thiết kế và biểu hiện protein tiểu đơn vị b độc tố không chịu nhiệt heat labile toxin

52 454 1
thiết kế và biểu hiện protein tiểu đơn vị b độc tố không chịu nhiệt heat labile toxin

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Thông tin tài liệu

ĐẶT VẤN ĐỀ Chất lượng ATVSTP có liên quan trực tiếp hàng ngày, thường xuyên, liên tục đến sức khỏe con người, ảnh hưởng lâu dài đến nòi giống dân téc. Sử dụng thực phẩm không đảm bảo chất lượng, vệ sinh sẽ dẫn đến ngộ độc cấp tính, ngộ độc mạn tính, các bệnh truyền qua thực phẩm. Chất độc tính lũy trong cơ thể gây ảnh hưởng đến sức khỏe lâu dài, giảm khả năng lao động, gây các bệnh mạn tính, rối loạn chuyển hóa và có thể gây ung thư. Không những thế, nó còn ảnh hưởng đến sự phát triển kinh tế, xã hội, an ninh chính trị và quan hệ quốc tế [13]. Theo thống kê của Trung tâm kiểm soát và phòng ngõa bệnh tật Mỹ thì hàng năm trên thế giới có khoảng 1,3 tỷ người tiêu chảy trong đó có 70% nguyên nhân do sử dụng thực phẩm không an toàn [26]. Tại các nước đang phát triển, mỗi năm có khoảng 1/3 dân số bị các bệnh do thực phẩm gây ra, trong đó bệnh tiêu chảy là thường gặp nhất và gây tử vong khoảng 2,2 triệu người [22]. Ở Việt Nam ngộ độc thực phẩm là một vấn đề đang được quan tâm hàng đầu, theo ước tính của bộ Y tế, chỉ riêng năm 2001 đó cú 4,2 triệu người bị ngộ độc thực phẩm. Từ năm 2001-2006, cả nước ghi nhận được hơn 5600000 ca tiêu chảy do ngộ độc thực phẩm, trong đó có 84 ca tử vong. Riêng trong 9 tháng đầu năm ngoái ghi nhận được hơn 750.000 ca tiêu chảy trong đó có 12 ca tử vong. Thực tế theo các chuyên gia phải gấp ít nhất 10 lần con số được công bố [10].[20]. Các bệnh liên quan đến thực phẩm hiện nay vẫn là một mối nguy cơ chính tác động đến sức khoẻ con người trên thế giới (Wood và CS 1983). Trong đó, vi khuẩn E.coli sinh độc tố (ETEC) là một trong những nguyên nhân gây bệnh tiêu chảy quan trọng cho trẻ em ở các quốc gia đang phát triển 1 và cho khách du lịch đến những vựng cú dịch lưu hành. Thực phẩm và nước bị ô nhiễm là những phương tiện lây truyền chủ yếu của loại vi khuẩn này. Các mẫu xét nghiệm thực phẩm và nước thường có tỷ lệ ô nhiễm cao với ETEC ở vựng cú dịch lưu hành (Black và CS, 1981,1982; Ryder và CS, 1976). Nhiễm trùng do ETEC thường xảy ra vào những mùa nóng, ẩm ướt sẽ là những điều kiện thuận lợi cho vi khuẩn phát triển trong thực phẩm và nước. ETEC có khả năng sinh độc tố chịu nhiệt ST và độc tố không chịu nhiệt LT. Độc tố không chịu nhiờt cú cấu trúc và chức năng như độc tố tả (cholerae toxin). Vì vậy người bị nhiễm độc tố này sẽ bị tiêu chảy cấp tính với mức độ mất nước trầm trọng. Trên thế giới nhiều nhà khoa học đó nhiờn cứu và sản xuất thành công protein tái tổ hợp tiểu đơn vị B của độc tố LT của ETEC và sử dụng protein tái tổ hợp này để thiết kế các bộ sinh phẩm