Tạo tấm tế bào sụn từ sự kết hợp giữa tế bào gốc trung mô mỡ thỏ và màng chân bì da người

BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ ĐẠI HỌC Y DƯỢC THÀNH PHỐ HỒ CHÍ MINH - NGUYỄN XUÂN HOÀNG TẠO TẤM TẾ BÀO SỤN TỪ SỰ KẾT HỢP GIỮA TẾ BÀO GỐC TRUNG MÔ MỠ THỎ VÀ MÀNG CHÂN BÌ DA NGƯỜI LUẬN VĂN THẠC SĨ Y HỌC THÀNH PHỐ HỒ CHÍ MINH – NĂM 2021 BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ ĐẠI HỌC Y DƯỢC THÀNH PHỐ HỒ CHÍ MINH - NGUYỄN XUÂN HOÀNG TẠO TẤM TẾ BÀO SỤN TỪ SỰ KẾT HỢP GIỮA TẾ BÀO GỐC TRUNG MÔ MỠ THỎ VÀ MÀNG CHÂN BÌ DA NGƯỜI NGÀNH: KHOA HỌC Y SINH (MƠ PHƠI) MÃ SỐ: 8720101 LUẬN VĂN THẠC SĨ Y HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC: TS HUỲNH DUY THẢO TS TRẦN NGUYỄN QUỐC VƯƠNG THÀNH PHỐ HỒ CHÍ MINH – NĂM 2021 LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu riêng tôi, hướng dẫn khoa học TS Huỳnh Duy Thảo TS Trần Nguyễn Quốc Vương Các nội dung nghiên cứu, kết đề tài trung thực Những số liệu bảng biểu, đồ thị, hình ảnh phục vụ cho việc phân tích, nhận xét, đánh giá nhóm nghiên cứu chúng tơi thu thập từ nguồn khác có ghi rõ phần tài liệu tham khảo Ngoài ra, luận văn sử dụng số nhận xét, đánh số liệu tác giả khác, quan tổ chức khác có trích dẫn thích nguồn gốc Nếu phát có gian lận tơi xin hồn tồn chịu trách nhiệm nội dung luận văn TP Hồ Chí Minh, ngày tháng năm 2021 NGUYỄN XUÂN HOÀNG MỤC LỤC Trang Danh mục chữ viết tắt Danh mục bảng Danh mục hình Danh mục đồ thị MỞ ĐẦU Chương TỔNG QUAN TÀI LIỆU 1.1 Tổng quan mô sụn 1.2 Quá trình sửa chữa tổn thương sụn 1.3 Các chiến lược điều trị phục hồi, sửa chữa tổn thương sụn khớp 1.3.1 Nhóm can thiệp điều trị khơng có thành phần sinh học 1.3.2 Nhóm can thiệp điều trị có thành phần sinh học 1.4 Kỹ nghệ mô sửa chữa tái tạo mô sụn 10 1.4.1 Tổng quan ứng dụng kỹ nghệ mô tái tạo mô sụn 10 1.4.2 Tế bào gốc trung mô từ mô mỡ 15 1.4.3 Giá thể màng chân bì 22 1.5 Tình hình nghiên cứu ngồi nước 23 1.6 Tình hình nghiên cứu nước 24 Chương ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 27 2.1 Đối tượng nghiên cứu 27 2.2 Tiêu chuẩn chọn mẫu 27 2.3 Thiết kế nghiên cứu 27 2.4 Y đức 27 2.5 Phương pháp nghiên cứu 27 2.5.1 Phân lập định danh TBGTM từ mô mỡ thỏ 27 2.5.2 Tạo tế bào sụn từ TBGTM giá thể màng chân bì da người 33 2.5.3 Đánh giá tế bào sụn 34 Chương KẾT QUẢ VÀ BÀN LUẬN 35 3.1 Phân lập nuôi cấy TBGTM từ mô mỡ 35 3.1.1 Kết phân lập, nuôi cấy tăng sinh TBGTM từ mô mỡ 35 3.1.2 Đánh giá tăng sinh TBGTM từ mỡ 37 3.2 Kết định danh TBGTM từ mỡ 38 3.2.1 Khảo sát hình thái học đặc tính bám dính 38 3.2.2 Khảo sát khả biệt hóa 40 3.2.3 Khảo sát biểu gien phương pháp PCR 42 3.2.4 Khảo sát biểu gien cho marker đặc trưng sụn qRT-PCR 46 3.3 Tạo tế bào sụn từ kết hợp TBGTM từ mơ mỡ thỏ với màng chân bì 49 3.3.1 Kết đánh giá mô học 50 3.3.2 Kết chụp SEM 52 KẾT LUẬN 54 KIẾN NGHỊ 55 DANH MỤC CÁC CƠNG TRÌNH ĐÃ CƠNG BỐ TÀI LIỆU THAM KHẢO PHỤ LỤC DANH MỤC CHỮ VIẾT TẮT Từ Viết Tắt ACI Tiếng Anh Autologous Chodrocyte Implementation ADSC Adipose Derived Stem Cell CS Cộng DMEM/F12 EDTA Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 Ethylene Diaminetetraacetic Acid FBS Fetal Bovine Serum H&E Hematocylin & Eosin iPSCs Induced Pluripotent Stem Cells ISCT International Society for Cellular Therapy KHV Kính hiển vi MACI Membrane-asociated ACI PBS Phophate-Buffered Saline Quantitative Reverse Transcription Polymerase Chain qRT-PCR Reaction RT-PCR Reverse Transcription Polymerase Chain Reaction SEM Scanning Electron Microscopy TBGTM Tế Bào Gốc Trung Mô TEM Transmission Electron Microscopy TGF-1 Transforming growth factor-1 DANH MỤC BẢNG Bảng 1.1 Tiêu chuẩn định danh TBGTM 21 Bảng 2.2 Thành phần phản ứng RT-PCR 31 Bảng 2.3 Chu trình nhiệt phản ứng RT-PCR 31 Bảng 2.4 Thành phầ khuếch đại gien tạo sụn 