Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc

Incubation of P.falciparum under exogenous oxidative stress resulted in an up-regulation of ICDH mRNA and protein levels indi-cating that the enzyme is involved in mitochondrial redox co

Isocitrate dehydrogenase of Plasmodium falciparum

Energy metabolism or redox control?

Carsten Wrenger and Sylke Mu¨ller

Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, UK

Erythrocytic stages of the malaria parasite Plasmodium

fal-ciparumrely on glycolysis for their energy supply and it is

unclear whether they obtain energy via mitochondrial

res-piration albeit enzymes of the tricarboxylic acid (TCA) cycle

appear to be expressed in these parasite stages Isocitrate

dehydrogenase (ICDH) is either an integral part of the

mitochondrial TCA cycle or is involved in providing

NADPH for reductive reactions in the cell The gene

enco-ding P.falciparum ICDH was cloned and analysis of the

deduced amino-acid sequence revealed that it possesses a

putative mitochondrial targeting sequence The protein is

very similar to NADP+-dependent mitochondrial

counter-parts of higher eukaryotes but not Escherichia coli

Expres-sion of full-length ICDH generated recombinant protein

exclusively expressed in inclusion bodies but the removal of

27 N-terminal amino acids yielded appreciable amounts of

soluble ICDH consistent with the prediction that these res-idues confer targeting of the native protein to the parasites’ mitochondrion Recombinant ICDH forms homodimers of

90 kDa and its activity is dependent on the bivalent metal ions Mg2+or Mn2+with apparent Kmvalues of 13 lMand

22 lM, respectively Plasmodium ICDH requires NADP+as cofactor and no activity with NAD+was detectable; the

Kapp

m for NADP+ was found to be 90 lM and that of

D-isocitrate was determined to be 40 lM Incubation of P.falciparum under exogenous oxidative stress resulted in

an up-regulation of ICDH mRNA and protein levels indi-cating that the enzyme is involved in mitochondrial redox control rather than energy metabolism of the parasites Keywords: isocitrate dehydrogenase; redox control; mito-chondrion; malaria; energy metabolism; oxidative stress

Isocitrate dehydrogenase (ICDH) occurs in multiple

iso-forms in eukaryotes, whereas Escherichia coli possesses a

single NADP+-dependent ICDH [1–4] The eukaryotic

enzymes are not only structurally distinct but they also rely

on different cofactors for catalysis and are localized in

different compartments of the cell [5–8] The reaction of

ICDH generates NAD(P)H and 2-oxoglutarate The latter

is shuttled either into the tricarboxylic acid cycle (TCA

cycle) or is metabolized to glutamate, depending on the

localization of the respective isoform of ICDH NAD+

-dependent ICDH are localized in the mitochondria and are

an essential part of the TCA cycle [3,6] They form octamers

consisting of three different subunits [3,9] and are

allosteri-cally responsive to the energy charge (adenine nucleotides

and NADH) of the cell [10] NADP+-dependent ICDH

have been found in mitochondria, cytosol and peroxisomes

They generally are homodimers and their physiological role

is less well understood It is believed that they are important

to provide NADPH essential for reductive reactions such as

lipid biosynthesis and reduction of hydroperoxides [11–14]

Plasmodium falciparumis the causative agent of malaria tropica, one of the most devastating tropical diseases The parasites go through a complex life cycle and the erythro-cytic stages of P.falciparum are responsible for the patho-logy in humans In order to survive the pro-oxidant environment within the human erythrocytes, the parasites possess efficient antioxidant and redox systems such as the glutathione and thioredoxin cycles [15–18] Both redox systems require NADPH, which usually is provided by the pentose phosphate shunt via glucose-6-phosphate dehydrogenase This enzyme is present in P.falciparum but its activity was found to be low and is probably not the major source of NADPH in the parasites [19] It was postulated that in P.falciparum NADPH is mainly provi-ded by glutamate dehydrogenase and potentially a NADP+-dependent ICDH [19–21] ICDH from P.falcipa-rum was partially purified previously and some of its characteristics were determined but the physiological rele-vance of the enzyme was not entirely understood because the source of isocitrate appeared to be unknown [19] However, recently a gene encoding for an aconitase-like protein was isolated from the parasites possibly providing the substrate for P.falciparum ICDH [22]

It is well established, that the erythrocytic stages of the malaria parasite rely mainly on glycolysis for their energy supply rather than on mitochondrial respiration [23,24] However, the release of the entire P.falciparum genome sequence revealed that the parasites possess the genes for the enzymes involved in the TCA cycle [25] but whether this route of energy metabolism is essential for the erythrocytic stages of the parasites remains unclear As no homologous genes for an NAD+-dependent ICDH could be identified

Correspondence to S Mu¨ller, Division of Biological Chemistry and

Molecular Microbiology, School of Life Sciences, University of

Dundee, Dundee DD1 5EH, UK.