chẩn đoán các ETEC gây bệnh bằng kỹ thuật ELSA và latex đã thu được kết quả tốt (Cryan B,1990; Oto và CS,1983). Nguyên lý của kỹ thuật là sử dụng protein tái tổ hợp tiểu đơn vị B của độc tố LT gây miễn dịch tạo ra kháng thể kháng LT sau đó sử dụng kháng thể này để phát hiện độc tố LT của ETEC. Tuy nhiên giá thành của sản phẩm này còn cao do vậy chưa đáp ứng được với điều kiện kinh tế của nước ta Ở Việt Nam, chi phí điều trị cho các bệnh liên quan đến thực phẩm do căn nguyên vi khuẩn gây nên rất đắt. Tuy nhiên do chúng ta chưa có thống kê rõ ràng về căn nguyên gây ra các vụ ngộ độc thực phẩm nên rất khó phòng chống . Ở Việt Nam, chi phí điều trị cho các bệnh liên quan đến thực phẩm do căn nguyên vi khuẩn gây nên rất đắt. Tuy nhiên do chúng ta chưa có thống kê rõ ràng về căn nguyên gây ra các vụ ngộ độc thực phẩm nên rất khó phòng chống . Với điều kiện khí hậu nóng ẩm ở Việt Nam và sự thiếu hiểu biết về vệ sinh an toàn thực phẩm của người dân nên ngộ độc thực phẩm do E. Coli sinh 2 độc tố (ETEC) chiếm tỷ lệ không nhỏ. Phương pháp nuôi cấy không thể phát hiện được ETEC trong thực phẩm mà phải phát hiện được sự có mặt của độc tố ETEC trong thực phẩm bằng kỹ thuật ELISA hay latex nhằm phát hiện các gen mã hóa độc tố của các chủng ETEC trong thực phẩm . Cho đến nay có một nghiên cứu ở Việt Nam của tác giả Nguyễn Thị Thanh Yến và CS năn 2005 tại viện dinh dưỡng về ứng dụng kỹ thuật ELISA để phát hiện khả năng sinh độc tố LT của ETEC trong các mẫu thực phẩm. Tuy nhiên các kỹ thuật này giá thành còn cao và phức tạp cho nên rất khó áp dụng cho các phong xét nghiệm thực phẩm ở tuyến tỉnh. Xuất phát từ thực tiễn đó chúng tôi tiến hành nghiên cứu đề tài: “Thiết kế và biểu hiện protein tiểu đơn vị B độc tố không chịu nhiệt LT của ETEC và sản xuất kháng thể đa dũng khỏng LT trên quy mô phũng thớ nghiệm” . Đây là bước quan trọng cho nghiên cứu tiếp theo nhằm mục đích sản xuất bộ sinh phẩm chẩn đoán độc tố không chịu nhiệt (LT) của ETEC ở trên một số nhóm thực phẩm Mục tiêu nghiên cứu: 1. Thiết kế vector biểu hiện gen mã hóa cho kháng nguyên tái tổ hợp EltB và biến nạp vào tế bào khả biến DH5α 2. Biểu hiện và tinh sạch Protein EltB trong tế bào vi khuẩn E.coli BL21 3. Sản xuất kháng thể kháng LT trên thỏ ở quy mô phòng thí nghiệm 3 Chương 1 TỔNG QUAN 1.1.Tình hình vệ sinh an toàn thực phẩm 1.1.1.Trên thế giới Theo thống kê của Trung tâm kiểm soát và phòng ngõa bệnh tật Mỹ thì hàng năm trên thế giới có khoảng 1,3 tỷ người tiêu chảy trong đó có 70% nguyên nhân do sử dụng thực phẩm không an toàn [26]. Tại các nước đang phát triển, mỗi năm có khoảng 1/3 dân số bị các bệnh do thực phẩm gây ra, trong đó bệnh tiêu chảy là thường gặp nhất và gây tử vong khoảng 2,2 triệu người [22]. Tại Úc, mỗi ngày có khoảng 11.500 người bị ngộ độc thực phẩm. Ở Mỹ hàng năm ước đoán có khoảng 5 đến 6 triệu người bị mắc bệnh do nguyên nhân ăn uống và hơn 9000 trường hợp tử vong [12].