Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc

Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? Carsten Wrenger and Sylke Mu¨ ller Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, UK Erythrocytic stages of the malaria parasite Plasmodium fal- ciparum rely on glycolysis for their energy supply and it is unclear whether they obtain energy via mitochondrial res- piration albeit enzymes of the tricarboxylic acid (TCA) cycle appear to be expressed in these parasite stages. Isocitrate dehydrogenase (ICDH) is either an integral part of the mitochondrial TCA cycle or is involved in providing NADPH for reductive reactions in the cell. The gene enco- ding P. falciparum ICDH was cloned and analysis of the deduced amino-acid sequence revealed that it possesses a putative mitochondrial targeting sequence. The protein is very similar to NADP + -dependent mitochondrial counter- parts of higher eukaryotes but not Escherichia coli. Expres- sion of full-length ICDH generated recombinant protein exclusively expressed in inclusion bodies but the removal of 27 N-terminal amino acids yielded appreciable amounts of soluble ICDH consistent with the prediction that these res- idues confer targeting of the native protein to the parasites’ mitochondrion. Recombinant ICDH forms homodimers of 90 kDa and its activity is dependent on the bivalent metal ions Mg 2+ or Mn 2+ with apparent K m values of 13 l M and 22 l M , respectively. Plasmodium ICDH requires NADP + as cofactor and no activity with NAD + was detectable; the K app m for NADP + was found to be 90 l M and that of D -isocitrate was determined to be 40 l M . Incubation of P. falciparum under exogenous oxidative stress resulted in an up-regulation of ICDH mRNA and protein levels indi- cating that the enzyme is involved in mitochondrial redox control rather than energy metabolism of the parasites. Keywords: isocitrate dehydrogenase; redox control; mito- chondrion; malaria; energy metabolism; oxidative stress. Isocitrate dehydrogenase (ICDH) occurs in multiple iso- forms in eukaryotes, whereas Escherichia coli possesses a single NADP + -dependent ICDH [1–4]. The eukaryotic enzymes are not only structurally distinct but they also rely on different cofactors for catalysis and are localized in different compartments of the cell [5–8]. The reaction of ICDH generates NAD(P)H and 2-oxoglutarate. The latter is shuttled either into the tricarboxylic acid cycle (TCA cycle) or is metabolized to glutamate, depending on the localization of the respective isoform of ICDH. NAD + - dependent ICDH are localized in the mitochondria and are an essential part of the TCA cycle [3,6]. They form octamers consisting of three different subunits [3,9] and are allosteri- cally responsive to the energy charge (adenine nucleotides andNADH)ofthecell[10].NADP + -dependent ICDH have been found in mitochondria, cytosol and peroxisomes. They generally are homodimers and their physiological role is less well understood. It is believed that they are important to provide NADPH essential for reductive reactions such as lipid biosynthesis and reduction of hydroperoxides [11–14]. Plasmodium falciparum is the causative agent of malaria tropica, one of the most devastating tropical diseases. The parasites go through a complex life cycle and the erythro- cytic stages of P. falciparum are responsible for the patho- logy in humans. In order to survive the pro-oxidant environment within the human erythrocytes, the parasites possess efficient antioxidant and redox systems such as the glutathione and thioredoxin cycles [15–18]. Both redox systems require NADPH, which usually is provided by the pentose phosphate shunt via glucose-6-phosphate dehydrogenase. This enzyme is present in P. falciparum but its activity was found to be low and is probably not the major source of NADPH in the parasites [19]. It was postulated that in P. falciparum NADPH is mainly provi- ded by glutamate dehydrogenase and potentially a NADP + -dependent ICDH [19–21]. ICDH from P. falcipa- rum was partially purified previously and some of its characteristics were determined but the physiological rele- vance of the enzyme was not entirely understood because the source of isocitrate appeared to be unknown [19]. However, recently a gene encoding for an aconitase-like protein was isolated from the parasites possibly providing the substrate for P. falciparum ICDH [22]. It is well established, that the erythrocytic stages of the malaria parasite rely mainly on glycolysis for their energy supply rather than on mitochondrial respiration [23,24]. However, the release of the entire P. falciparum genome sequence revealed that the parasites possess the genes for the enzymes involved in the TCA cycle [25] but whether this route of energy metabolism is essential for the erythrocytic stages of the parasites remains unclear. As no homologous genes for an NAD + -dependent ICDH could be identified Correspondence to S. Mu ¨ ller, Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, Dundee DD1 5EH, UK. Fax: + 44 1382 345764, Tel.: + 44 1382 345760, E-mail: s.muller@dundee.ac.uk Abbreviations: ICDH, isocitrate dehydrogenase; ICDH-1, full length ICDH of P. falciparum; ICDH-2, truncated ICDH of P. falciparum; SOD, superoxide dismutase; TCA cycle, tricarboxylic acid cycle. (Received 11 December 2002, revised 17 February 2003, accepted 25 February 2003) Eur. J. Biochem. 