Nghiên cứu tạo chủng vi khuẩn vibrio parahaemolyticus đột biến giảm độc lực nhằm phát triển vắc xin phòng bệnh hoại tử gan thận trên một số loài cá biển tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING HA NOI NATIONAL UNIVERSITY VU THI BICH HUYEN A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus STRAINS TO DEVELOP LIVE ATTENUATED VACCINE AGAINST HEPATIC AND KIDNEY NECROSIS DISEASE IN SOME MARINE FISH Specialized: GENETICS Code: 9.42.01.21 SUMMARY OF BIOLOGICAL THESIS HANOI - 2020 The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology Laboratory, Faculty of Biotechnology, Ha Noi Open University Science instructor: Assoc Prof Dr Nguyen Xuan Viet Assoc Prof Dr Pham Thi Tam Critical Reviewer 1: Assoc Prof Dr Khuat Huu Thanh Hanoi University of Science and Technology Critical Reviewer 2: Assoc Prof Dr Nguyen Thi Hong Van VNU University of Science - Vietnam National University, Hanoi Critical Reviewer 3: Assoc Prof Dr Duong Minh Lam Hanoi National University of Education The thesis will be presented before Assessment Council in Hanoi National University of Education at ………………………… The thesis can be found at the National Library, Hanoi or Library of Hanoi National University of Education PUBLISHED BY AUTHOR The articles were published Cao Thi Thanh Huong, Pham Thi Tam, Nguyen Manh Hung, Nguyen Xuan Viet, Vu Thi Bich Huyen (2015) The characteristics of Vibrio parahaemolyticus isolated from fish have hepatic and kidney necrosis Science and Technology Journal of Agriculture & Rural Development 8/2015: 72-78, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thị Tam, Man Hong Phuoc, Nguyen Dang Quang, Do Thanh Van, Dang Thi Hong Tham (2018) A study on creating an attenuated Vibrio parahaemolyticus mutant strain by treatment with rifampicin The 3nd National Scientific Conference on Biological Research and Teaching in Vietnam at Quy Nhon, Viet Nam 20th May: 1156 -1163, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Dang Thi Hong Tham, Man Hong Phuoc, Pham Thi Tam (2018) Assessment of stability and immunization response of Vibrio parahaemolyticus L4650 attenuated strain to support vaccine production against hepatic and kidney necrosis disease for marine fish, Science and Technology Journal of Agriculture & Rural Development 21/2018: 79-85, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Huynh Viet Tung, Pham Thi Tam, man Hong Phuoc (2019) Biochemical characteristics and genetics of Vibrio parahaemolyticus strains caused hepatic necrosis disease for groupers in Cat Ba, Hai Phong Veterinary Science and Techniques Journal Vol 26 No.7/2019: 62-73, in Vietnamese Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thi Tam, Man Hong Phuoc, Huynh Viet Tung, Nguyen Dang Quang, Do Thanh Van (2020) Development of attenuated Vibrio parahaemolyticus mutant strains as potential live vaccines Asia Pacific Journal of Molecular Biology and Biotechnology 28(1): 52-67 Sequences were published in NCBI: - Gen toxR of A3.3 strain with accession number MH047286 - Gen tlh of A3.3 strain with accession number MH047289 International Conference Vu Thi Bich Huyen, Chu Dinh Toi, Nguyen Xuan Viet, Man Hong Phuoc, Pham Thi Tam (2019) Isolation and evaluation the potential as live attenuated vaccine candidate of rifampicin-resistant Vibrio parahaemolyticus strains 2019 International Academic Conference for Graduate Student of Nanjing Agricultural University in October 2019, Nanjing, China INTRODUCTION Reason to choose the topic With the advantage of a long coastline (3,260 km) stretching from North to South, the potential for aquaculture development of our country is huge According to the General Statistics Office, in 2018 the GDP of the whole fishery reached 190.123 billion VND, accounted for 3.43% of the whole economy and 23.57% of the whole agriculture sector, increased 6.46% compared to 2017, reached the highest growth rate in agriculture, contributed 0.22 percentage points to the overall growth of the country's agricultural sector [187] However, the aquaculture industry in Vietnam as well as in the world always faces difficulties and challenges, especially the losses caused by diseases According to the Food and Agriculture Organization of the United Nations (FAO), diseases that cause global aquaculture losses more than USD billion each