains Three strains of rifampicin-resistant bacteria A400, A500, and A650 were assessed virulence in zebrafish and tilapia 100 90 80 70 60 50 40 30 20 10 A3.3 A650 A500 A400 PBS 12 24 48 96 120 Hours post-infection Figure 3.17 Survival rate of zebrafish after infection with strains derived from A3.3 strain For zebrafish, the results of survival after the infection period are shown in Figure 3.17 The infected zebrafish died due to skin bleeding and ulceration at the site of infection When A3.3 and A500 strains were injected into the zebrafish body, the survival rates of the fish decreased sharply from the period from to 24 hours after injection After 48 hours post-injection, the survival rate of fish was recorded 0% It can be seen that the A500 was not a attenuated strain compared to wild-type A3.3 strain In contrast, the two A650 and A400 strains were evaluated as attenuated strains compared to the wild-type A3.3 strain With A650 strain, the survival rate of fish was 94, 44% at hours post-injection; 77,78% at 24 hours post-injection, and from 24 to 120 hours after injection, there was no dead fish The A400 was a attenuated strain, but its virulence was higher than virulence of the A650, as the survival rate of fish after 120 hours injection was 60% With tilapia, survival rate of fish infected with A650 and A400 after 14 days postinjection were 80% and 63,33%, respectively (Figure 3.19) The survival rate of fish infected with wild-type A3.3 strain and A500 strain is 10% at 14 days after injection Diseased tilapia had an ulcer in infected area, fin, tail, tail and necrosis of kidney, liver Survival rates of control tilapia injected with PBS solution were 100% The result showed that two A650 and A400 strains were the attenuated strains, of which the A650 strain is more attenuated From the results of experiments with both zebrafish and tilapia, it can be concluded that the ifampicin-resistant A650 and A400 strains derived from wild-type A3.3 strain were 16 the attenuated strains And the A650 strains reduced virulence more The A500 strain had the quite high virulence, nearly equivalent to the wild-type A3.3 strain 100 Survival rate of fish (%) 90 80 70 60 A3.3 50 A400 40 A500 A650 30 PBS 20 10 10 11 12 13 14 Days post-infection Figure 3.19 Survival rate of tilapia after infected with strains derived from A3.3 strain The virulence of strains was accurately assessed through LD50 value LD50 value of wild-type A3.3; A650, A500, A400 series and respectively were 104,03; 108,12; 104,06 107,32 CFU/ml This result was consistent with the results of the survival rate of fish after infection with the same concentration between strains The A650 and A400 strains were the two attenuated strains, of which the A650 is the more reduced The A500 series did not significantly change virulence compared to the wild-type A3.3 strain The virulence test of bacterial strains in this study showed similar results both in experiments with zebrafish and tilapia Therefore, it can be said that tilapia – aquatic fish species can become a potential model object for virulence studies of V parahaemolyticus Zebrafish are small in size, so the infection with bacteria into fish body is quite difficult Using large numbers of grouper for a study to identyfy the virulence of many strains of Vibrio under laboratory conditions is even more difficult Since then, in the next experiments on the virulence assessment of bacterial strains, we chose to tilapia to test but not the zebrafish (b) Virulence assessment of L1380, L2100, L3600, L3900, L4200, L4650 strains According to the data in Figure 3.21, the survival rate of tilapia after 14 days injection with L4650 was rated as the highest (85,56%) This ratios in fish injected with L4200, L3900, L3600, LBT6 strains were 62,22%, 54,44%; 17,78%, 8,89%, respectively Thus, rifampicin-resistant strains including L3600, L3900, L4200 and L4650 were attenuated strains In particular, the L4650 strain is the most attenuated strain In contrast, there was no significant difference between the survival rate of the fish injected LBT6 strain compared to this rates in L1380 and L2100 strains These two strains were not attenuated strains 17 100 90 Survival rate of fish (%) 80 70 LBT6 60 L1380 L2100 50 L3600 40 L4200 30 L3900 L4650 20 PBS 10 10 11 12 13 14 Days post-infection Hình 3.21 Survival rate of tilapia infected with strains derived from LBT6 