[48]. Một nghiên cứu khác về bệnh từ thực phẩm bị ô nhiễm VSV gây bệnh ở New-York Mỹ, phát hiện có sự gia tăng gấp 4 lần từ 1980 đến 1990. [6]. Ở Trung Quốc năm 1998 có 292.000 người bị ngộ độc thực phẩm do virus viêm gan A làm tử vong 9 người. Năm 1999 xảy ra 591 vụ ngộ độc thực phẩm với 17.971 người mắc, chết 108 người. Nguyên nhân chính là do thực phẩm bị ô nhiễm VSV là 8.505 trường hợp, do hóa chất là 9.506 trường hợp, thực vật hặc động vật có chất độc là 2.719 trường hợp. Phần lớn các trường hợp ngộ độc xảy tại các căng tin là 7.529 trường hợp[2]. Một thống kê trong 10 năm xác định các yếu tố nguyên nhân gây ngộ độc thực phẩm tại Trung Quốc cho thấy 93,24 % là nguyên nhân vi sinh vật, chỉ có 6,76% bởi các yếu tố hóa học [23]. Ngộ độc thực phẩm do VSV ngày càng gia tăng ở các quốc gia đang phát triển và ở cả các quốc gia đã phát triển, đăc biệt là E.coli. Ở Nhật Bản năm 1996 có khoảng 800 người bị nhễm bệnh do Enterohaemorrhagie E.coli [3]. 4 1.1.2. Ở Việt Nam. Tình trạng ô nhiễm thực phẩm đang diễn ra khá phổ biến trên cả nước, chủ yếu là ô nhiễm mầm bệnh sinh học và hóa chất [10]. Tại Hà Nội, tỷ lệ thức ăn đường phố ô nhiễm vi khuẩn cao (46,7%) [10]. Điều tra tại thành phố Hồ Chí Minh cho thấy, 100% các mẫu thực phẩm được kiểm tra: bánh mì, thịt nguội, thịt quay và dưa muối không đảm bảo vệ sinh thực phẩm về mặt vi sinh [3]. Tại Hải Phòng có 76,4% thực phẩm không đạt tiêu chuẩn vệ sinh, trong đó tỷ lệ không đạt vệ sinh của thức ăn đường phố là 92,9%. Có tới 85% mẫu thực phẩm ăn ngay tại các chợ không đạt tiêu chuẩn về vi sinh, với số lượng vi khuẩn có trong thực phẩm vượt mức cho phép nhiều lần, kể cả các vi khuẩn gây bệnh nguy hiểm [20]. Không chỉ ở các thành phố lớn, tình trạng nhiễm vi sinh vật gây bệnh trong thực phẩm còn diễn ra phổ biến ở rất nhiều địa phương khác trên cả nước [10]. Cùng với tình trạng ô nhiễm thực phẩm, ngộ độc thực phẩm ở Việt Nam xảy ra cũng rất thường xuyên. Theo thống kê chưa đầy đủ của Cục ATVSTP, từ năm 2000 đến năm 2007, trung bình mỗi năm có khoảng 181 vô ngộ độc thực phẩm xảy ra với khoảng 5.211 người mắc và khoảng 48 ca tử vong. Tỷ lệ mắc ngộ độc thực phẩm trung bình là 6,05/100.000 dân, tỷ lệ chết là 0,06/100.000 dân/năm. Tuy nhiên, trên thực tế, do chưa có hệ thống giám sát đến cơ sở, việc thống kê báo cáo còn chưa được thiết lập nên số ca ngộ độc thực phẩm thực tế hàng năm còn cao hơn rất nhiều. Theo ước tính của WHO, ngộ độc thực phẩm hàng năm ở Việt Nam khoảng trên 8 triệu ca. Ngoài tình trạng ngộ độc thực phẩm cấp tính, ngộ độc thực phẩm mạn tính cũng đang diễn ra khá phức tạp. Ngộ độc thực phẩm mạn tính thường Ýt được chú vì biểu hiện lâm sàng thường không dữ dội như ngộ độc cấp