year, occur in most developing countries In Vietnam, it is estimated that each year the aquaculture industry has lost nearly USD billion due to the disease [22] Hepatic and kidney necrosis disease in fish was detected in 14 countries, in 48 species of fish, is known to be caused by the bacterium Vibrio parahaemolyticus [112] Diseased fish have symptoms such as red spots, skin sores, flakes, truncated fins, hemorrhagic organs, especially in liver and kidney, diseased fishes can die in mass, with up to 90% mortality [112, 138] V parahaemolyticus caused hepatic and kidney necrosis disease and made high percentage mortality in fish annually reported in Quang Ninh, Hai Phong, Quang Ngai, Phu Yen, Khanh Hoa, Ba Ria-Vung Tau provinces [184, 185, 186] Until now, to control and to treat hepatic and kidney necrosis disease for fish, farmers has mainly used antibiotics to kill V parahaemolyticus [34, 61] However, that using regularly and lack strict control of antibiotics led to the antibiotic resistance in many bacterial strains [26] and accumulation of residual antibiotics in fish tissue, which is food for human [107] Therefore, vaccination for aquatic animals is an effective method to control disease and reduce using antibiotics in aquaculture Bacterial vaccines for fish include inactivated vaccines, live attenuated vaccines, recombinant vaccines, sub-unit vaccines, DNA vaccines [125] Most of the commercially bacterial vaccines for fish in the world are inactivated vaccine because of their high safety However, the inactivated vaccines usually have a short protection period [152] Although there have been a few studies on making inactivated, recombinant or DNA vaccines to prevent the disease caused by V parahaemolyticus in fish has been published So far, no commercially licensed vaccines against bacterium V parahaemolyticus have been used in fish A live attenuated vaccines using a attenuated bacteria are a promising research path for commercial vaccine production for fish with high relative survival percent (RPS) and long protection periods Creating a strain of V parahaemolyticus that has the ability to cause an immune response for fish is important and decisive for the success or failure of developing a live attenuated vaccine Therefore, the study of creating a attenuated strain for the development of live attenuated vaccine to prevent necrosis of the liver and kidney in fish is very necessary and consistent with the trend and offers a high potential for prevention hepatic and kidney necrosis disease Based on the theoretical and practical basis, the project: “A study on creating of attenuated mutant Vibrio parahaemolyticus strains to develop live atttenuated vaccine against hepatic and kidney necrosis disease in some marine fish” has been carried out Objectives 2.1 General objectives Create attenuated mutant Vibrio parahaemolyticus strains causing immune response for fish to use as candidate of live atttenuated vaccines to prevent hepatic and kidney necrosis disease for some cultured marine fish in cage farms 2.2 Specific objectives - Create attenuated strains of V parahaemolyticus from the virulent wild-type strains causing hepatic and kindey necrosis disease by treating with rifampicin - Determine nucleotide sequence changes in genes that encode virulence proteins (tdh, trh, tlh, toxR) and rpoB genes in Vibrio attenuated strains - Determine the protection ability for fish of the attenuated bacteria strain Research content - Isolation and identification of V parahaemolyticus strains causing hepatic and kidney necrosis disease for some cultured fish (grouper, snapper, cobia) in sea areas the Northern Viet Nam - Creating attenuated strains of V parahaemolyticus from virulent wild-type strains by treatment rifampicin and analyzing nucleotide sequence changes in genes (toxR, tdh, trh, tlh rpoB) of attenuated strains compare to wild-type strains - Evaluation of the ability to create an immune response of the potential attenuated mutant strain in orange-spotted grouper (Epinephelus coioides) and selection V parahaemolyticus attenuated strains to be vaccine candidate to prevent hepatic and kidney necrosis disease for some cultured marine fish Objects Strains of V parahaemolyticus cause hepatic and kidney necrosis disease for marine fish The