strain LD50 values of BLT6, L4650, L4200, L3900, L3600, L2100, L1380 were 104,09; 108,15; 108,09; 107,22; 105,03; 104,03 104,06 CFU/ml, respectively This result was combined with the result of the survival rate of fish after infection with the same concentration showed that L3600, L3900, L4200, L4650 were the attenuated strains The L1380 and L2100 strains were not attenuated strains The L4200 and L4650 strains were considered to have the strongest attenuated than wild-type strains The L3600 strain was attenuated strain compared with wild-type strains However, level of attenuation of this strain was small, so it was not used for further studies (c) Virulence assessment of bacteria B5250, B7050, B7900, B5700 strains Four rifampicin-resistant strains B5250, B7050, B7900 and B5700 were generated from wild-type strain B3.13 Three strains had reduced virulence: B7050, B7900 and B5700 with survival rate of tilapia after 14 days of infection 46,67%, 35,56% 32,22%, respectively (Figure 3.22) While the survival rate of fish challenged with wild-type B3.13 strain and B5250 strain was very low, only 6,67% 7,78% after 14 days of infection The LD50 valuas of wild-type B3.13, rifampicin-resistant B7900; B7050; B5700; B5250 were 104,03; 106,18; 106,25; 105,06; 104,06 CFU/ml, respectively This result confirms once again that the three strains of bacteria B7050, B7900 and B5700 were the attenuated strain and were selected for further experiments Rifampicin is the agent used in many studies to create attenuated mutant bacterial strains for the production of vaccines against diseases for fish In this study, virulence analysis of rifampicin-resistant strains indicated nine attenuated strains of V parahaemolyticus: L3600, L3900, L4200, L4650, B5700, B7050, B7900, A400, A650 derived from LBT6; B3.13; A3.3 strains However, the degree of attenuation of bacterial strains belonging to different groups was different The selective effect of rifampicin in creating attenuated strains The selective action of rifampicin has caused a certain amount of pressure to change the virulence strain of bacteria And the changing tendency to increase, 18 decrease or maintain the virulence is random 100 Survival rate of fish (%) 90 80 70 B3.13 60 B5250 50 B5700 40 B7050 30 B7900 20 PBS 10 10 11 12 13 14 Days post-infection Hình 3.22 Survival rate of tilapia infected with strains derived from B3.13 strain From these results, it is proposed that a number of potential attenuated strains have a virulence that is significantly reduced compared to wild-type strains, with potential for developing vaccines including L4650, A650, L4200 and A400 strains We continue to select 8/9 attenuated strains (except L3600 strain) to assess biochemical characteristics and detect changes sequence in virulence genes and rpoB genes 3.2.2 Assessment of biochemical characteristics of the attenuated strains Eight strains of attenuated bacterial strains had similar biochemical properties to wildtype strains: indole-producing, catalase-producing, mobile, glucose-fermenting, lactose-free, H2S-producing, non-producing gas 3.2.3 Comparison of toxR, tlh and rpoB sequences genes of attenuated strains and wild-type strains 3.2.3.1 Comparison of toxR and tlh gene sequences of attenuated strain and wild-type strain (a) PCR results The toxR and tlh genes were amplified by two toxR2-toxR4 and tlh1-tlh3 primer pairs of strains including L3900, L4200, L4650, B5700, B7050, B7900, A400, A650 The bands of these products had expected sizes and enough qualified to sequence genes These products were purified and sequenced at First BASE Laboratories, Selangor, Malaysia (b) Results of gene sequence comparison The sequences of toxR and tlh genes from these wild-type strains and eight attenuated strains also were sequenced and compared With toxR gene, the sequences of eight attenuated strains divided by three groups were identical together and similar those of three wild-type strains; whereas with tlh gene, there were some nucleotide changes between attenuated strains and theirs wild-typel strains Mutations were identified by comparing the sequences of tlh gene of the wild-type strain and its attenuated strains (Table 3.12) 19 Table 3.12 Nucleotide changes of the tlh gene sequences of attenuated strains compared to wid-type strains Mutaion Amino Nucleotide Nucleotide sequence acid Deduced amino acid sequence change positon