270, 1775–1783 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03536.x in the parasite genome it is possible that NADP + -dependent ICDH in P. falciparum is involved in both, energy metabo- lism and redox control. In this study we have cloned and recombinantly expressed ICDH of P. falciparum,estab- lished its biochemical characteristics and propose a possible function for the parasite enzyme. Materials and methods Materials Cloning vectors pASK-IBA 7 and pASK-IBA 3, Strep- Tactin–Sepharose, anhydrotetracycline and desthiobiotine were from IBA, Go ¨ ttingen, Germany. Oligonucleotides were from Hybaid, UK. Enhanced Avian HS RT-PCR-20 kit was purchased from, Sigma, UK. [a- 32 P]dATP (6000 CiÆmmol )1 ) was from Amersham, UK. Cloning of P. falciparum ICDH The ICDH sequence was identified on chromosome 13 of P. falciparum using the human ICDH sequence (accession no. P48735) for a TBLASTN search of the PlasmoDB database (http://www.PlasmoDB.org). After we identified the gene, the Plasmodium genome consortium published the identical sequence under accession numbers CAD 52580 and NP_705343 [26]. According to nucleotide and deduced amino-acid sequences there are no introns within the ICDH gene so that the full-length gene was amplified by PCR using genomic DNA as a template. In order to verify this prediction, a reverse transcriptase PCR was also performed to isolate the cDNA encoding ICDH. Using the specific oligonucleotides (sense 5¢-GCGCGCGGTCTCCGCGCA TGGGAAAGCATATACGAATTTTAAAAAATCAAT ACC-3¢ and antisense 5¢-GCGCGCGGTCTCTATCA TTATGTTGAATGTTCTTGGGGAGC-3¢) containing BsaI restriction sites and Pfu polymerase (Stratgene), ICDH was amplified from both templates using the following PCR protocol: 3 min at 95 °C for 1 cycle followed by 35 cycles of 1 min at 95 °C, 1.5 min at 42 °C and 4 min at 60 °C. The approximately 1.4 kb PCR fragment, designated ICDH-1 was digested with BsaI and subcloned into pASK-IBA-7 previously digested with the same enzyme. The expression plasmid possesses an N-terminal Strep-tag that allows one- step purification of recombinant protein via Strep-Tactin– Sepharose that specifically binds the recombinant fusion protein [27]. An N-terminal truncated version (residue 82– 1404) of P. falciparum ICDH was amplified using the sequence specific oligonucleotides sense 5¢-GCGCGCG GTCTCGAATGAACATATGCGGTAAAATTAACGT AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI restriction sites and ICDH-1 as a template and the following PCR programme: 3 min at 95 °C for 1 cycle followed by 35 cycles of 1 min 95 °C, 1.5 min 42 °Cand4min68°C. The truncated 1.32 kb PCR fragment was designated ICDH-2 and was subcloned into pASK-IBA 3, an expression plasmid conferring recombinant expression of the protein with a C-terminal Strep-tag [28]. The nucleotide sequences of all PCR fragments and clones were determined by automated nucleotide sequencing using the automatic sequencer ABI 377 (Bio-Rad). Nucleotide and amino-acid analyses were performed using Vector NTI (Informax) or Generunner. Expression and purification of ICDH ICDH-1 and ICDH-2 were transformed into E. coli BLR (DE3) (Novagen) and a single colony of each was used to set up an overnight culture in Luria–Bertani medium containing 50 lgÆmL )1 ampicillin. The overnight cultures were diluted 1 : 50 into fresh Luria–Bertani medium containing the antibiotic and grown at 37 °C until the D 600 reached 0.5. Expression of the recombinant proteins was induced by addition of 200 ng of anhydrotetracycline. The bacteria were grown for an additional 4 h at 37 °C before they were harvested by centrifugation at 3480 g (Beckman J6-MC, JS-4.2). The bacterial pellets were resuspended in buffer W (100 m M Tris/HCl pH 8.0 containing 150 m M NaCl), the suspension was sonified (Soniprep 150, MSE) and subsequently centrifuged at 50 000 g for 1 h 30 min (Beckman Avanti J-25, JA 25.50). The resulting supernatants were applied to 1 mL of Strep-Tactin–Sepharose resin previously equilibrated with buffer W, washed with 10–15 column volumes of the same buffer before the specifically bound proteins were eluted using 5 mL of buffer W containing 5 m M desthio- biotine. The purity of the eluted proteins was assessed by SDS/PAGE. In order to analyse the oligomeric state of P. falciparum ICDH, recombinant ICDH-2 was applied to a Superdex S-200 gel sizing column (1.6 · 60 cm, Amersham) previously equilibrated with 50 m M potassium phosphate pH 8.0 containing 1 m M MgCl 2 (buffer A), buffer A containing 150 m M KCl or buffer A containing 150 m M KCl and 1 m M dithiothreitol using an A ¨ kta FPLC system (Amersham). The column was previously calibrated with the following gel filtration standards (Bio-Rad): thyro- globulin (670 kDa), bovine c-globulin (158 kDa), chicken ovalbumin (44 kDa), equine myoglobin (17 kDa) and vitamin B 12 (1.3 kDa), so that the apparent size of the Plasmodium protein could be assessed. Protein concentrations were estimated by the Bradford method using bovine serum albumin as a standard [29]. Characterization of recombinant ICDH-2 ICDH enzyme assays were performed at 30 °Cin25m M Mops buffer pH 8.0, containing 5 m M MgCl 2 and 100 m M NaCl, 2 m M NADP + and 4 m M D, L -isocitrate as described by [30]. The assay was initiated by addition of 0.3–1 lg recombinant enzyme and the increase in absorbance at 340 nm was followed spectrophotometrically (UV—2041 PC, Shimadzu). In order to determine the pH-optimum for the reaction, 50 m M Bicine/Bis Tris Propane/Mes buffers in the range between pH 5.5 and 10.0 were used and the standard assay was performed. As there are reports that the specific activity of ICDH is dependent on the buffer system used in vitro, the pH-optimum in 50 m M Mops buffer pH 7.0– 8.5 was also determined. It is known that ICDH requires bivalent metal ions for catalytic activity [31]. In order to establish which metals support enzymatic activity of P. falciparum ICDH, MgCl 2 , MnSO 4 ,CoCl 2 ,CuCl 2 , 1776 C. Wrenger and S. Mu ¨ ller (Eur. J. Biochem. 