32 Bảng 2.5 Chu trình nhiệt phản ứng qRT-PCR 32 Bảng 3.6 Mật độ tế bào thu nhận theo thời gian 37 Bảng 3.7 So sánh marker bề mặt người thỏ Flow cytometry nghiên cứu 43 Bảng 3.8 So sánh marker bề mặt phương pháp RT-PCR nghiên cứu 45 Bảng 3.9 Bảng số liệu mức độ biểu gien theo thời gian 46 DANH MỤC HÌNH Hình 1.1 Phân bố sụn thể Hình 1.2 Phân loại mơ sụn Hình 1.3 Các dạng tổn thương sụn Hình 1.4 Lược đồ phương pháp ACI Hình 1.5 Những tiến kỹ nghệ mô 12 Hình 1.6 Các thành phần kỹ nghệ mô sửa chữa sụn 13 Hình 1.7 Các nguồn tế bào gốc, nguồn thu nhận đặc điểm chúng 14 Hình 1.8 Khả biệt hóa tế bào gốc trung mơ 16 Hình 1.9 Quy trình phân lập ni cấy TBGTM từ mỡ 18 Hình 2.10 Xử lý mẫu mô mỡ để thu nhận TBGTM 28 Hình 2.11 Một số loại mơi trường sử dụng để cảm ứng biệt hóa TBGTM thành nguyên bào xương, nguyên bào sụn tế bào mỡ 29 Hình 3.12 Phân lập nuôi cấy TBGTM từ mô mỡ 36 Hình 3.13 Kết quan sát hình thái đặc tính bám dính TBGTM từ mô mỡ KHV đảo ngược 10X 39 Hình 3.14 Kết đánh giá khả biệt hóa TBGTM 41 Hình 3.15 Kết RT-PCR marker TBGTM 43 Hình 3.16 Cấu trúc mơ học nhuộm H&E Safranin O tế bào sụn 50 Hình 3.17 Kết nhuộm mơ học tế bào sụn từ kết hợp TBGTM mỡ màng chân bì 51 Hình 3.18 Cấu trúc mơ học nhộm H&E tế bào sụn đưa lên lần 52 Hình 3.19 Kết chụp tế bào sụn KHV điện tử quét (SEM) 53 DANH MỤC ĐỒ THỊ Đồ thị 3.1 Đường cong tăng trưởng tế bào TBGTM F3 38 Đồ thị 3.2: Biểu đồ thể mức độ biểu tương đối gien SOX9, COL2A1, COL10A1, RUNX2 phương pháp Realtime-PCR 47 MỞ ĐẦU Thối hóa khớp gối bệnh thường gặp Trên giới có khoảng 263 triệu người mắc bệnh [42] khoảng 20 % người trưởng thành từ 45 tuổi Mỹ chẩn đoán X-Quang nghiên cứu Framinham [50] Tại Việt Nam, tỷ lệ lưu hành bệnh thối hóa khớp gối X-quang 44,60 % người 40 tuổi [4] Tuy nhiên, tỷ lệ thối hóa khớp gối người trẻ ngày gia tăng gây ảnh hưởng tới khả vận động giảm đáng kể chất lượng sống người bệnh [11] Các phương pháp điều trị bệnh chủ yếu điều trị triệu chứng Trong trường hợp tổn thương nặng điều trị nội khoa khơng hiệu phẫu thuật thay khớp thường lựa chọn Phẫu thuật thay khớp gối phẫu thuật lớn nên đối mặt với vấn đề gồm nhiễm khuẩn, mổ lại, tử vong việc thay khớp gối nhân tạo có hạn chế tuổi thọ mảnh ghép, đặc biệt bệnh nhân trẻ tuổi [60], [10] Hiện có nhiều phương pháp khác để điều trị nhằm làm chậm, phục hồi kéo dài thời gian thay khớp tùy vào mức độ tổn thương bề mặt sụn khớp tiêm nội khớp, kích thích mọc sụn tạo tổn thương sụn có khơng kết hợp với ghép sụn xương Trong chiến lược phục hồi, sửa chữa tổn thương sụn khớp kỹ nghệ mơ cách tiếp cận đại có tiềm khắc phục nhược điểm phương pháp điều trị truyền thống Kỹ nghệ mơ sụn kết hợp ba thành phần quan trọng gồm tế bào, giá thể yếu tố sinh học để tái tạo, sửa chữa tạo mơ sụn giống với sụn bình thường để ứng dụng ghép sụn [32] Đối với yếu tố tế bào kỹ nghệ mơ sụn tế bào gốc ứng viên tuyệt vời để sử dụng chúng có đặc điểm mà tế bào khác khơng có khả tăng sinh tiềm biệt hóa Trong số loại tế bào gốc quan tâm tế bào gốc trung mô loại tế bào ưu tiên lựa chọn hàng đầu [23], [32] Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh xương tự thân điều trị thối hóa khớp gối, Đại học Y Hà Nội, Đại học Y Hà Nội, Hà Nội Tài liệu Tiếng Anh 11 Ackerman I N., Kemp J L., Crossley K M., Culvenor A G and Hinman R S (2017), "Hip and Knee Osteoarthritis Affects Younger People, Too", J Orthop Sports Phys Ther 47(2), pp 67-79 12 Ahmed T A and Hincke M T (2010), "Strategies for articular cartilage lesion repair and functional restoration", Tissue Eng Part B Rev 16(3), pp 305-329 13 Al-Himdani S., Jessop Z M., Al-Sabah A., Combellack E., Ibrahim A., Doak S H., Hart A M., Archer C W., Thornton C A and Whitaker I S (2017), "Tissue-Engineered Solutions in Plastic and Reconstructive