tính. Tuy nhiên, hậu quả của ngộ độc thực phẩm mạn tính còn nguy hiểm hơn nhiều, dẫn đến biết bao hệ lụy cho sức khỏe cộng đồng. 5 Riêng trong quý IV năm 2010, cả nước xảy ra 18 vụ ngộ độc làm 4 người tử vong, trong đó có 3 vụ ngộ độc lớn từ 30 người trở lên. Số người bị ngộ độc là 323 người với 242 người nhập viện. Nguyên nhân chính là do vi sinh (gồm 4 nhóm vi khuẩn chính là Salmonella, Streptoccocus, E.Coli và Staphylococcus); do độc tố tự nhiên và hóa chất. Có 5/18 vụ ngộ độc không xác định được nguyên nhân do không lấy được mẫu thực phẩm lưu tại cơ sở. Mới đây nhất, ngày 30/12, có 461 công nhân thuộc 4 công ty trên địa bàn quận 12 và huyện Húc Mụn, TP.HCM đã lần lượt phải nhập viện cấp cứu vì ngộ độc thực phẩm (Dinh dưỡng 1.2.Ngộ độc thực phẩm do E.coli 1.2.1. Vài nét về E.coli E.coli do Eschirich phân lập từ phân người năm 1885 E.coli ký sinh bình thường trong đại tràng người và một số động vật. Sau khi trẻ ra đời khoảng 3h, người ta đã thấy E.coli trong đại tràng và từ đó nó sống suốt đời với cơ thể vật chủ E.coli góp phần tiêu hóa thức ăn, phân giải muối mật, sản xuất một số sinh tố, giữ thăng bằng vi khuẩn chí ở ruột. Trong số vi khuẩn hiếu khí ở đại tràng, E.coli chiếm 80% 6 Một số hình ảnh của E.coli Hình 1. Hình ảnh E.coli trên kính hiển vi điện tử Hình 2: khuẩn lạc E.coli trên môi trường thạch Endo 1.2.2 Phân loại Có nhiều cách phân chia loài E.coli nhưng cách phân loại theo type huyết thanh là hay được dùng hơn cả. Cách phân loại này dựa trên cấu trúc kháng nguyên khác nhau cú trờn bề mặt tế bào vi khuẩn. 7 - Kháng nguyên O là quyết định kháng nguyên quan trọng nhất. Bản chất là lipopolisaccharide nằm trờn vỏch tế bào vi khuẩn. Có 171 loại kháng nguyên O đã được xác định, một số trong số chỳng cú phản ứng chéo với các vi khuẩn khác [34].[44]. - Kháng nguyên K là kháng nguyên bề mặt. Kháng nguyên K nằm bên ngoài kháng nguyên O. Người ta đã xác định được khoảng 80 loại kháng nguyên K khác nhau [14].[34]. - Kháng nguyên H là kháng nguyên lụng cú bản chất hóa học là protein. Có 56 loại kháng nguyên lông khác nhau [14].[34]. Dựa trên các kháng nguyên O, K và H người ta đã phân biệt được trên 700 type huyết thanh khác nhau của E.coli Phân loại dựa vào sự ly giải bởi phage đặc hiệu có khoảng 50 type phage Phân loại dựa vào tính chất gây bệnh chia làm 5 loại [21]. - EPEC (Enteropathogenic E.coli): E.coli gây bệnh đường ruột - EHEC ( Enterohemorrhagic E.coli): E.coli gây chảy máu đường ruột - ETEC (Enterotoxigenic E.coli): E.coli sinh độc tố ruột - EIEC (Enteroinvasive E.coli): E.coli xâm nhập đường ruột - EAEC Enteroadherent E.coli) E.coli bám dính đường ruột 1.2.3. Đặc điểm sinh học Hình thái học - E.coli là trực khuẩn kích thước trung bình 1-3àx 0,5àm, đứng riêng rẽ hoặc đôi khi thành đôi. Trong những điều kiện không thích hợp (ví