270) Ó FEBS 2003 NiSO 4 , ZnSO 4 or CaCl 2 , respectively, were used in the assay at 5 m M . The apparent K m values for NADP + , D -isocitrate, Mg 2+ and Mn 2+ were determined by using a rapid kinetics device attached to the spectrophotometer which allows to deter- mine time points every 10 ms. The assays were performed by varying the concentration of NADP + from 2 l M to 2m M at constant isocitrate concentration of 4 m M and Mg 2+ at 5 m M and varying the D , L -isocitrate concentration from 2 l M to 4 m M at 2 m M NADP + and Mg 2+ at 5 m M as well as varying the concentrations of Mg 2+ or Mn 2+ (4 l M to 150 l M ) at saturating concentrations of the other two substrates. The results were analysed using GraphPad PRISM (GraphPad software) and the apparent K m values were derived from the reciprocal Lineweaver–Burk plots. Isolation of nucleic acids from P. falciparum 3D7 erythrocytic stages Erythrocytic stages of P. falciparum at 4% haematocrit and 10–15% parasitaemia were isolated by saponin lysis according to [32]. Genomic DNA was isolated from the parasites according to Krnajski et al. 2002 [33]. Total RNA was isolated from the parasites using Trizol (Gibco BRL) or Tri-reagent (Sigma) according to the manufacturer’s instructions. Expression of ICDH in erythrocytic stages of P. falciparum According to previous reports [18] ICDH is expressed in erythrocytic stages of P. falciparum. In order to confirm these reports, a reverse transcriptase PCR was performed with total RNA of P. falciparum 3D7 as a template and specific oligonucleotides using the one-step procedure recommended for the Enhanced Avian HS RT-PCR-20 kit. To validate that no traces of genomic DNA were present in the RNA isolated from the parasites, a gene containing several introns (superoxide dismutase 2; acces- sion number: NP_703892) was also amplified as a control from RNA and genomic P. falciparum 3D7 DNA. Effect of oxidative stress on ICDH expression in P. falciparum erythrocytic stages Erythrocytic stages of P. falciparum (3D7) were cultured according to [34] with RPMI 1640 medium containing Hepes, 11 m M glucose (Invitrogen), 0.1% Albumax II (Invitrogen), 27.2 mgÆL )1 hypoxanthine and 20 mgÆL )1 gentamycin in A + human erythrocytes under a reduced oxygen atmosphere. Parasites were synchronized using 5% sorbitol according to [35]. 48 h after synchronization trophozoites (approximately 30–36 h) were oxidatively stressed with 50 mUÆmL )1 glucose oxidase for 3 h. In order to analyse whether the transcription levels of ICDH were increased, parasites were freed of erythrocytes by saponin lysis [32], the parasite pellet was resuspendend in Tri-reagent and total RNA was isolated as described above. Northern Blot analysis was performed as described by [36]. Ten micrograms of total RNA were separated by electrophoresis using a 1.5% agarose-gel containing 5 m M guanidine thiocyanate and subsequently transferred to a positively charged nylon membrane (Roche) with 7.5 m M NaOH as transfer buffer. The blot was hybridized with a radiolabelled ICDH-2 probe (Random Primed DNA Labeling Kit, Roche) in 7% SDS/0.5 M NaH 2 PO 4 ,pH7.2/2%dextran sulfate at 55 °C overnight. The membrane was washed three times in 75 m M NaCl, 7.5 m M sodium citrate, pH 7.0/0.1% SDS for 10 min at 55 °C. The signals were visualized by exposure to Hyperfilm (Amersham) overnight. Subse- quently the blot was re-probed with a superoxide dismutase 2 probe (accession no. NP_703892) and an 18-S rRNA probe as a loading control. In order to analyse whether protein levels were simulta- neously altered with mRNA levels in oxidatively stressed parasites, an aliquot of the parasite pellet obtained after saponin lysis was resuspended in NaCl/P i containing EDTA-free protease inhibitor cocktail (Roche) and lysed by freeze-thawing. Protein concentration was determined using the Bradford method [29]. Fifteen micrograms of protein extract of control and treated parasites was separ- ated on a 4–12% SDS/PAGE (Invitrogen) and subse- quently blotted onto nitrocellulose (Schleicher and Schuell). The blots were hybridized with polyclonal antibodies directed against ICDH-2 (1 : 400) and after incubation with a secondary anti rabbit horseradish peroxidase coupled antibody (Scottish Antibody Production Unit) (1 : 10 000) the blot was developed using the ECL + system from Amersham, according to manufacturer’s instructions. Results Analysis of P. falciparum ICDH sequence The BLAST search for an ICDH homologue in the P. falciparum genome database using a mammalian mito- chondrial NADP + -dependent ICDH sequence recognized a single sequence