Surgery: Principles and Practice", Front Surg 4, p 14 Bacakova L., Zarubova J., Travnickova M., Musilkova J., Pajorova J., Slepicka P., Kasalkova N S., Svorcik V., Kolska Z., Motarjemi H and Molitor M (2018), "Stem cells: their source, potency and use in regenerative therapies with focus on adipose-derived stem cells - a review", Biotechnol Adv 36(4), pp 1111-1126 15 Baer P C and Geiger H (2012), "Adipose-derived mesenchymal stromal/stem cells: tissue localization, characterization, and heterogeneity", Stem cells international 2012, pp 812693-812693 16 Bakhtina A., Tohfafarosh M., Lichtler A and Arinzeh T L (2014), "Characterization and differentiation potential of rabbit mesenchymal stem cells for translational regenerative medicine", In Vitro Cell Dev Biol Anim 50(3), pp 251260 17 Barretto L S., Lessio C., Sawaki e Nakamura A N., Lo Turco E G., da Silva C G., Zambon J P., Gozzo F C., Pilau E J and de Almeida F G (2014), "Cell kinetics, DNA integrity, differentiation, and lipid fingerprinting analysis of rabbit adipose-derived stem cells", In Vitro Cell Dev Biol Anim 50(9), pp 831-839 Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 18 Boquest A C., Shahdadfar A., Brinchmann J E and Collas P (2006), "Isolation of stromal stem cells from human adipose tissue", Methods Mol Biol 325, pp 35-46 19 Bornes T D., Adesida A B and Jomha N M (2014), "Mesenchymal stem cells in the treatment of traumatic articular cartilage defects: a comprehensive review", Arthritis Res Ther 16(5), p 432 20 Branam G M and Saber A Y (2020), "Osteochondral Autograft Transplantation", StatPearls, StatPearls Publishing Copyright © 2020, StatPearls Publishing LLC., Treasure Island (FL) 21 Brittberg M., Lindahl A., Nilsson A., Ohlsson C., Isaksson O and Peterson L (1994), "Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation", N Engl J Med 331(14), pp 889-895 22 Campos Y., Almirall A., Fuentes G., Bloem H L., Kaijzel E L and Cruz L J (2019), "Tissue Engineering: An Alternative to Repair Cartilage", Tissue Eng Part B Rev 25(4), pp 357-373 23 Chandra P K., Soker S and Atala A (2020), "Chapter - Tissue engineering: current status and future perspectives", in Lanza Robert, et al., Editors, Principles of Tissue Engineering (Fifth Edition), Academic Press, pp 1-35 24 Cui D., Daley W P., Fratkin J D., Haines D E., Lynch J C., Naftel J P and Yang G (2011), Atlas of histology: with functional and clinical correlations, Wolters Kluwer/Lippincott Williams & Wilkins 25 De Ugarte D A., Morizono K., Elbarbary A., Alfonso Z., Zuk P A., Zhu M., Dragoo J L., Ashjian P., Thomas B., Benhaim P., Chen I., Fraser J and Hedrick M H (2003), "Comparison of multi-lineage cells from human adipose tissue and bone marrow", Cells Tissues Organs 174(3), pp 101-109 26 Dehghani F and Fathi A (2017), "Challenges for Cartilage Regeneration", in Li Qing and Yiu-Wing Mai, Editors, Biomaterials for Implants and Scaffolds, Springer Berlin Heidelberg, Berlin, Heidelberg, pp 389-466 Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 27 Del Bakhshayesh A R., Asadi N., Alihemmati A., Tayefi N H., Montaseri A., Davaran S., Saghati S., Akbarzadeh A and Abedelahi A (2019), "An overview of advanced biocompatible and biomimetic materials for creation of replacement structures in the musculoskeletal systems: focusing on cartilage tissue engineering", Journal of biological engineering 13, pp 85-85 28 Dominici M., Le Blanc K., Mueller I., Slaper-Cortenbach I., Marini F., Krause D., Deans R., Keating A., Prockop Dj and Horwitz E (2006), "Minimal criteria for defining multipotent mesenchymal stromal cells The International Society for Cellular Therapy position statement", Cytotherapy 8(4), pp 315-317 29 Dong