research scopes Strains of V parahaemolyticus bacteria isolated from marine fish farmed around Cat Ba island, Lan Ha bay, Cat Hai (Hai Phong); Dong Chau sea areas (Thai Binh); Hai Thinh sea (Nam Dinh) and the attenuated strains were selected The scientific and practical significance of the topic Scientific significance Thesis provide a database of pathogenic V.parahaemotycus causing hepatic and kidney necrosis disease for cultured marine fish in some sea areas in the Northern Viet nam for morphological, biochemical and antibiotic resistance characteristics Detecting mutations in the virulence gene and ropB gene of rifampicn-resistant attenuated V parahaemolyticus strains was of scientific significance for the direction of further studies to develop live attenuated vaccines to prevente diseases for cultured marine fish The results of evaluating the protection ability of attenuated V parahaemolyticus strain in orange-spotted grouper is the scientific basis for immunological research for marine fish 6.2 Practical significance The mutant attenuated V parahaemolyticus strain causing a protective immune response will a potential candidate for vaccine development against hepatic and kidney necrosis disease for orange-spotted grouper as well as some other marine fish New contributions of the thesis The thesis is one of the first studies on creating attenuated V parahaemolyticus strains by treatment with rifampicin as potential vaccine candidate against hepatic and kidney necrosis disease in marine fish The full-length tlh gene was amplified in the first time by PCR Detecting differences in nucleotide sequences in virulence tlh genes and rpoB genes of attenuated strains compared to wild-type strains provided the genetic basis for the relationship between mutation changes in these genes and attenuation of strains V parahaemolyticus Selecting V paraheamolitycus L4650 strain being potential vaccine candidate for development live attenuated vaccine for hepatic and kidney necrosis disease in marine fish The L4650 strain was stable virulence level, the survival rate of orange-spotted grouper (Epinephelus coioides) injected with a dose of 100 µl/fish, 105 CFU/ml reached 100% The relative percent survival (RPS) of L4650 vaccinated groupers reached 96.91 - 100% after 15 days post-vaccination; 93.33 - 100% after months post-vaccination Location and study time Location: The project was completed at: Department of Genetics - Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology Laboratory, Faculty Biotechnology, Ha Noi Open University Study time: from 11/2014 to 4/2019 CHAPTER I OVERVIEW OF RESEARCH 1.1 Overview of Vibrio parahaemolyticus cause hepatic and kidney necrosis disease in marine fish 1.1.1 Morphological, biochemical and growth characteristics of Vibrio 1.1.2 Genome of V parahaemolyticus 1.1.3 Virulence and haemolysin virulence genes There are three haemolysin protein: TDH (thermostable direct haemolysin), TRH (TDH-related haemolysin) and TLH (thermolabile haemolysin) are encoded by tdh, trh and tlh genes, respectively The toxR gene is in the toxRS operon (Vp-toxRS), encodes for regulatory proteins that play an essential role in regulating the survival and virulence of bacteria 1.1.4 The rpoB gene and resistance to rifampicin The rpoB gene coding for b-subunit of RNA polymerase that related to Rifampicin resistance Rifampicin is a broad-spectrum antibiotic that can hinder DNA-directed RNA polymerase, and thereby, block the initiation of transcription and kill bacterium 1.1.5 Antigen of V parahaemolyticus 1.2 Hepatic and kidney necrosis disease in marine fish 1.2.1 Symptom 1.2.2 Diagnosis and treatment 1.3 Vaccines and active immune mechanism 1.3.1 Vaccines and vaccine types for fish 1.3.2 Specific immunity in bone fish 1.3.3 Fish vaccine delivery 1.4 Study on creating attenuated strains for development of attenuated vaccines against hepatic and kidney necrosis disease 1.4.1 Creating attenuated strains with physical agents 1.4.2 Creating attenuated strains with chemical agents 1.4.3 Creating attenuated strains by genetic engineering 1.5 Research situation on vaccine production to prevent hepatic and kidney necrosis disease in fish 1.5.1 Research situation in the world 1.5.2 Research situation in Vietnam Currently, studies on creating vaccines