in the parasite genome located on chro- mosome 13. Recently the genome sequence of P. falciparum was released and the ICDH gene was annotated by the Plasmodium sequencing consortium [26]. According to their predictions and to our analyses, P. falciparum possess only one ICDH gene unlike other eukaryotes where several genes encoding ICDH are frequently found [1–3]. The open reading frame of the P. falciparum ICDH gene was cloned from genomic and cDNA of P. falciparum 3D7. It consists of 1407 nucleotides and encodes for a polypeptide of 468 amino acids. The deduced amino-acid sequence of P. falciparum ICDH shows a high degree of identity to the mitochondrial NADP + -dependent ICDH of mammals (55.3% to 57.7%) and yeast (46.6%) (Fig. 1) but has only little identity to E. coli ICDH (10.3%). Analysis of the deduced amino-acid sequence using the prediction pro- grammes available on the ExPaSy website (http://c.expasy. org/tools/) revealed that the Plasmodium protein possesses a putative mitochondrial targeting sequence (residues 1–27) suggesting that it is localized in the parasite mitochondrion [37]. All residues that are known to be involved in structure and catalytic activity of mammalian ICDH appear to be conserved in P. falciparum ICDH. In porcine ICDH the positive charges of the arginine residues Arg101, Arg110 and Arg133 are responsible for the binding of the isocitrate- metal ion complex to the protein and these residues correspond to Arg129, Arg138 and Arg161 in P. falciparum Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1777 ICDH [38]. In addition Asp252 and Asp275 were found to be important for the binding of the binary isocitrate-Mn 2+ complex in the mitochondrial porcine ICDH as shown by mutagenesisaswellasstructuralanalyses[39,40].The equivalent residues in P. falciparum ICDH are Asp281 and Asp301. The histidine and lysine residues equivalent to His315 and Lys374 of the porcine ICDH (His343 and Lys402 in P. f. ICDH) are also conserved in the parasite protein and these residues have been shown to be involved in interacting with the cofactor NADP + [41,42]. Recombinant expression of P. falciparum ICDH Two expression constructs of ICDH were generated and recombinantly expressed in E. coli BLR (DE3) cells. The full-length construct ICDH-1 conferred expression of recombinant ICDH exclusively in the bacterial pellet whereas construct ICDH-2 was expressed as a soluble protein in the bacteria. These results are consistent with our suggestion that the 27 N-terminal amino acid, which are lacking in construct ICDH-2, represent a mitochondrial targeting sequence which cannot be cleaved by the bacterial expression system and therefore results in miss folding of the recombinant protein. The yield of soluble recombinant ICDH-2 was 2 mgÆL )1 of bacterial cells. Affinity chroma- tography on Strep-Tactin–Sepharose resulted in 98% homogeneous protein that was used for all subsequent analyses (Fig. 2). The P. falciparum ICDH-2 monomer has a molecular mass of 51 kDa in agreement with the theoretical molecular mass of 51.6 kDa. In order to determine the oligomeric state of the protein it was subjected to gel filtration on Superdex S-200. Interestingly, it eluted in Fig. 1. Alignment of P. falciparum isocitrate dehydrogenase deduced amino-acid sequence. The deduced amino-acid sequence of P. falciparum ICDH (Pf) (accession number: NP_705343/CAD 52580) is aligned with those of Sus scrofa (Ss) (accession number: P33198), Homo sapiens (Hs) (accession number: 57499) and Saccharomyces cerevisiae (Sc) (accession number: P21954). Identical amino acids are shaded in black; homologous amino acids are shaded in grey. An arrowhead indicates the potential cleavage site for the mitochondrial target sequence in the P. falciparum sequence. Amino acids known to be involved in the binding and interaction of ICDH with cofactors and substrates are indicated by *. 1778 C. Wrenger and S. Mu ¨ ller (Eur. J. Biochem. 270) Ó FEBS 2003 two peaks: one corresponding to a homodimer of 90 kDa and one corresponding to a homotetramer of 210 kDa (Fig. 3). Both peaks were found to contain active ICDH-2 enzyme. In order to test whether hydrophobic interactions with the column matrix were responsible for the delayed elution of a portion of the protein, 150 m M KCl was added to the equilibration and elution buffer. The enzyme activities still eluted in two peaks at 90 and 210 kDa. Only addition of 1 m M dithiothreitol to the buffer led to elution of the protein in a single peak suggesting that the reducing agent releases sulfhydryl bonds that have formed between the homodimers during the purification procedure (Fig. 3). Therefore we presume that P. falciparum ICDH-2 forms homodimers as has been reported for the native enzyme partially purified from P. falciparum [19], which also tend to form enzymatic active tetramers in the absence of reducing agents. Characteristics of P. falciparum ICDH P. falciparum ICDH-2isspecificforNADP + and does not accept NAD + at detectable rates. The K m app for NADP + was determined to be 90 l M and that for D -isocitrate was found to be 40 l M (Table 1). In order to determine the apparent K m for D -isocitrate, the concentration for Fig. 2. SDS/PAGE of recombinant P. falciparum isocitrate dehydro- genase. P. falciparum ICDH-2 was expressed in BLR (DE3) and subsequently