Chanjuan and Lv Yonggang (2016), "Application of Collagen Scaffold in Tissue Engineering: Recent Advances and New Perspectives", Polymers 8(2), p 42 30 Dubey N K., Mishra V K., Dubey R., Deng Yue-Hua, Tsai Feng-Chou and Deng Win-Ping (2018), "Revisiting the Advances in Isolation, Characterization and Secretome of Adipose-Derived Stromal/Stem Cells", International journal of molecular sciences 19(8), p 2200 31 Eto H., Suga H., Matsumoto D., Inoue K., Aoi N., Kato H., Araki J and Yoshimura K (2009), "Characterization of structure and cellular components of aspirated and excised adipose tissue", Plast Reconstr Surg 124(4), pp 1087-1097 32 Faust H J., Guo Q and Elisseeff J H (2019), "Chapter 53 - Cartilage Tissue Engineering", in Atala Anthony, et al., Editors, Principles of Regenerative Medicine (Third Edition), Academic Press, Boston, pp 937-952 33 Fernandes T L., Kimura H A., Pinheiro C C G., Shimomura K., Nakamura N., Ferreira J R., Gomoll A H., Hernandez A J and Bueno D F (2018), "Human Synovial Mesenchymal Stem Cells Good Manufacturing Practices for Articular Cartilage Regeneration", Tissue engineering Part C, Methods 24(12), pp 709-716 34 Ghosal K., Sarkar P., Saha R., Ghosh S and Sarkar K (2020), "Advances in Tissue Engineering and Regeneration", in Li Bingyun, et al., Editors, Racing for Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh the Surface: Antimicrobial and Interface Tissue Engineering, Springer International Publishing, Cham, pp 577-646 35 Gobbi A and Whyte G P (2019), "Long-term clinical outcomes of onestage cartilage repair in the knee with hyaluronic acid–based scaffold embedded with mesenchymal stem cells sourced from bone marrow aspirate concentrate", The American journal of sports medicine 47(7), pp 1621-1628 36 Gottipamula S., Muttigi M S., Kolkundkar U and Seetharam R N (2013), "Serum-free media for the production of human mesenchymal stromal cells: a review", Cell proliferation 46(6), pp 608-627 37 Gugjoo M B., Aithal H P., Kinjavdekar P and A (2019), "Cartilage Tissue Engineering: Role of Mesenchymal Stem Cells, Growth Factors, and Scaffolds", in Duscher Dominik and Melvin A Shiffman, Editors, Regenerative Medicine and Plastic Surgery: Skin and Soft Tissue, Bone, Cartilage, Muscle, Tendon and Nerves, Springer International Publishing, Cham, pp 249-262 38 Heath D E (2019), "A Review of Decellularized Extracellular Matrix Biomaterials for Regenerative Engineering Applications", Regenerative Engineering and Translational Medicine 5(2), pp 155-166 39 Hoffman T., Khademhosseini A and Langer R (2019), "Chasing the Paradigm: Clinical Translation of 25 Years of Tissue Engineering", Tissue engineering Part A 25(9-10), pp 679-687 40 Hogg P., Rooney P., Ingham E and Kearney J N (2013), "Development of a decellularised dermis", Cell Tissue Bank 14(3), pp 465-474 41 Irawan V., Sung Tzu-Cheng, Higuchi A and Ikoma T (2018), "Collagen Scaffolds in Cartilage Tissue Engineering and Relevant Approaches for Future Development", Tissue engineering and regenerative medicine 15(6), pp 673-697 42 James S L., Abate D., Abate K H., Abay S M, Abbafati C., Abbasi N., Abbastabar H., Abd-Allah F., Abdela J and Abdelalim A (2018), "Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh and injuries for 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017", Lancet 392(10159), pp 1789-1858 43 Jankowski Maurycy, Dompe Claudia, Sibiak Rafał, Wąsiatycz Grzegorz, Mozdziak Paul, Jaśkowski Jędrzej M., Antosik Paweł, Kempisty Bartosz and Dyszkiewicz-Konwińska Marta (2020), "In Vitro Cultures of Adipose-Derived Stem Cells: An Overview of Methods, Molecular Analyses, and Clinical Applications", Cells 9(8), p 1783 44 Khademhosseini A and Langer R (2016), "A decade of progress in tissue engineering", Nature Protocols 11(10), pp 1775-1781 45 Khalilifar M A., Baghaban E M R., Ghasemzadeh M., Hosseini S and Baharvand H (2019), "In Vitro and In Vivo Comparison of Different Types of Rabbit Mesenchymal Stem Cells for Cartilage Repair", Cell journal 21(2), pp 150-160 46 Komori T (2018), "Runx2, an inducer of osteoblast and chondrocyte differentiation", Histochem Cell Biol 149(4), pp 313-323 47 Kozhemyakina E., Lassar A B and Zelzer E (2015), "A pathway to bone: signaling molecules and transcription factors involved in chondrocyte development and maturation", Development (Cambridge, England) 142(5), pp 817-831 48 Kwon H J., Akimoto H., Ohmiya Y., Honma K and Yasuda K (2008), "Gene expression profile of rabbit cartilage by expressed sequence tag analysis", Gene 424(1-2), pp 147-152 49 Kwon H., Brown W E , Lee C A., Wang D., Paschos N., Hu J C and Athanasiou K A (2019), "Surgical and tissue engineering strategies for articular cartilage and meniscus repair", Nature Reviews Rheumatology 15(9), pp 550-570 50 Lawrence Reva C., Felson David T., Helmick Charles G., Arnold Lesley M., Choi Hyon, Deyo Richard A., Gabriel Sherine, Hirsch Rosemarie, Hochberg Marc C., Hunder Gene G., Jordan Joanne M., Katz Jeffrey N., Kremers Hilal Maradit, Wolfe Frederick and National Arthritis Data Workgroup (2008), "Estimates of the prevalence of arthritis and other rheumatic conditions in the United States Part II", Arthritis and rheumatism 58(1), pp 26-35 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 51 Lee S J., Lee C R., Kim K J., Ryu Y H., Kim E., Han Y N., Moon S H and Rhie J W (2020), "Optimal Condition of Isolation from an Adipose TissueDerived Stromal Vascular Fraction for the Development of Automated Systems", Tissue Eng Regen Med 17(2), pp 203-208 52 Lee Tao-Chen, Lee Tsung-Han, Huang Yu-Hua, Chang Nyuk-Kong, Lin Yu-Jun, Chien Pei-Wen Chang, Yang Wei-Hsun and Lin Martin Hsiu-Chu (2014), "Comparison of surface markers between human and rabbit mesenchymal stem cells", PloS one 9(11), pp e111390-e111390 53 Lefebvre V and Dvir-Ginzberg M (2017), "SOX9 and the many facets of its regulation in the chondrocyte lineage", Connective tissue research 58(1), pp 214 54 Liu Chia-Feng, Samsa William E., Zhou Guang and Lefebvre Véronique (2017), "Transcriptional control of chondrocyte specification and differentiation", Seminars in cell & developmental biology 62, pp 34-49 55 Livak K J and Schmittgen T D (2001), "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method", Methods 25(4), pp 402-408 56 Lu Z., Zhou S., Vaida J., Gao G., Stewart A., Parenti J., Yan L and Pei M (2020), "Unfavorable Contribution of a Tissue-Engineering Cartilage Graft to Osteochondral Defect Repair in Young Rabbits", Frontiers in cell and developmental biology 8, pp 595518-595518 57 Ma H., Yang Q., Li D and Liu J (2015), "Validation of suitable reference genes for quantitative polymerase chain reaction analysis in rabbit bone marrow mesenchymal stem cell differentiation", Mol Med Rep 12(2), pp 2961-2968 58 Mahomed M N., Beaver R J and Gross A E (1992), "The long-term success of fresh, small fragment osteochondral allografts used for intraarticular posttraumatic defects in the knee joint", Orthopedics 15(10), pp 1191-1199 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 59 Makris E A., Gomoll A H., Malizos K N., Hu J C and Athanasiou K A (2015), "Repair and tissue engineering techniques for articular cartilage", Nature Reviews Rheumatology 11(1), pp 21-34 60 McDermott A G., Langer F., Pritzker K P and Gross A E (1985), "Fresh small-fragment osteochondral allografts Long-term follow-up study on first 100 cases", Clin Orthop Relat Res(197), pp 