Fax: + 44 1382 345764, Tel.: + 44 1382 345760,

E-mail: s.muller@dundee.ac.uk

Abbreviations: ICDH, isocitrate dehydrogenase; ICDH-1, full length

ICDH of P.falciparum; ICDH-2, truncated ICDH of P.falciparum;

SOD, superoxide dismutase; TCA cycle, tricarboxylic acid cycle.

(Received 11 December 2002, revised 17 February 2003,

accepted 25 February 2003)

in the parasite genome it is possible that NADP+-dependent

ICDH in P.falciparum is involved in both, energy

metabo-lism and redox control In this study we have cloned and

recombinantly expressed ICDH of P.falciparum,

estab-lished its biochemical characteristics and propose a possible

function for the parasite enzyme

Materials and methods

Materials

Cloning vectors pASK-IBA 7 and pASK-IBA 3,

Strep-Tactin–Sepharose, anhydrotetracycline and desthiobiotine

were from IBA, Go¨ttingen, Germany Oligonucleotides

were from Hybaid, UK Enhanced Avian HS RT-PCR-20

kit was purchased from, Sigma, UK [a-32P]dATP

(6000 CiÆmmol)1) was from Amersham, UK

Cloning ofP falciparum ICDH

The ICDH sequence was identified on chromosome 13 of

P.falciparumusing the human ICDH sequence (accession

no P48735) for a TBLASTN search of the PlasmoDB

database (http://www.PlasmoDB.org) After we identified

the gene, the Plasmodium genome consortium published the

identical sequence under accession numbers CAD 52580

and NP_705343 [26] According to nucleotide and deduced

amino-acid sequences there are no introns within the ICDH

gene so that the full-length gene was amplified by PCR using

genomic DNA as a template In order to verify this

prediction, a reverse transcriptase PCR was also performed

to isolate the cDNA encoding ICDH Using the specific

oligonucleotides (sense 5¢-GCGCGCGGTCTCCGCGCA

TGGGAAAGCATATACGAATTTTAAAAAATCAAT

ACC-3¢ and antisense 5¢-GCGCGCGGTCTCTATCA

TTATGTTGAATGTTCTTGGGGAGC-3¢) containing

BsaIrestriction sites and Pfu polymerase (Stratgene), ICDH

was amplified from both templates using the following PCR

protocol: 3 min at 95C for 1 cycle followed by 35 cycles of

1 min at 95C, 1.5 min at 42 C and 4 min at 60 C The

approximately 1.4 kb PCR fragment, designated ICDH-1

was digested with BsaIand subcloned into pASK-IBA-7

previously digested with the same enzyme The expression

plasmid possesses an N-terminal Strep-tag that allows

one-step purification of recombinant protein via Strep-Tactin–

Sepharose that specifically binds the recombinant fusion

protein [27] An N-terminal truncated version (residue 82–

1404) of P.falciparum ICDH was amplified using the

sequence specific oligonucleotides sense 5¢-GCGCGCG

GTCTCGAATGAACATATGCGGTAAAATTAACGT

AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT

TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI

restriction sites and ICDH-1 as a template and the following

PCR programme: 3 min at 95C for 1 cycle followed by 35

cycles of 1 min 95C, 1.5 min 42 C and 4 min 68 C The

truncated 1.32 kb PCR fragment was designated ICDH-2

and was subcloned into pASK-IBA 3, an expression

plasmid conferring recombinant expression of the protein

with a C-terminal Strep-tag [28] The nucleotide sequences

of all PCR fragments and clones were determined by

automated nucleotide sequencing using the automatic

sequencer ABI377 (Bio-Rad) Nucleotide and amino-acid

analyses were performed using Vector NTI(Informax) or Generunner

Expression and purification of ICDH ICDH-1 and ICDH-2 were transformed into E.coli BLR (DE3) (Novagen) and a single colony of each was used to set up an overnight culture in Luria–Bertani medium containing 50 lgÆmL)1 ampicillin The overnight cultures were diluted 1 : 50 into fresh Luria–Bertani medium containing the antibiotic and grown at 37C until the

D600 reached 0.5 Expression of the recombinant proteins was induced by addition of 200 ng of anhydrotetracycline The bacteria were grown for an additional 4 h at 37C before they were harvested by centrifugation at 3480 g (Beckman J6-MC, JS-4.2) The bacterial pellets were resuspended in buffer W (100 mM Tris/HCl pH 8.0 containing 150 mM NaCl), the suspension was sonified (Soniprep 150, MSE) and subsequently centrifuged at