purified as described in Materials and methods. Purity of the recombinant protein was assessed by SDS/PAGE. 1, 10 lgof bacterial pellet; 2, 10 lg of bacterial supernatant prior to loading to Strep-Tactin–Sepharose; 3, 10 lg of flow-through after Strep-Tactin– Sepharose; 4, 3 lg of ICDH-2 after Strep-Tactin–Sepharose; 5, 1 lgof ICDH-2 after gel filtration on Superdex S-200. Fig. 3. Oligomeric state of P. falciparum isocitrate dehydrogenase. (A) Recombinant ICDH-2 was separated on a Superdex S-200 gel sizing column using buffer A without (—) and with addition of 1 m M dithiothreitol (––). Enzyme activity (j) corresponds to both, the 210 kDa and 90 kDa peaks. (B) Twenty microlitres of the elution fractions indicated were analysed by Western blotting and the results confirm the presence of recombinant proteininbothpeakfractionsthatalsocon- tain enzyme activity. Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1779 D -isocitrate in the commercially available mixture of D , L -isocitrate was established prior performing the assay according to [30]. The specific activity of ICDH-2 at saturation of all three substrates and cofactors was found to be 162.5 ± 22.1 UÆmg )1 with a k cat of 138 s )1 (Table 1), which is about 2–4 times higher than that reported for other eukaryotic NADP + -dependent ICDH [38,41] but in the same range as the bacterial ICDH [30]. The recombinant protein had a pH-optimum of 8.0 in both, Bicine/Bis Tris Propane/Mes and Mops buffer, which is higher than that determined for the native enzyme, which was reported to be at pH 7.5 [19]. As all other ICDH the Plasmodium enzyme is dependent on bivalent metal ions such as Mg 2+ and Mn 2+ . A number of metal ions were tested with the parasite ICDH and Mg 2+ was found to stimulate activity most efficiently followed by Mn 2+ . All other tested metal ions had no or only marginal effects on the enzyme activity. Therefore the K app m for Mg 2+ and Mn 2+ were determined and found to be 13 l M and 21 l M , respectively, which is about 10 times higher than that determined for Mn 2+ for the pig mito- chondrial enzyme [41]. Expression of ICDH in erythrocytic stages of P. falciparum In order to establish that ICDH is indeed expressed in the erythrocytic stages of P. falciparum, a reverse-transcriptase PCR was performed using total RNA isolated from P. falciparum 3D7. As a quality control for the RNA preparation the gene and cDNA of superoxide dismutase 2, which contains several introns were also amplified. As shown in Fig. 4, the PCR resulted in amplification of 1.4 kb bands from cDNA and genomic DNA indicating that the ICDH gene is expressed in erythrocytic stages of P. falci- parum and that it indeed does not contain any introns as also verified by sequence analysis of the PCR product obtained from cDNA. Further the control PCR verifies that the RNA preparation used for this PCR was not contami- nated with traces of DNA, as only the 0.7 kb band expected for the amplification of superoxide dismutase 2 cDNA is visible whereas in the control lane with genomic DNA the superoxide dismutase 2 PCR product is larger (1.5 kb) consistent with the presence of introns in the gene (Fig. 4). Expression of P. falciparum ICDH under enhanced oxidative stress Northern and Western blot analyses of P. falciparum total RNA and protein extracts clearly show, that the ICDH transcript as well as protein level are elevated when parasites were stressed with glucose oxidase for a 3-h period (Fig. 5). These results strongly indicate that in P. falciparum mito- chondrial ICDH is involved in the protection of the parasite mitochondria from oxidative injury by providing reducing equivalents for antioxidant processes required to prevent damage of the organelle. Table 1. Properties of P. falciparum isocitrate dehydrogenase. The properties of recombinant P. falciparum ICDH were determined as described in the Materials and methods section. For native ICDH the data was from reference [19], no standard deviations are given in this reference. For pig mitochondrial ICDH the data was from [38,48]. ND, not determined. Recombinant ICDH Native ICDH Pig mitochondrial ICDH K app m NADP + (l M ) 90 ± 8 80 5.6 ± 0.4 K app m D -isocitrate (l M ) 40 ± 8 150 8.4 ± 0.9 K app m Mg 2+ (l M )13±1 ND ND K app m Mn 2+ (l M ) 21 ± 2 ND 0.33 ± 0. 02 NAD + >2 m M ND Specific activity (UÆmg )1 ) 162 ± 22 0.0096 37.8 ± 4.7 k cat (s )1 ) 138 ND 29.4 Metal Mg 2+ >Mn 2+ >Co 2+ Mg 2+ >Mn 2+ Mn 2+ >Cd 2+ >Zn 2+ >Co 2+ >Mg 2+ pH optimum 8.0 7.5 7.4 Subunit size (kDa) 51 40 46.6 Oligomeric state Homodimer Homodimer Homodimer Fig. 4. Reverse transcriptase PCR. In order to verify that P. falcipa- rum ICDH is expressed in erythrocytic stages of P. falciparum 3D7, a reverse transcriptase PCR using total RNA isolated from these para- site stages was performed as described in Materials and methods. SOD + DNA, PCR was performed using the SOD-2 primers with P. falciparum genomic DNA as template; SOD + RNA, PCR was performed using the SOD-2 primers with RNA as template; ICDH – DNA, PCR was performed without any template DNA or RNA (negative control); ICDH + RNA, PCR was performed using ICDH primers with RNA as template; ICDH + DNA, PCR was performed using ICDH primers with DNA as template. 1780 C. Wrenger and S. Mu ¨ ller (Eur. J. Biochem. 