against V parahaemolyticus are focusing on inactivated and recombinant vaccines with the outer membrane proteins and DNA vaccines However, commercially licensed vaccines against V parahaemolyticus are not available for fish, including the attenuated vaccines for hepatic and kidney necrosis disease in fish In this study, we created attenuated strains and assessed the their potential to select some strains to use as a candidate for the development of attenuated vaccines against V parahaemolyticus CHAPTER II MATERIALS AND RESEARCH METHODS 2.1 Materials 2.1.1 Diseased fish Marine fish (grouper, snapper, seabass, cobia ) had symptoms of hepatic and kidney necrosis disease were collected in aquaculture areas in Cat Ba Island, Lan Ha Bay, Cat Hai (Hai Phong); Đồng Chau (Thai Binh); Hai Thinh (Nam Dinh) Samples were used to isolate bacteria for 24 hours from the time of sample collection 2.1.2 Experimental fish Zebrafishes (Danio rerio) having length - 3,5 cm and tilapiaes (Oreochromis niloticus) having length - 6,5 cm were purchased from Research Institute for Aquaculture No1 (Tu Son, Bac Ninh) Orange spotted grouper (Epinephelus coioides) having length 5,5 cm were purchased from Aquatic Breeding Center in Hai Phong 2.1.3 Bacteria: The V parahaemolyticus VTCC 12233 strain was purchased from the Institute of Microbiology and Biotechnology, Vietnam National University, Hanoi, Vietnam to be used as a control 2.1.4 Chemicals 2.1.5 Equipment 2.2 Research methods 2.2.1 Diagram of the main steps Disease marine fishes Isolation V parahaemolyticus strains isolated Inject into orange-spotted grouper Treatment of rifampicin from 10 to 250 μg/ml Rifampicin-resistant V parahaemolyticus strains Assessment, selection Attenuated strains of V parahaemolyticus Selecte potential attenuated strain Evaluation of stability, ability to create immune response of potential attenuated strains Figure 2.1 Diagram of the main steps 2.2.2 Method of isolating Vibrio strain from suspected infected fish The liver, kidneys, skin, fins of suspected disease fish are crushed in 1.5% saline solution, dilute this solution, and spread evenly over the surface of the TCBS medium Select colonies with morphology: round, glossy, convex, dark green on TCBS medium 2.2.3 The method to hold bacterial strains 2.2.4 Gram stain method 2.2.5 Method for determining the growth of bacteria 2.2.6 Methods of assessing biochemical characteristics and antibiotic resistance characteristics of strains (a) Assessing biochemical characteristics: fermentation, indole production, catalase generation, mobility, gas production and H2S generation and haematopoietic capacity (b) Antibiotic resistance characteristics: with ampicillin (25 µg), gentamycin (30 µg), norfloxacin (10 µg), enrofloxacin (5 µg) erythromycin (15 µg) 2.2.7 Methods of assessing virulence of isolated strains Groupers were injected with the V parahaemolyticus isolates Determine survival rates of injected fish 2.2.8 Method of treating bacteria with rifampicin Bacterial culture on rifampicin-containing media with increasing rifampicin concentration from 10 to 250 µg/ml Selection rifampicin-resistant strains 2.2.9 Methods of assessing virulence of rifampicin-resistant strains (a) Survival rate of fish after infection: Rifampicin-resistant bacteria strains were evaluated for virulence by bacterial infection on zebrafish and tilapia Determine survival rate of fish after infection (b) LD50 value 2.2.10 Molecular biology methods 2.2.10.1 Primer design method Using CLC Genomics Workbench 8.5 (QIAGEN Bioinformatics) to design primar for toxR, tdh, trh, tlh genes of V parahaemolyticus 2.2.10.2 Methods of total DNA extraction: Total DNA was extracted by i-genomic BYF DNA Extraction Mini kit (iNtRON, Korea) 2.2.10.3 PCR, sequencing and analyzing sequences of virulence and rpoB genes (a) PCR to amplify virulence genes and rpoB gene Bảng 2.1: Sequence and characteristics of primers used in PCR Genes Primer target toxR-4 toxR toxR-7 toxR2 toxR toxR4 tlhF tlh tlhR tlh1 tlh tlh3 tdhF tdh tdhR tdh1 tdh tdh2 trhF trh trhR trh1 trh trh2 Primer sequence (5’ – 3’) GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG ACTCTACCCCCCTAAAAGCA CTGCCCCAGTACAACCAACC AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGCG TGTCGTGGCCATTTTGCTT CCGTGATGCCAAAATCAAAA