dụ: trong môi trường có kháng sinh), vi khuẩn có thể dài như sợi chỉ. - Bắt mầu Gram (-) - Di động bằng hệ thống lông xung quanh thân hoặc không di động. - Có thể có vỏ. 8 Tính chất nuôi cấy - Là loại hiếu khí hay hiếu kỵ khí tùy tiện. - Nhiệt độ thích hợp 37 o C nhưng có thể mọc ở 40 o C, sống được ở nhiệt đô 5-40 o C - pH 7,4. - E.coli phát triển dễ dàng trên môi trường nuôi cấy thông thường, một số có thể phát triển trên môi trường tổng hợp rất nghèo chất dinh dưỡng. - Ở những điều kiện thích hợp, E.coli phát triển rất nhanh, thời gian phân chia thành một thế hệ mới khoảng 20 đến 30 phút. - Trong môi trường lỏng (như canh thang) sau 3-4h E.coli đã làm đục nhẹ môi trường, sau 24h làm đục đều. Những ngày sau, dưới đáy ống có thể có cặn. - Trên môi trường đặc sau khoảng 8-10h, dùng kính lúp có thể thấy được khuẩn lạc. Sau 24h đường kính khuẩn lạc khoảng 1,5mm, hình thái khuẩn lạc điển hình là dạng S: tròn, lồi, ướt, màu xám, bề mặt sáng bóng, bờ đều, nhưng cũng có thể gặp dạng M hoặc dạng R. - Trên môi trường thạch dinh dưỡng NA tạo khúm trũn ướt (dạng S) màu trắng đục. Để lâu khóm trở nên khô nhăn (dạng R). Kích thước khóm 2- 3mm. - Trên thạch mỏu: Cú chủng dung huyết β, có chủng không dung huyết α. - Trên môi trường chẩn đoán chuyên biệt EMB (Eozin Methyl Blue) tạo khúm tớm ánh kim. - Trên môi trường Rapid’ E.coli tạo khuẩn lạc màu tím Trên môi trường Macconkey, Endo, SS tạo khóm hồng đỏ Trờn cỏc môi trường đường: Lên men sinh hơi lactose, glucose, galactose. Lên men không đều saccarose và không lên men dextrin, glycogen. - Trên môi trường Macconkey, Endo, SS tạo khóm hồng đỏ. 9 - Trên các môi trường đường: Lên men sinh hơi lactose, glucose, galactose. Lên men không đều saccarose và không lên men dextrin, glycogen. Tính chất sinh vật hóa học - Phản ứng oxydase(-), Citrat Simmons(-) - Lên men glucose (+), Lên men sorbitol (-), Lên men lactose(+/-) - Phản ứng RM (+), Phản ứng VP (-), Urease (-), Indole (+), H 2 S (-), Sinh hơi (+), Lysine decarboxylase (+), Arginine dihydrolase (+), Ornithin decarboxylase (+), ONPG (+) 1.2.4. Khả năng gây bệnh ở đường tiêu hóa E.coli là vi khuẩn gây bệnh cơ hội Hiện tại người ta đã xác định được 5 loại E.coli có khả năng gây tiêu chảy: ETEC , EPEC , EHEC, EIEC, EAEC ♦ ETEC Để gây được bệnh tiêu chảy, E.coli đòi hỏi phải có hai yếu tố độc lực đó là: + Khả năng bám và cư ngụ ở niêm mạc ruột. + Khả năng sản sinh ra độc tố. •Các yếu tố bỏm dớnh: - Khả năng bám và cư ngụ của ETEC vào tế bào màng nhầy biểu mô ruột non là điều kiện quan trọng trong quá trình gây bệnh. Quá trình này được thực hiện qua một số các yếu tố trung gian gọi là CFA (Colonization Factor Antigen “yếu tố kháng nguyên cư ngụ”) hoặc các yếu tố kháng nguyên trên bề mặt E.coli (E.coli surface antigen). Các CFA này có bản chất là protein và chúng có tính kháng nguyên nguyên mạnh, có khả năng gây ngưng kết hồng cầu của một số loài khác nhau [36].