96-102 61 Medvedeva E V., Grebenik E A., Gornostaeva S N., Telpuhov V I., Lychagin A V., Timashev P S and Chagin A S (2018), "Repair of Damaged Articular Cartilage: Current Approaches and Future Directions", International journal of molecular sciences 19(8), p 2366 62 Mendibil U., Ruiz-Hernandez R., Retegi-Carrion S., Garcia-Urquia N., Olalde-Graells B and Abarrategi A (2020), "Tissue-Specific Decellularization Methods: Rationale and Strategies to Achieve Regenerative Compounds", International journal of molecular sciences 21(15), p 5447 63 Meng F G., Zhang Z Q., Huang G X., Chen W S., Zhang Z J., He A S and Liao W M (2016), "Chondrogenesis of mesenchymal stem cells in a novel hyaluronate-collagen-tricalcium phosphate scaffolds for knee repair", Eur Cell Mater 31, pp 79-94 64 Mescher A (2016), Junqueira's Basic Histology Text & Atlas (14th ed.), McGraw Hill Education 65 Mizuno H., Takeda A and Uchinuma E (1999), "Creation of an acellular dermal matrix from frozen skin", Aesthetic Plast Surg 23(5), pp 316-322 66 Moradi L., Vasei M., Dehghan M M., Majidi M., Farzad Mohajeri S and Bonakdar S (2017), "Regeneration of meniscus tissue using adipose mesenchymal stem cells-chondrocytes co-culture on a hybrid scaffold: In vivo study", Biomaterials 126, pp 18-30 67 Neo P Y., See E Y., Toh S L and Goh J C (2016), "Temporal profiling of the growth and multi-lineage potentiality of adipose tissue-derived mesenchymal stem cells cell-sheets", J Tissue Eng Regen Med 10(7), pp 564-579 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 68 Ogura T., Bryant T and Minas T (2017), "Long-term Outcomes of Autologous Chondrocyte Implantation in Adolescent Patients", Am J Sports Med 45(5), pp 1066-1074 69 Oh Se-Joon, Park Hee-Young, Choi Kyung-Un, Choi Sung-Won, Kim Sung-Dong, Kong Soo-Keun and Cho Kyu-Sup (2018), "Auricular Cartilage Regeneration with Adipose-Derived Stem Cells in Rabbits", Mediators of inflammation 2018, pp 4267158-4267158 70 Oikonomopoulos A., van Deen W K., Manansala A R., Lacey P N., Tomakili T A., Ziman A and Hommes D W (2015), "Optimization of human mesenchymal stem cell manufacturing: the effects of animal/xeno-free media", Sci Rep 5, p 16570 71 Palumbo P., Lombardi F., Siragusa G., Cifone M G., Cinque B and Giuliani M (2018), "Methods of Isolation, Characterization and Expansion of Human Adipose-Derived Stem Cells (ASCs): An Overview", International journal of molecular sciences 19(7), p 1897 72 Pittenger M F., Mackay A M., Beck S C., Jaiswal R K., Douglas R., Mosca J D., Moorman M A., Simonetti D W., Craig S and Marshak D R (1999), "Multilineage potential of adult human mesenchymal stem cells", Science 284(5411), pp 143-147 73 Pösel C., Möller K., Fröhlich W., Schulz I., Boltze J and Wagner DanielChristoph (2012), "Density gradient centrifugation compromises bone marrow mononuclear cell yield", PloS one 7(12), pp e50293-e50293 74 Raposio E and Bertozzi N (2017), "How to isolate a ready-to-use adiposederived stem cells pellet for clinical application", Eur Rev Med Pharmacol Sci 21(18), pp 4252-4260 75 Riis S., Nielsen F M., Pennisi C P., Zachar V and Fink T (2016), "Comparative Analysis of Media and Supplements on Initiation and Expansion of Adipose-Derived Stem Cells", Stem cells translational medicine 5(3), pp 314-324 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 76 Roxburgh J., Metcalfe A D and Martin Y H (2016), "The effect of medium selection on adipose-derived stem cell expansion and differentiation: implications for application in regenerative medicine", Cytotechnology 68(4), pp 957-967 77 Sart S., Jeske R., Chen X., Ma T and Li Y (2020), "Engineering Stem CellDerived Extracellular Matrices: Decellularization, Characterization, and