GTAAAGGTCTCTGACTTTTGGAC TGGAATAGAACCTTCATCTTCACC ACTGGACTGTGGTTGGT CCTCGAATTACGCAACAA TTGGCTTCGATATTTTCAGTATCT TTGGCTTCGATATTTTCAGTATCT TCGCATTTTTTCACCATTCCC TAAGTTCACGCATTGAG Tm (℃) 54,1 55,0 55,5 58,5 58,0 56,1 55,7 52,0 53,3 54,5 56,7 50,3 52,2 52,8 54,2 49,6 1110F GTAGAAATCTACCGCATGATG 54,1 CM32b CGGAACGGCCTGACGTTGCAT 53,3 rpoB Size of products (bp) Source 368 Kim Y.B et al (1999) 1070 In this study 450 Bej A.K et al (1999) 1484 In this study 269 Bej A.K et al (1999) 865 In this study 500 Bej A.K et al (1999) 772 In this study 984 Tarr C.L et al (2007) Mollet C et al (1997) (b) Sequencing method: PCR products sent for sequencing at First BASE Laboratories, Malaysia 2.2.11 Bioinformatics method: Results of gene sequencing were analyzed with software BLAST (https://blast.ncbi.nlm.nih.gov/Blast) CLC Genomics Workbench 8.5 Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) Swiss model (https://swissmodel.expasy.org/interactive) 2.2.12 Methods for evaluating virulence stability and the safety of attenuated strain in orange-spotted grouper (a) Evaluating virulence stability of attenuated strains (b) Evaluating the safety of attenuated strains 2.2.13 Method of evaluating the immune response of the attenuated strain on groupers (a) Assessing the immune response to fish Relative survival percent (RPS) is calculated by the formula of Amend (1981) RPS (%) = [1-(% dead vaccinated fish /% dead control fish)] x 100 (b) Evaluate immune time: assess relative survival percent of vaccinated fish after 1, 2, 4, and months 2.2.14 Data processing methods Data were processed statistically in Excel and Stata 2.0 software 10 (toxR-4, toxR-7 [69] and tlhF-tlhR [29]) Therefore, it can be confirmed precisely that 11 bacterial isolates were V parahaemolyticus From here, the bacterial isolates were called V parahaemolyticus strains 3.1.4 Evaluation of pathogenicity of V parahaemolyticus strains to groupers Observing the symptoms of infected fish and recording the survival rate of the groupers after 14 injection days with V parahaemolyticus strains isolated showed that: 100% of the infected fish manifested hemorrhagic symptoms, hemorrhagic fin, flake of fish scales, skin ulcer, the muscular area around the injection site and skin are darker, severe necrosis of the liver and kidney The survival rate of grouper after 14 infection days (Table 3.5) ranged from 2.22% to 22.22%, of which, fish injected with B5M3 and N9.2 strains had the lowest survival rate (2.22%) The highest survival rate recorded in fish infected with the B13M1 strain (22.22%) These rates in fishes infected with LBT6, B3.13, A3.3, B5M2, B5M4 strains were 13.33%; 6.67%; 10%; 18.9%; 18.9%, respectively The survival rate 16.67% was observed in fish infected with one of three strains of bacteria B20M2, N13.1.1, HH3-34 High mortality rates was in the first week, especially on day to day after infection In the following week, the mortality rate was lower and the change range of this rate was less among days Table 3.5 Survival rate (%) of groupers infected with 11 strains Strains LBT6 B3.13 A3.3 B5M2 B5M3 B5M4 B13M1 B20M2 N9.2 N13.1.1 HH3-34 PBS Survival rate of fish after infection (%) Day Day Day Day Day Day 11 Day 13 82.22 ± 55.56 ± 28.89 ± 17.78 ± 13.33 ± 14.44 ± 13.33 ± 1.25 0.47 0.47 0.47 0.00 0.47 0.82 81.11 ± 53.33 ± 35.56 ± 14.44 ± 7.78 ± 6.67 ± 6.67 ± 1.70 1.24 0.47 0.47 0.47 0.00 0.00 78.89 ± 70.00 ± 48.89 ± 31.11 ± 13.33 ± 11.11 ± 11.11 ± 0.67 0.00 0.47 0.47 0.47 0.47 0.00 85.56 ± 67.78 ± 45.56 ± 33.33 ± 22.22 ± 20.00 ± 18.89 ± 0.47 0.47 0.47 0.00 1.25 0.82 0.47 55.56 ± 27.78 ± 17.78 ± 8.89 ± 4.44 ± 2.22 ± 2.22 ± 0.47 0.82 0.47 0.47 0.00 0.47 0.47 74.44 ± 47.78 ± 38.89 ± 26.67 ± 20.00 ± 18.89 ± 18.89 ± 1.25 0.47 0.94 0.82 0.00 0.47 0.47 82.22 ± 55.56 ± 35.56 ± 25.56 ± 24.44 ± 22.22 ± 22.22 ± 0.82 0.47 1.25 0.47 0.47 0.47 0.47 71.11 ± 55.56 ± 44.44 ± 30.00 ± 21.11 ± 18.89 ± 16.67 ± 0.47 2.05 2.05 1.63 0.47 0.47 0.00 55.56 ± 45.56 ± 35.56 ± 13.33 ± 4.44 ± 2.22 ± 2.22 ± 0.47 0.47 0.47 0.82 0.47 0.47 0.47 60.00 ± 48.89 ± 30.00 ± 23.33 ± 18.89 ± 17.78 ± 17.78 ± 1.41 1.25 0.82 1.41 0.94 0.47 0.47 62.22 ± 48.89 ± 28.89 ± 23.33 ± 21.11 ± 20.00 ± 20.00 ± 0.94 1.25 0.47 0.82 1.63 1.41 1.25 100 100 100 100 100 100 100 Values with different letters(a,b,c) indicate significant differences at P