[38].[46]. - Cho đến nay người ta đã phát hiện ra một số loại CFA khác nhau như CFA I, CFA II, CFA III, CFA IV. CFAII được mô tả như một yếu tố kháng 10 [...]... dớnh của tiểu < /b> đơn < /b> vị < /b> B vào thụ thể GM1 trên niêm mạc ruột non sẽ cho phép độc tố này xâm nhập vào b n trong của tế b o niêm mạc ruột Tiểu < /b> đơn < /b> vị < /b> A mang hoạt tính enzym gồm 2 peptid A1 và < /b> A2 nối với nhau b i cầu nối disulfide (Giannella và < /b> CS, 1974, 1981; Streatfield và < /b> CS, 1992) [41] - Cơ chế gây tiêu chảy của LT 12 Sau khi phần B giúp độc tố b m vào tế b o biểu < /b> mô ruột thì phần A được đẩy vào b n trong... I, CFA II và < /b> CFA IV xuất hiện < /b> khoảng 75% trong các chủng ETEC gây b nh ở người trên thế giới [34] ● Độc tố ETEC gây tiêu chảy nhờ hoạt động của độc tố ruột không chịu nhiệt LT và < /b> độc tố ruột chịu nhiệt ST Một chủng E.coli có thể chỉ có LT, chỉ có ST hoặc cả 2 loại độc tố này ◘ Độc tố không chịu nhiệt LT LT là một protein < /b> có tính kháng nguyên mạnh, có tính chất của một ngoại độc tố Cấu trúc và < /b> chức năng... Plasmid b ng cách điện trên thach điện - B o quản ở -20oC để phục vụ cho các nghiên cứu tiếp theo Biến nạp đoạn gen ELTB vào vector pGEX Đoạn gen ELTB mã hóa tiểu < /b> đơn < /b> vị < /b> B độc tố không chịu nhiờt của ETEC sẽ được biến nạp vào vector biểu < /b> hiện < /b> pGEX ELTB protein < /b> sẽ được tổng hợp trong tế b o E Coli BL21 dưới sự điều khiển của Tac promoter (hình 2.2) ACC BamHI EltB XhoI GCC Hình 2.2 Sơ đồ biến nạp... xác độc tố LT của ETEC trong các mẫu thực phẩm 24 CHƯƠNG 2 ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1 Đối tượng nghiên cứu 2.1.1 Chủng vi khuẩn và < /b> plasmid - Tế b o vi khuẩn khả biến Escherichia coli chủng DH5α sử dụng cho mục đích tỏch dũng và < /b> biểu < /b> hiện < /b> protein < /b> EltB, - Tế b o biểu < /b> hiên protein < /b> BL21 - Chủng ETEC chuẩn (… ) mang gen độcn tố LT - vector biểu < /b> hiện < /b> pGEX mang đoạn gen mã hóa cho protein < /b> EltB... canh thang LB có chứa 100àg ampicillin sau đó được ly tâm lấy căn tế b o và < /b> tách chiết plasmid (như ở b ớc - Biến nạp plasmid pGEX-ELTB vào tế b o biểu < /b> hiện < /b> protein < /b> E.coli BL21 Lấy 1àl plasmid pGEX-ELTB cho vào 100àl tế b o biến nạp E Coli BL21 Ủ trong hỗn hợp trong đá 30 phút Cho hỗn hợp vào trong máy ủ nhiệt ở 420C Để trở lại trong đá 1 phút Cho ra nhiệt độ phòng 1 phút Nhò vào hỗn hơp 1ml... cho protein < /b> EltB có trình tự như sau 5’ CGCGGATCCGGAGCTCCTCAGTCTATTA 3’EltB BamHI-F 5’ CCGCTCGAGGTTTTCCATACTGATTGCCG 3’ EltB XhoI-R 2.2 Phương pháp nghiên cứu 27 2.2.1 Sơ đồ nghiên cứu Nghiên cứu được tiến hành theo sơ đồ như mô tả tại hình 2.1 Khuyếch đại gen EltB b ng PCR Tách dòng gen EltB Đưa gen EltB vào vector biểu < /b> hiện < /b> pGEX PCR Kiểm tra vector biểu < /b> hiện < /b> chứa gen EltB Enzym cắt Sequencing Biểu < /b> hiện.