270) Ó FEBS 2003 Discussion The malaria parasite P. falciparum appears to possess only one NADP + -dependent ICDH with very little homology to the E. coli but a high degree of amino-acid identity to NADP + -dependent ICDH from eukaryotes. There appear to be no genes present in the parasite’s genome encoding for the subunits of an NAD + -dependent ICDH [25,26] repre- senting the enzyme form responsible for providing 2-oxoglutarate in the TCA cycle in eukaryotes [3,6]. The precise physiological roles of NADP + -dependent ICDH in eukaryotes are not entirely clear but there are several reports that the enzymes are responsible for the supply of reducing equivalents for a variety of reductive reactions [11–14]. Peroxisomal ICDH provides NADPH for enzymes involved in the oxidation of unsaturated fatty acids such as 2,4-dienoyl-CoA reductase [11,12], hydroxymethylglutaryl- CoA reductase [43] and acyl-CoA reductase [44]. In addition 2-oxoglutarate in peroxisomes is required by phytanoyl- CoA a-hydroxylase [45]. In mitochondria ICDH is thought to provide NADPH for antioxidant enzymes such as glutathione reductase and thioredoxin reductase, which are pivotal parts of the cell’s antioxidant defence system [13]. The N-terminal 27 amino acids of P. falciparum ICDH were predicted to encode a mitochondrial targeting sequence. Consistent with this prediction it was necessary to remove these amino acids before obtaining soluble recombinant protein in the E. coli expression system used in this study. However, further studies are required to unambiguously show that the enzyme localizes to the parasite’s mitochondrion considering reports about the localization of proteins such as DNA ligase III which possesses a mitochondrial targeting sequence but also is found in the cytosol and nucleus of the cell [46]. Fig. 5. Expression levels of ICDH in oxidatively stressed P. falciparum. (A) Northern blot analysis of P. falciparum ICDH. (a) 10 lgoftotalRNA from control parasites (b) 10 lg of total RNA from parasites treated with 50 mUÆmL )1 glucose oxidase for 3 h. The blot was hybridized with radiolabelled ICDH-2 or superoxide dismutase 2 (B), respectively, and exposed for 48 h. (C) The 18 S rRNA loading control shows that the same amount of RNA of both (a) untreated and (b) treated parasites was loaded onto the gel. (D) Western blot of parasite proteins probed with anti- ICDH antiserum at 1 : 400 dilution detected by the ECL + system; (a) untreated parasites and (b) treated parasites. Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1781 The recombinant truncated P. falciparum ICDH shows a clear preference for NADP + as a cofactor although its K app m wasratherhighwith90l M . This low affinity for the cofactor NADP + was also observed for one of the human isoenzymes and the E. coli ICDH also appears to show a lower affinity for NADP + [8,11,47]. The K app m for NADP + determined for the native enzyme is in the same range as that of the recombinant protein [19]. Interestingly the specific activity of the recombinant P. falciparum ICDH is about 4 fold higher than that reported for the porcine mitochondrial enzyme but in the same range as the bacterial enzyme [30,38,41]. P. falciparum ICDH shows preference for Mg 2+ and Mn 2+ and apart from Co 2+ , none of the other metal ions tested had any effect on the enzyme activity. In contrast porcine ICDH is activated by a wide range of metal ions with Mn 2+ having the most pronounced effect on the enzyme activity [31]. Similar to other NADP + - dependent ICDH, the P. falciparum protein forms dimers as shown by gel filtration of recombinant ICDH on Sephadex S-200 although without addition of reducing agents homo- tetrameric forms of the enzyme were also observed. As P. falciparum ICDH is clearly NADP + -dependent and shows no activity with NAD + it is unlikely that it is an essential part of the parasite’s TCA cycle. This suggestion is consistent with the finding that in yeast the disruption of the NAD + -dependent ICDH gene could not be compensated by overexpressing the mitochondrial NADP + -dependent enzyme in the null mutants [6] indicating distinct roles for both enzymes. If the parasite ICDH is not or only marginally involved in energy metabolism, it is an attractive hypothesis that its major role is the maintenance of the intramitochondrial redox balance as it was shown for mouse mitochondrial NADP + -dependent ICDH [13]. In order to analyse this potential function of the P. falciparum enzyme, parasites were exposed to oxidative stress followed by Northern blot and Western blot analyses of the ICDH mRNA and protein levels. Interestingly both, ICDH transcript and protein levels are up-regulated in oxidatively stressed parasites suggesting that NADP + -dependent ICDH in P. falciparum erythrocytic stages is a mitochon- drial protein that is important for the maintenance of the organelle’s redox state and that it is most likely not crucially involved in energy metabolism during the erythrocytic life stages of P. falciparum. Acknowledgements C. W. is a Wellcome Trust Travelling Research Fellow (067363/Z/02/Z) andS.M.isaWellcomeTrustSeniorFellow. References 1. Plaut, G.W. & Aogaichi, T. (1967) The separation of DPN-linked and TPN-linked isocitrate dehydrogenase activities of mammalian liver. Biochem. Biophys. Res. Commun. 28, 628–634. 