50 000 g for 1 h 30 min (Beckman Avanti J-25, JA 25.50) The resulting supernatants were applied to 1 mL of Strep-Tactin–Sepharose resin previously equilibrated with buffer W, washed with 10–15 column volumes of the same buffer before the specifically bound proteins were eluted using 5 mL of buffer W containing 5 mM desthio-biotine The purity of the eluted proteins was assessed by SDS/PAGE

In order to analyse the oligomeric state of P.falciparum ICDH, recombinant ICDH-2 was applied to a Superdex S-200 gel sizing column (1.6· 60 cm, Amersham) previously equilibrated with 50 mM potassium phosphate

pH 8.0 containing 1 mM MgCl2 (buffer A), buffer A containing 150 mM KCl or buffer A containing 150 mM

KCl and 1 mMdithiothreitol using an A¨kta FPLC system (Amersham) The column was previously calibrated with the following gel filtration standards (Bio-Rad): thyro-globulin (670 kDa), bovine c-thyro-globulin (158 kDa), chicken ovalbumin (44 kDa), equine myoglobin (17 kDa) and vitamin B12 (1.3 kDa), so that the apparent size of the Plasmodiumprotein could be assessed

Protein concentrations were estimated by the Bradford method using bovine serum albumin as a standard [29] Characterization of recombinant ICDH-2

ICDH enzyme assays were performed at 30C in 25 mM

Mops buffer pH 8.0, containing 5 mMMgCl2and 100 mM

NaCl, 2 mMNADP+and 4 mMD,L-isocitrate as described

by [30] The assay was initiated by addition of 0.3–1 lg recombinant enzyme and the increase in absorbance at

340 nm was followed spectrophotometrically (UV—2041

PC, Shimadzu)

In order to determine the pH-optimum for the reaction,

50 mM Bicine/Bis Tris Propane/Mes buffers in the range between pH 5.5 and 10.0 were used and the standard assay was performed As there are reports that the specific activity of ICDH is dependent on the buffer system used

in vitro, the pH-optimum in 50 mMMops buffer pH 7.0– 8.5 was also determined It is known that ICDH requires bivalent metal ions for catalytic activity [31] In order

to establish which metals support enzymatic activity of P.falciparum ICDH, MgCl, MnSO, CoCl, CuCl,

NiSO4, ZnSO4 or CaCl2, respectively, were used in the

assay at 5 mM

The apparent Kmvalues for NADP+, D-isocitrate, Mg2+

and Mn2+were determined by using a rapid kinetics device

attached to the spectrophotometer which allows to

deter-mine time points every 10 ms The assays were performed

by varying the concentration of NADP+ from 2 lM to

2 mM at constant isocitrate concentration of 4 mM and

Mg2+at 5 mMand varying theD,L-isocitrate concentration

from 2 lMto 4 mMat 2 mMNADP+and Mg2+at 5 mM

as well as varying the concentrations of Mg2+or Mn2+

(4 lMto 150 lM) at saturating concentrations of the other

two substrates The results were analysed using GraphPad

PRISM (GraphPad software) and the apparent Km values

were derived from the reciprocal Lineweaver–Burk plots

Isolation of nucleic acids fromP falciparum 3D7

erythrocytic stages

Erythrocytic stages of P.falciparum at 4% haematocrit and

10–15% parasitaemia were isolated by saponin lysis

according to [32] Genomic DNA was isolated from the

parasites according to Krnajski et al 2002 [33] Total RNA

was isolated from the parasites using Trizol (Gibco BRL)

or Tri-reagent (Sigma) according to the manufacturer’s

instructions

Expression of ICDH in erythrocytic stages

ofP falciparum

According to previous reports [18] ICDH is expressed in

erythrocytic stages of P.falciparum In order to confirm

these reports, a reverse transcriptase PCR was performed

with total RNA of P.falciparum 3D7 as a template and

specific oligonucleotides using the one-step procedure

recommended for the Enhanced Avian HS RT-PCR-20

kit To validate that no traces of genomic DNA were

present in the RNA isolated from the parasites, a gene

containing several introns (superoxide dismutase 2;