< /b> .. LT I và < /b> LT II, chúng không có phản ứng miễn dịch chéo với nhau LT I có ở những chủng gây b nh cho cả người và < /b> động vật, LT II hiếm khi phân lập được ở trên người Nhưng cả động vật và < /b> người, sự có mặt can LT II không liên quan đến b nh Do vậy thuật ngữ LT chỉ để ám chỉ LT I LT là độc tố có trọng lượng phân tử thấp 86 kDa bao gồm 28 kDa tiểu < /b> đơn < /b> vị < /b> A và < /b> 11,5 kDa của 5 tiểu < /b> đơn < /b> vi B (LTB) Khả năng b m... cột b ng 20ml PBS có chứa 0,1% Triton X-100 Thu hoạch 1ml trong một lần sau đó phân tích protein < /b> tái tố hợp ELBT b ng điện di trên gel SDS-polyacrylamide 12% và < /b> nhuộm gel b ng Coomasie Blue R250 Kiểm tra protein < /b> EltB b ng Western blot Western blot là kỹ thuật phát hiện < /b> protein < /b> b ng phương pháp điện di trên gel SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis)Western blot bao... biệt là khả năng sinh độc tố và < /b> các gen quy định các yếu tố độc lực Thử nghiệm b m dớnh trờn tế b o Hep-2 hiện < /b> nay vẫn được coi là “tiờu chuẩn vàng” để xác định EAEC Phương pháp này cũng có giá trị nhất định trong phân biệt cỏc nhúm E.coli b m dớnh và < /b> gây tiêu chảy Thử nghiệm b m dớnh trờn tế b o Hep-2 được thực hiện < /b> b ng cách cấy truyền các chủng E.coli cần xác định trên tế b o 1lớp và < /b> ủ trong 3h ở điều... 14/221 (6,3%) các chủng E coli phân lập từ các b nh nhân tiêu chảy cấp có sinh độc tố ruột Thêm vào đó các nghiên cứu sâu về E coli sinh độc tố b ng các kỹ thuật sinh học phân tử như phát hiện < /b> tỷ lệ mang gen độc tố của E coli (bao gồm cả độc tố LT) của các trường hợp tiêu chảy cấp tinh của trẻ em Hay việc phát hiện < /b> gen độc tố của E coli ở các trang trại b sữa cũng đã được tiến hành tại Việt Nam Tuy . phẩm và nước. ETEC có khả năng sinh độc tố chịu nhiệt ST và độc tố không chịu nhiệt LT. Độc tố không chịu nhiờt cú cấu trúc và chức năng như độc tố tả (cholerae toxin) . Vì vậy người b nhiễm độc. nghiên cứu đề tài: Thiết kế và biểu hiện protein tiểu đơn vị B độc tố không chịu nhiệt LT của ETEC và sản xuất kháng thể đa dũng khỏng LT trên quy mô phũng thớ nghiệm” . Đây là b ớc quan trọng. và CFA IV xuất hiện khoảng 75% trong các chủng ETEC gây b nh ở người trên thế giới. [34]. ● Độc tố ETEC gây tiêu chảy nhờ hoạt động của độc tố ruột không chịu nhiệt LT và độc tố ruột chịu nhiệt

Ngày đăng: 16/01/2015, 07:12

Từ khóa liên quan

Mục lục

  • - Đọc trình tự gen bằng máy đọc trình tự ABI (Applied Biosystem)

  • - So sánh các đoạn gen và được so sánh với các trình tự chuẩn của ngân hàng gen



Tài liệu cùng người dùng

  • Đang cập nhật ...

Tài liệu liên quan