2. Giorgio, N.A. Jr, Yip, A.T., Fleming, J. & Plaut. G.W. (1970) Diphosphopyridine nucleotide-linked isocitrate dehydrogenase from bovine heart. Polymeric forms and subunits. J. Biol. Chem. 245, 5469–5477. 3. Ramachandran, N. & Colman, R.F. (1980) Chemical character- ization of distinct subunits of pig heart DPN-specific isocitrate dehydrogenase. J. Biol. Chem. 255, 8859–8864. 4. Borthwick, A.C., Holms, W.H. & Nimmo, H.G. (1984) Isolation of active and inactive forms of isocitrate dehydrogenase from Escherichia coli ML 308. Eur. J. Biochem. 141, 393–400. 5. Reeves, H.C., Daumy, G.O., Lin, C.C. & Houston, M. (1972) NADP + -specific isocitrate dehydrogenase of Escherichia coli.I. Purification and characterization. Biochim. Biophys. Acta 258, 27–39. 6. Haselbeck, R.J. & McAlister-Henn, L. (1993) Function and expression of yeast mitochondrial NAD- and NADP-specific isocitrate dehydrogenases. J. Biol. Chem. 268, 12116–12122. 7. Zhao, W.N. & McAlister-Henn, L. (1996) Assembly and function of a cytosolic form of NADH-specific isocitrate dehydrogenase in yeast. J. Biol. Chem. 271, 10347–10352. 8. Geisbrecht, B.V. & Gould, S.J. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP (+) -dependent isocitrate dehydrogenase. J. Biol. Chem. 274, 30527–30533. 9. Keys, D.A. & McAlister-Henn, L. (1990) Subunit structure, expression, and function of NAD (H) -specific isocitrate dehy- drogenase in Saccharomyces cerevisiae. J. Bacteriol. 172, 4280– 4287. 10. Barnes, L.D., McGuire, J.J. & Atkinson, D.E. (1972) Yeast diphosphopyridine nucleotide specific isocitrate dehydrogenase. Regulation of activity and unidirectional catalysis. Biochemistry 11, 4322–4329. 11. Henke, B., Girzalsky, W., Berteaux-Lecellier, V. & Erdmann, R. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J. Biol. Chem. 273, 3702–3711. 12. van Roermund, C.W., Hettema, E.H., Kal, A.J., van den Berg, M., Tabak, H.F. & Wanders, R.J. (1998) Peroxisomal beta-oxi- dation of polyunsaturated fatty acids in Saccharomyces cerevisiae: isocitrate dehydrogenase provides NADPH for reduction of double bonds at even positions. EMBO J. 17, 677–687. 13. Jo, S.H., Son, M.K., Koh, H.J., Lee, S.M., Song, I.H., Kim, Y.O., Lee, Y.S., Jeong, K.S., Kim, W.B., Park, J.W., Song, B.J., Huh, T.L. & Huhe, T.L. (2001) Control of mitochondrial redox balance and cellular defense against oxidative damage by mitochondrial NADP + -dependent isocitrate dehydrogenase. J. Biol. Chem. 276, 16168–16176. 14. Minard, K.I. & McAlister-Henn, L. (2001) Antioxidant function of cytosolic sources of NADPH in yeast. Free Radic. Biol. Med. 31, 832–843. 15. Krauth-Siegel, R.L. & Coombs, G.H. (1999) Enzymes of parasite thiol metabolism as drug targets. Parasitol. Today 15, 404–409. 16. Lu ¨ ersen, K., Walter, R.D. & Mu ¨ ller, S. (2000) Plasmodium falci- parum-infected red blood cells depend on a functional glutathione de novo synthesis attributable to an enhanced loss of glutathione. Biochem. J. 346, 545–552. 17. Krnajski, Z., Gilberger, T.W., Walter, R.D. & Mu ¨ ller, S. (2001) The malaria parasite Plasmodium falciparum possesses a functional thioredoxin system. Mol. Biochem. Parasitol. 112, 219–128. 18. Meierjohann, S., Walter, R.D. & Mu ¨ ller, S. (2002) Glutathione synthetase from Plasmodium falciparum. Biochem. J. 363, 833–838. 19. Vander Jagt, D.L., Hunsaker, L.A., Kibirige, M. & Campos, N.M. (1989) NADPH production by the malarial parasite Plas- modium falciparum. Blood 74, 471–474. 20. Walter, R.D., Nordmeyer, J.P. & Ko ¨ nigk, E. (1974) NADP-spe- cific glutamate dehydrogenase from Plasmodium chabaudi. Hoppe Seylers Z. Physiol. Chem. 355, 495–500. 21. Wagner, J.T., Lu ¨ demann, H., Fa ¨ rber, P.M., Lottspeich, F. & Krauth-Siegel, R.L. (1998) Glutamate dehydrogenase, the marker protein of Plasmodium falciparum – cloning, expression and characterization of the malarial enzyme. Eur. J. Biochem. 258, 813–819. 1782 C. Wrenger and S. Mu ¨ ller (Eur. J. Biochem. 270) Ó FEBS 2003 22. Loyevsky, M., LaVaute, T., Allerson, C.R., Stearman, R., Kassim, O.O., Cooperman, S., Gordeuk, V.R. & Rouault, T.A. (2001) An IRP-like protein from Plasmodium falciparum binds to a mammalian iron-responsive element. Blood 98, 2555–2562. 23. Ginsburg, H. & Atamna, H. (1994) The redox status of malaria- infectederythrocytes:anoverviewwithanemphasisonunresolved problems. Parasite 1, 5–13. 24. Krungkrai, J., Prapunwattana, P. & Krungkrai, S.R. (2000) Ultrastructure and function of mitochondria in gametocytic stage of Plasmodium falciparum. Parasite 7, 19–26. 25.Gardner,M.J.,Hall,N.,Fung,E.,White,O.,Berriman,M., Hyman, R.W., Carlton, J.M., Pain, A., Nelson, K.E., Bowman, S., Paulsen, I.T., James, K., Eisen, J.A., Rutherford, K., Salzberg, S.L.,Craig,A.,Kyes,S.,Chan,M.S.,Nene,V.,Shallom,S.J.,Suh, B.,Peterson,J.,Angiuoli,S.,Pertea,M.,Allen,J.,Selengut,J., Haft, D., Mather, M.W., Vaidya, A.B., Martin, D.M., Fairlamb, A.H., Fraunholz, M.J., Roos, D.S., Ralph, S.A., McFadden, G.I., Cummings, L.M., Subramanian, G.M., Mungall, C., Venter, J.C., Carucci, D.J., Hoffman, S.L., Newbold, C., Davis, R.W., Fraser, C.M. & Barrell, B. (2002) Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498–511. 