acces-sion number: NP_703892) was also amplified as a control

from RNA and genomic P.falciparum 3D7 DNA

Effect of oxidative stress on ICDH expression

inP falciparum erythrocytic stages

Erythrocytic stages of P.falciparum (3D7) were cultured

according to [34] with RPMI1640 medium containing

Hepes, 11 mM glucose (Invitrogen), 0.1% Albumax II

(Invitrogen), 27.2 mgÆL)1 hypoxanthine and 20 mgÆL)1

gentamycin in A+human erythrocytes under a reduced

oxygen atmosphere Parasites were synchronized using 5%

sorbitol according to [35] 48 h after synchronization

trophozoites (approximately 30–36 h) were oxidatively

stressed with 50 mUÆmL)1glucose oxidase for 3 h In order

to analyse whether the transcription levels of ICDH were

increased, parasites were freed of erythrocytes by saponin

lysis [32], the parasite pellet was resuspendend in Tri-reagent

and total RNA was isolated as described above Northern

Blot analysis was performed as described by [36] Ten

micrograms of total RNA were separated by electrophoresis

using a 1.5% agarose-gel containing 5 mM guanidine

thiocyanate and subsequently transferred to a positively

charged nylon membrane (Roche) with 7.5 mMNaOH as transfer buffer The blot was hybridized with a radiolabelled ICDH-2 probe (Random Primed DNA Labeling Kit, Roche) in 7% SDS/0.5M NaH2PO4, pH 7.2/2% dextran sulfate at 55C overnight The membrane was washed three times in 75 mMNaCl, 7.5 mMsodium citrate, pH 7.0/0.1% SDS for 10 min at 55C The signals were visualized by exposure to Hyperfilm (Amersham) overnight Subse-quently the blot was re-probed with a superoxide dismutase

2 probe (accession no NP_703892) and an 18-S rRNA probe as a loading control

In order to analyse whether protein levels were simulta-neously altered with mRNA levels in oxidatively stressed parasites, an aliquot of the parasite pellet obtained after saponin lysis was resuspended in NaCl/Pi containing EDTA-free protease inhibitor cocktail (Roche) and lysed

by freeze-thawing Protein concentration was determined using the Bradford method [29] Fifteen micrograms of protein extract of control and treated parasites was separ-ated on a 4–12% SDS/PAGE (Invitrogen) and subse-quently blotted onto nitrocellulose (Schleicher and Schuell) The blots were hybridized with polyclonal antibodies directed against ICDH-2 (1 : 400) and after incubation with a secondary anti rabbit horseradish peroxidase coupled antibody (Scottish Antibody Production Unit) (1 : 10 000) the blot was developed using the ECL+ system from Amersham, according to manufacturer’s instructions

Results

Analysis ofP falciparum ICDH sequence The BLAST search for an ICDH homologue in the P.falciparum genome database using a mammalian mito-chondrial NADP+-dependent ICDH sequence recognized

a single sequence in the parasite genome located on chro-mosome 13 Recently the genome sequence of P.falciparum was released and the ICDH gene was annotated by the Plasmodiumsequencing consortium [26] According to their predictions and to our analyses, P.falciparum possess only one ICDH gene unlike other eukaryotes where several genes encoding ICDH are frequently found [1–3] The open reading frame of the P.falciparum ICDH gene was cloned from genomic and cDNA of P.falciparum 3D7 It consists

of 1407 nucleotides and encodes for a polypeptide of

468 amino acids The deduced amino-acid sequence of P.falciparumICDH shows a high degree of identity to the mitochondrial NADP+-dependent ICDH of mammals (55.3% to 57.7%) and yeast (46.6%) (Fig 1) but has only little identity to E.coli ICDH (10.3%) Analysis of the deduced amino-acid sequence using the prediction pro-grammes available on the ExPaSy website (http://c.expasy org/tools/) revealed that the Plasmodium protein possesses a putative mitochondrial targeting sequence (residues 1–27) suggesting that it is localized in the parasite mitochondrion [37] All residues that are known to be involved in structure and catalytic activity of mammalian ICDH appear to be conserved in P.falciparum ICDH In porcine ICDH the positive charges of the arginine residues Arg101, Arg110 and Arg133 are responsible for the binding of the isocitrate-metal ion complex to the protein and these residues correspond to Arg129, Arg138 and Arg161 in P.falciparum

ICDH [38] In addition Asp252 and Asp275 were found to

be important for the binding of the binary isocitrate-Mn2+

complex in the mitochondrial porcine ICDH as shown by

mutagenesis as well as structural analyses [39,40] The

equivalent residues in P.falciparum ICDH are Asp281 and

Asp301 The histidine and lysine residues equivalent to

His315 and Lys374 of the porcine ICDH (His343 and

Lys402 in P.f.ICDH) are also conserved in the parasite

protein and these residues have been shown to be involved

in interacting with the cofactor NADP+[41,42]