Biological Function", Tissue Eng Part B Rev 26(5), pp 402-422 78 Shasha N., Krywulak S., Backstein D., Pressman A and Gross A E (2003), "Long-term follow-up of fresh tibial osteochondral allografts for failed tibial plateau fractures", J Bone Joint Surg Am 85-A Suppl 2, pp 33-39 79 Shimojo A A M., Rodrigues I C P., Perez A G M., Souto E M B., Gabriel L P and Webster T (2020), "Scaffolds for Tissue Engineering: A State-ofthe-Art Review Concerning Types, Properties, Materials, Processing, and Characterization", in Li Bingyun, et al., Editors, Racing for the Surface: Antimicrobial and Interface Tissue Engineering, Springer International Publishing, Cham, pp 647-676 80 Si Z., Wang X., Sun C., Kang Y., Xu J., Wang X and Hui Y (2019), "Adipose-derived stem cells: Sources, potency, and implications for regenerative therapies", Biomed Pharmacother 114, p 108765 81 Strem B M., Hicok K C., Zhu M., Wulur I., Alfonso Z., Schreiber R E., Fraser J K and Hedrick M H (2005), "Multipotential differentiation of adipose tissue-derived stem cells", Keio J Med 54(3), pp 132-141 82 Suman S., Domingues A., Ratajczak J and Ratajczak M Z (2019), "Potential Clinical Applications of Stem Cells in Regenerative Medicine", Adv Exp Med Biol 1201, pp 1-22 83 Takeda H., Nakagawa T., Nakamura K and Engebretsen L (2011), "Prevention and management of knee osteoarthritis and knee cartilage injury in sports", British Journal of Sports Medicine 45(4), p 304 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 84 Tan Sik-Loo, Ahmad T S., Selvaratnam L and Kamarul T (2013), "Isolation, characterization and the multi-lineage differentiation potential of rabbit bone marrow-derived mesenchymal stem cells", Journal of anatomy 222(4), pp 437450 85 Tapp H., Hanley E N., Jr., Patt J C and Gruber H E (2009), "Adiposederived stem cells: characterization and current application in orthopaedic tissue repair", Exp Biol Med (Maywood) 234(1), pp 1-9 86 Tirpáková M., Vašíček J., Svoradová A., Baláži A., Tomka M., Bauer M., Makarevich A and Chrenek P (2021), "Phenotypical Characterization and Neurogenic Differentiation of Rabbit Adipose Tissue-Derived Mesenchymal Stem Cells", Genes (Basel) 12(3) 87 Tomlins P (2013), "6 - Standards in cell and tissue engineering", in Salih Vehid, Editor, Standardisation in Cell and Tissue Engineering, Woodhead Publishing, pp 107-126 88 Valdivia Zúñiga C A and De Cicco F L (2020), "Osteochondral Allograft", StatPearls, StatPearls Publishing Copyright © 2020, StatPearls Publishing LLC., Treasure Island (FL) 89 Van Pham P., Bui K H., Ngo D Q., Vu N B., Truong N H., Phan N L., Le D M., Duong T D., Nguyen T D., Le V T and Phan N K (2013), "Activated platelet-rich plasma improves adipose-derived stem cell transplantation efficiency in injured articular cartilage", Stem Cell Research and Therapy 4(4), p 91 90 Van Pham P., Bui Khanh Hong-Thien, Duong T D., Nguyen N T., Nguyen T D., Le V T., Mai V T., Phan Nhan Lu-Chinh, Le D M and Ngoc N K (2014), "Symptomatic knee osteoarthritis treatment using autologous adipose derived stem cells and platelet-rich plasma: a clinical study", Biomedical Research and Therapy 1(1) 91 Van Pham P and Vu Ngoc B (2016), "In vitro expansion of mesenchymal stem cells for clinical use", Progress in Stem Cell 3(02), pp 87-96 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 92 Vašíček J., Kováč M., Baláži A., Kulíková B., Tomková M., Olexiková L., Čurlej J., Bauer M., Schnabl S., Hilgarth M., Hubmann R., Shehata M., Makarevich A V and Chrenek P (2020), "Combined approach for characterization and quality assessment of rabbit bone marrow-derived mesenchymal stem cells intended for gene banking", N Biotechnol 54, pp 1-12 93 Wang Y., Xu