26. Hall, N., Pain, A., Berriman, M., Churcher, C., Harris, B., Harris, D., Mungall, K., Bowman, S., Atkin, R., Baker, S., Barron, A., Brooks, K., Buckee, C.O., Burrows, C., Cherevach, I., Chilling- worth, C., Chillingworth, T., Christodoulou, Z., Clark, L., Clark, R., Corton, C., Cronin, A., Davies, R., Davis, P., Dear, P., Dearden, F., Doggett, J., Feltwell, T., Goble, A., Goodhead, I., Gwilliam, R., Hamlin, N., Hance, Z., Harper, D., Hauser, H., Hornsby, T., Holroyd, S., Horrocks, P., Humphray, S., Jagels, K., James, K.D., Johnson, D., Kerhornou, A., Knights, A., Konfor- tov, B., Kyes, S., Larke, N., Lawson, D., Lennard, N., Line, A., Maddison, M., McLean, J., Mooney, P., Moule, S., Murphy, L., Oliver, K., Ormond, D., Price, C., Quail, M.A., Rabbinowitsch, E., Rajandream, M.A., Rutter, S., Rutherford, K.M., Sanders, M.,Simmonds,M.,Seeger,K.,Sharp,S.,Smith,R.,Squares,R., Squares, S., Stevens, K., Taylor, K., Tivey, A., Unwin, L., Whitehead, S., Woodward, J., Sulston, J.E., Craig, A., Newbold, C. & Barrell, B.G. (2002) Sequence of Plasmodium falciparum chromosomes 1, 3–9 and 13. Nature 419, 527–531. 27. Krnajski, Z., Gilberger, T.W., Walter, R.D. & Mu ¨ ller, S. (2000) Intersubunit interactions in Plasmodium falciparum thioredoxin reductase. J. Biol. Chem. 275, 40874–40878. 28. Wrenger, C., Lu ¨ ersen, K., Krause, T., Mu ¨ ller, S. & Walter, R.D. (2001) The Plasmodium falciparum bifunctional ornithine decarboxylase, S -adenosyl- L -methionine decarboxylase, enables a well balanced polyamine synthesis without domain–domain interaction. J. Biol. Chem. 276, 29651–29656. 29. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 30. Singh, S.K., Miller, S.P., Dean, A., Banaszak, L.J. & LaPorte, D.C. (2002) Bacillus subtilis isocitrate dehydrogenase. A substrate analogue for Escherichia coli isocitrate dehydrogenase kinase/ phosphatase. J. Biol. Chem. 277, 7567–7573. 31. Colman, R.F. (1972) Regulation of enzymes by small molecules. Ann. NY Acad. Sci. 193, 2–13. 32. Umlas, J. & Fallon, J.N. (1971) New thick-film technique for malaria diagnosis. Use of saponin stromatolytic solution for lysis. Am. J. Trop. Med. Hyg. 20, 527–529. 33. Krnajski, Z., Gilberger, T.W., Walter, R.D., Cowman, A.F. & Mu ¨ ller, S. (2002) Thioredoxin reductase is essential for the survival of Plasmodium falciparum erythrocytic stages. J. Biol. Chem. 277, 25970–25975. 34. Trager, W. & Jensen, J.B. (1976) Human malaria parasites in continuous culture. Science 193, 673–675. 35. Hoppe, H.C., Verschoor, J.A. & Louw, A.I. (1991) Plasmodium falciparum: a comparison of synchronisation methods for in vitro cultures. Exp. Parasitol. 72, 464–467. 36. Kyes, S., Pinches, R. & Newbold, C. (2000) A simple RNA ana- lysis method shows var and rif multigene family expression pat- terns in Plasmodium falciparum. Mol. Biochem. Parasitol. 105, 311–315. 37. Claros, M.G. & Vincens, P. (1996) Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur. J. Biochem. 241, 779–786. 38. Soundar, S., Danek, B.L. & Colman, R.F. (2000) Identification by mutagenesis of arginines in the substrate binding site of the por- cine NADP-dependent isocitrate dehydrogenase. J. Biol. Chem. 275, 5606–5612. 39. Grodsky, N.B., Soundar, S. & Colman, R.F. (2000) Evaluation by site-directed mutagenesis of aspartic acid residues in the metal site of pig heart NADP-dependent isocitrate dehydrogenase. Biochemistry 39, 2193–2200. 40. Ceccarelli, C., Grodsky, N.B., Ariyaratne, N., Colman, R.F. & Bahnson, B.J. (2002) Crystal structure of porcine mitochondrial NADP + -dependent isocitrate dehydrogenase complexed with Mn 2+ and isocitrate: Insights into the enzyme mechanism. J. Biol. Chem. 277, 43454–43462. 41. Huang, Y.C. & Colman, R.F. (2002) Evaluation by mutagenesis of the roles of His309, His315, and His319 in the coenzyme site of pig heart NADP-dependent isocitrate dehydrogenase. Biochem- istry 41, 5637–5643. 42. Zhao, W.N. & McAlister-Henn, L. (1996) Expression and gene disruption analysis of the isocitrate dehydrogenase family in yeast. Biochemistry 35, 7873–7878. 43. Kovacs, W.J., Faust, P.L., Keller, G.A. & Krisans, S.K. (2001) Purification of brain peroxisomes and localization of 3-hydroxy- 3-methylglutaryl coenzyme A reductase. Eur. J. Biochem. 268, 4850–4859. 44. Riendeau, D. & Meighen, E. (1985) Enzymatic reduction of fatty acids and acyl-CoAs to long chain aldehydes and alcohols. Experientia 41, 707–713. 45. Wierzbicki, A.S., Lloyd, M.D., Schofield, C.J., Feher, M.D. & Gibberd, F.B. (2002) Refsum’s disease: a peroxisomal disorder affecting phytanic acid alpha-oxidation. J. Neurochem. 80, 727– 735. 46. Lakshmipathy, U. & Campbell, C. (1999) The human DNA ligase III gene encodes nuclear and mitochondrial proteins. Mol. Cell. Biol. 19, 3869–3876. 47. Hurley, J.H., Dean, A.M., Thorsness, P.E., Koshland, D.E. Jr & Stroud, R.M. (1990) Regulation of isocitrate dehydrogenase by phosphorylation involves no long-range conformational change in the free enzyme. J. Biol. Chem. 265, 3599–3602. 48. Colman, R.F. (1972) Role of metal ions in reactions catalysed by pig heart triphosphopyridine nucleotide-dependent isocitrate dehydrogenase. II. Effect on catalytic properties and reactivity of aminoacidresidues.J. Biol. Chem. 247, 215–223. Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1783 . Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? Carsten Wrenger and Sylke Mu¨ ller Division of Biological. mitochondrial redox control rather than energy metabolism of the parasites. Keywords: isocitrate dehydrogenase; redox control; mito- chondrion; malaria; energy metabolism;