change codon A400, A500, A650 strains 1037 346 G®C Glu ® Asp 1055 352 G®A Ala ® Ala (silent mutation) A400 1096 366 G®A Asp ® Asn 1105 369 T®G Tyr ® Asp 1195 399 G®T Arg ® Leu A650 1033 345 G®A Glu ® Lys 1036 G®A Glu® Asn, resulted frameshift mutation from 346 Deletion 01 nucleotide codon 346 to codon 413, presence of stop 1038 codon in codon 350 (A) insertion 01 nucleotide 1238-1239 413 Ala ® His (A) 1245 415 C ® A Tyr ® Stop codon 1247 G®C 416 Arg ® Pro 1248 T®G 1251 417 C ® T Phe ® Phe (silent mutation) 1252 T®A 418 Stop codon ® Asn 1254 A®T L3900, L4200, L4650 strains 34 12 C®T Leu ® Phe 40 14 C®G Leu ® Val L3900 234 78 C®G Gly ® Gly (silent mutation) 1069 357 T®C Leu ® Leu (silent mutation) 1233 411 C®A Asn ® Lys L4200 Insertion 01 Glu® Ala, resulted frameshift mutation, 1241-1242 414 nucleotide (C) absence of stop codon (codon 418) 16 A®C Thr ® Pro 61 21 G®A Glu ® Lys 234 78 C®T Gly ® Gly (silent mutation) 431 144 A®T Asn ® Ile 468 156 G®A Thr ® Thr (silent mutation) 609 203 T®C Gly ® Gly (silent mutation) 657 219 G®A Gln ® Gln (silent mutation) 846 282 A®G Thr ® Thr (silent mutation) L4650 847 283 C®G Leu ® Val 857 286 C®T Ala ® Val 862 288 A®T Lys ® Stop codon 867 289 G®A Ala ® Ala (silent mutation) 886 296 A®C Thr ® Pro 914 305 C®A Thr ® Glu 988 330 T®C Leu ® Leu (silent mutation) 1006 336 T®C Leu ® Leu (silent mutation) Strain 20 1011 337 1134 378 1140 380 1152 384 1176 392 1239 413 B5700, B7050, B7900 strains B5700 270 90 766 256 B7050 786 262 858 286 B7900 738 246 C®T G®A C®T A®G C®T C®A Phe ® Phe (silent mutation) Ala ® Ala (silent mutation) Ser ® Ser (silent mutation) Lys ® Lys (silent mutation) His ® His (silent mutation) Ala ® Ala (silent mutation) none C®A G®T T®A G®A G®T Phe ® Leu Val ® Phe Asp ® Glu Ala ® Ala (silent mutation) Leu ® Phe (c) Results of constructing TLH protein structure From the sequence of deduced polypeptides, TLH proteins of wild-type strains and attenuated strains were constructed the structures of second-order and third-order by Phyre2 software (http://www.sbg.bio.ic.ac.uk/ phyre2/html /page.cgi? id = index) and Swiss model (https://swissmodel.expasy.org/interactive) The VvPlpA molecular structure (also known as thermolabile hemolysins, TLHs) of Vibrio vulnificus was used as temple Three wild-type A3.3, LBT6 and B3.13 strains had 12 a-helices and 12 β-strands in TLH protein structure Comparing the spatial structure of TLH of two A400, A650 strains and wild-type A3.3 strain showed that some changes: The A400 strains had 11 a- helices and 10 β-strands; the A650 strain lost a-helices at 250-252; 382-384 and 393-407 positions, added one βstrands at 85-86 positions and lost one b-strands at 385-387 positions For the TLH structures of the three atttenuated L3900, L4200, L4650 strains comparing to the wild-type strains showed that: The L3900 strain had 11 a-helices and 13 β-strands; lost one a-helix at 250-252 position; added one β-strands at 85-86 position The L4200 strains added one a-helix L4650 strain had a- helices and 11 β-strand in TLH protein structure The expected TLH structure of TLH was vary greatly from the TLH structure of the wild-type LBT6 (Figure 3.27) Figure 3.27 3D structural model of TLH protein of LBT6 strain (A) and L4650 strain (B) 21 The B7050 strain was the same number of a-helices and β-strand in TLH protein structure compared to wild-type strains However, with the corresponding helical position a in amino acid 250-252 of wild-type strain, the B7050 has a longer helical length from the amino acid position 246-254 which contains the catalytic position Asn247 For B7900 strain, TLH structure had the a-helix number reduced by one a-helix at 250-252 position 3.2.3.2 Comparison of rpoB sequence of wild-type strains with attenuated strains Full-length of rpoB gene of V parahaemolyticus is 4029 bp We used primers 1110F and CM32b to amplify PCR products with bands ~984 bp Then, these were sequenced to nucleotide sequences of rpoB gene region from 1121 to 2050 position (~930 bp) The result comparing the attenuation sequence with wild-type strain was shown in Table 3.13 Table 3.13 Amino acid change in the region of the rpoB gene sequences of attenuated strains with those of wild-type strains Amino acid change A650 Gln513®Pro L4650 Ser387® Asn Glu393®Asp Thr399®Ala Glu412®Asp Gln415®Glu Glu422®Lys Thr423®Glu Ala434®Asp Leu492®Met Val524®Ile Leu558®Val Ala577®Val Phe578®Tyr