Y., Zhou G., Liu Y and Cao Y (2021), "Biological Evaluation of Acellular Cartilaginous and Dermal Matrixes as Tissue Engineering Scaffolds for Cartilage Regeneration", Frontiers in cell and developmental biology 8, pp 624337-624337 94 Wilson A., Chee M., Butler P and Boyd A S (2019), "Isolation and Characterisation of Human Adipose-Derived Stem Cells", Methods Mol Biol 1899, pp 3-13 95 Wuelling M and Vortkamp A (2016), "Molecular control of cartilage differentiation", Cartilage, Springer, pp 191-213 96 Ye K., Traianedes K., Choong P F M and Myers D E (2016), "Chondrogenesis of Human Infrapatellar Fat Pad Stem Cells on Acellular Dermal Matrix", Frontiers in surgery 3, pp 3-3 97 Ye K., Traianedes K., Robins S A., Choong P F M and Myers D E (2018), "Osteochondral repair using an acellular dermal matrix-pilot in vivo study in a rabbit osteochondral defect model", J Orthop Res 36(7), pp 1919-1928 98 Zachar V., Rasmussen J G and Fink T (2011), "Isolation and growth of adipose tissue-derived stem cells", Methods Mol Biol 698, pp 37-49 99 Zhang Z., Kang Y., Zhang Z., Zhang H., Duan X., Liu J., Li X and Liao W (2012), "Expression of microRNAs during chondrogenesis of human adiposederived stem cells", Osteoarthritis Cartilage 20(12), pp 1638-1646 100 Zomer H D., Roballo K C., Lessa T B., Bressan F F., Gonỗalves N N., Meirelles F V., Trentin A G and Ambrósio C E (2018), "Distinct features of rabbit and human adipose-derived mesenchymal stem cells: implications for biotechnology and translational research", Stem Cells Cloning 11, pp 43-54 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh 101 Zuk P A., Zhu M., Mizuno H., Huang J., Futrell J W., Katz A J., Benhaim P., Lorenz H P and Hedrick M H (2001), "Multilineage cells from human adipose tissue: implications for cell-based therapies", Tissue Eng 7(2), pp 211-228 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh PHỤ LỤC Phụ lục 1: Trình tự mồi sử dụng nghiên cứu Gien F R F Sox-9 R F Col I R F Col II R F Col X R F Aggrecan R F Runx2 R F CD14 R F CD34 R F CD44 R F CD45 R F CD73 R F CD90 R F CD105 R F CD106 R Gapdh Trình tự mồi (5’ – 3’) AGACACGATGGTGAAGGTCG CTTGCCGTGGGTGGAATCAT AGCTCACCAGACCTTGAGAC GTTGGGTACCAGTTGCCTTC CAATGGTGGCACCCAGTTTG GTGCAGCCATCGACAAGAAC GGCTGGAGGATTTGACGAGA CCAGGGTTGCCTTGAAATCC GTCCTTCTGGACCACCAGGA GGCTTCCCAGTGGCTGATAG TGGGTGTCAGGACCGTGTAC CGTCTGGACCGTGATGTGGT GATGACACTGCCACTTCTGAC GTGGCTGGATAGTGCATTCG TGCCTAAGGGACTGCCTG CAGGGACCAGGAACGGATT CATCCTGGGCACTACTGGC GCATGTGCAGACTCCTTTCC AGGTTTGGTGGAAGACCTGG CTTCCTCCTCTGCCATGAGT CAATTACCTGGACACCTCCTC CTGACAGCTTGAAGCACTTC GAGCTCACGATCCTGCACAC CTTGGCGGATCTGTTGCACT CTCTGTGCTCAGAGACAAGC CCAACCAGTCACAGGGAAAG CGCTCTGGTGCATCTACTCG CGATGCTGTGGTTCGTGCT TCCCCGAATCCAGATCTCTTGC CTCGCTCCTCACCTTCCCAT Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn Độ dài sản phẩm (bp) 164 197 258 135 100 155 165 132 115 162 221 142 135 108 134 Tham khảo NM_001082253.1 XM_008271763.2 NM_001195668.1 NM_001195671.1 XM_002714724.3 XM_008251723.2 XM_008262992.2 NM_001082195.2 XM_008268472.2 XM_002709048.3 XM_008268698.2 XM_017345272.1 XM_002722718.3 XM_008251029.2 NM_001082152.1 Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh Phụ lục 2: Nhiệt độ bắt cặp cặp mồi cho gien đặc trưng tế bào gốc trung mô Gien Nhiệt độ bắt cặp (C) Gapdh CD14 CD34 CD45 CD44 CD73 CD90 CD105 CD106 57 57 57 55 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn 57 58 55 58 59 Bản quyền tài liệu thuộc Thư viện Đại học Y Dược TP.Hồ Chí Minh Phụ lục 3: Nhiệt độ bắt cặp cặp mồi cho gien đặc trưng tế bào gốc trung mô Gien Nhiệt độ bắt cặp (C) GAPDH 57 SOX9 56 Tuân thủ Luật sở hữu trí tuệ Quy định truy cập tài liệu điện tử Ghi rõ nguồn tài liệu trích dẫn COL2A1 56.5 COL10A1 58 RUN2X 56