Asp604®His Nucleotide change Amino acid change Nucleotide change A1538®C G1160®A G1179®C A1195®G, T1197®G A1236®C C1243®G G1264®A A1267®G, C1268®A C1301®A, G1302®T C1474®A G1570®A, A1572®C C1672®G C1730®T T1733®A, T1734®C G1810®C, T1812®C Phe614®Tyr Ala621®Thr Lys622®Asn Asn624®Asp Asp626®Glu Glu632®Asp Ile634®Val Gly643®Ser Glu648®Asp His649®Gln Ala650®Val Ala656®Ser Ile663®Val Ala664®Gly T1841®A G1861®A, T1863®C G1866®C A1870®G T1878®A G1896®C A1900®G, C1902®T G1927®A, T1929®C G1944®C C1947®G C1949®T G1966®T, G1968®C A1987®G C1991®G Thus, based on the results of virulence analysis as well as the point mutations occurring on virulence and rpoB genes, we selected 03 potential virulence strains L4650, A650 and L4200 Based on the results of virulence analysis as well as the point mutations that occur on the tlh and rpoB genes, we selected 03 potential virulence strains L4650, A650 and L4200, of which, the L4650 strain were the most attenuated strain compared to wildtype strain Therefore the L4650 strain was further studied to evaluate the potential of this strain in the development vaccine against V parahaemolyticus 3.3 Evaluating the ability to produce an immune response and the growth of attenuated strain 3.3.1 Evaluate the virulence stability and the growth ability of the attenuated strain Results of evaluating the stability of the attenuation of L4650 strain are shown in table 3.14 22 Table 3.14 Assessment of virulence stability of L4650 bacterial strain Strain/PBS Number of original 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 Time LBT6 L4650 PBS LBT6 L4650 PBS LBT6 L4650 PBS LBT6 L4650 PBS LBT6 L4650 PBS Number of dead fish 18 26 25 26 25 Dead fish ratio (%) 93,33 16,67 0,00 86,66 20,00 0,00 83,33 20,00 0,00 90,00 13,33 0,00 83,33 16,67 0,00 Number of live fish 25 30 24 30 24 30 26 30 25 30 Live fish ratio (%) 6,67 83,33 100,0 13,33 80,00 100,0 16,67 80,00 100,0 10,00 86,67 100,0 13,33 83,33 100,0 Orange spotted grouper infected with L4650 strain had a high survival rate (80% 86.67%) and was stable through experiments, while this ratio of LBT6 wild-type strain was only 6.67 % - 16.67% The V parahaemolyticus L4650 still maintains the attenuation level being stable over time compared to the LBT6 strain The L4650 strain were the most attenuated strain In order to be able to use L4650 as a raw material for live attenuated vaccines, it is necessary to assess the growth of this strain We cultured wild-type LBT6 strain and L4650 strain on BHI medium supplemented with 1.5% NaCl, then evaluated the OD600 value of two bacterial strains at different time intervals from hours to 24 hours The result is shown in Figure 3.31 OD (600 nm) 2.5 1.5 LBT6 L4650 0.5 10 12 14 16 18 20 22 24 Thời gian (giờ) Hình 3.31 Growth curve of two LBT6 and L4650 strains 23 3.3.2 Determine the safety of L4650 strain Experiment to determine LD50 valua by method of infecting LBT6 strain and L4650 strain on orange-spotted grouper based on the method of Reed and Muench (1938) From the recorded data, LD50 values of V parahaemolyticus LBT6 and L4650 strains were respectively 105,155 and 107,155 The L4650 vaccination dose was 105 CFU/ml; 100 µl/fish had 100% survival rate in fish vaccinated This was a safe concentration for vaccination to assess the immune response of L4650 strain on orange-spotted grouper 3.3.3 Evaluate the ability to create immune response of grouper attenuated bacteria for grouper Orange-spotted grouper (E coioides) was vaccinated with V parahaemolyticus L4650 were challenged with wild-type LBT6 strain Experimental results are shown in Tables 3.15 After 15 days of vaccination, the relative percent survivals (RPS) were high from 96.91% to 100% This proves that protective antibodies were created earlier Table 3.15 Immunological response time and relative percent survival of grouper vaccinated L4650 Bacterial Treatment concentration LBT6 5LD50 PBS 10LD50 100LD50 5LD50 L4650 10LD50 100LD50 Dead fish ratio (%) after 15 dpv* 76,67a ± 1,01 87,67a,b ± 2,43 96,67b ± 1,27 0,00c ± 0,0 1,67c ± 0,02 3,45c ± 0,04 60 dpv* 76,69a ± 1,1 89,67a,b ± 2,23 97,33b ± 1,29 0,0c ± 0,0 1,89c ± 0,03 3,67c ± 0,03 RPS (%) after 15 dpv* 60 dpv* 100,0d ± 0,00 98,10d ± 2,71 96,91d ± 2,03 100d ± 0,0 97,03d ± 2,32 96,27 d± 2,12 Fish mortality (%), RPS (%) for each dose and challenge duration were compared; Values with different letters indicate significant differences at P