Recombinant expression ofP falciparum ICDH

Two expression constructs of ICDH were generated and

recombinantly expressed in E.coli BLR (DE3) cells The

full-length construct ICDH-1 conferred expression of

recombinant ICDH exclusively in the bacterial pellet whereas construct ICDH-2 was expressed as a soluble protein in the bacteria These results are consistent with our suggestion that the 27 N-terminal amino acid, which are lacking in construct ICDH-2, represent a mitochondrial targeting sequence which cannot be cleaved by the bacterial expression system and therefore results in miss folding of the recombinant protein The yield of soluble recombinant ICDH-2 was 2 mgÆL)1of bacterial cells Affinity chroma-tography on Strep-Tactin–Sepharose resulted in 98% homogeneous protein that was used for all subsequent analyses (Fig 2) The P.falciparum ICDH-2 monomer has

a molecular mass of 51 kDa in agreement with the theoretical molecular mass of 51.6 kDa In order to determine the oligomeric state of the protein it was subjected

to gel filtration on Superdex S-200 Interestingly, it eluted in

Fig 1 Alignment of P falciparum isocitrate dehydrogenase deduced amino-acid sequence The deduced amino-acid sequence of P.falciparum ICDH (Pf) (accession number: NP_705343/CAD 52580) is aligned with those of Sus scrofa (Ss) (accession number: P33198), Homo sapiens (Hs) (accession number: 57499) and Saccharomyces cerevisiae (Sc) (accession number: P21954) Identical amino acids are shaded in black; homologous amino acids are shaded in grey An arrowhead indicates the potential cleavage site for the mitochondrial target sequence in the P.falciparum sequence Amino acids known to be involved in the binding and interaction of ICDH with cofactors and substrates are indicated by *.

two peaks: one corresponding to a homodimer of 90 kDa and one corresponding to a homotetramer of 210 kDa (Fig 3) Both peaks were found to contain active ICDH-2 enzyme In order to test whether hydrophobic interactions with the column matrix were responsible for the delayed elution of a portion of the protein, 150 mMKCl was added

to the equilibration and elution buffer The enzyme activities still eluted in two peaks at 90 and 210 kDa Only addition

of 1 mM dithiothreitol to the buffer led to elution of the protein in a single peak suggesting that the reducing agent releases sulfhydryl bonds that have formed between the homodimers during the purification procedure (Fig 3) Therefore we presume that P.falciparum ICDH-2 forms homodimers as has been reported for the native enzyme partially purified from P.falciparum [19], which also tend to form enzymatic active tetramers in the absence of reducing agents

Characteristics ofP falciparum ICDH P.falciparumI CDH-2 is specific for NADP+and does not accept NAD+at detectable rates The Kmappfor NADP+ was determined to be 90 lMand that forD-isocitrate was found to be 40 lM (Table 1) In order to determine the apparent Km for D-isocitrate, the concentration for

Fig 2 SDS/PAGEof recombinant P falciparum isocitrate

dehydro-genase P.falciparum ICDH-2 was expressed in BLR (DE3) and

subsequently purified as described in Materials and methods Purity of

the recombinant protein was assessed by SDS/PAGE 1, 10 lg of

bacterial pellet; 2, 10 lg of bacterial supernatant prior to loading to

Strep-Tactin–Sepharose; 3, 10 lg of flow-through after Strep-Tactin–

Sepharose; 4, 3 lg of ICDH-2 after Strep-Tactin–Sepharose; 5, 1 lg of

ICDH-2 after gel filtration on Superdex S-200.

Fig 3 Oligomeric state of P falciparum

isocitrate dehydrogenase (A) Recombinant

ICDH-2 was separated on a Superdex S-200

gel sizing column using buffer A without (—)

and with addition of 1 m M dithiothreitol (––).

Enzyme activity (j) corresponds to both, the

210 kDa and 90 kDa peaks (B) Twenty

microlitres of the elution fractions indicated

were analysed by Western blotting and the

results confirm the presence of recombinant

protein in both peak fractions that also

con-tain enzyme activity.

D-isocitrate in the commercially available mixture of

D,L-isocitrate was established prior performing the assay

according to [30] The specific activity of ICDH-2 at

saturation of all three substrates and cofactors was found to

be 162.5 ± 22.1 UÆmg)1with a kcatof 138 s)1(Table 1),

which is about 2–4 times higher than that reported for other

eukaryotic NADP+-dependent ICDH [38,41] but in the

same range as the bacterial ICDH [30] The recombinant

protein had a pH-optimum of 8.0 in both, Bicine/Bis Tris

Propane/Mes and Mops buffer, which is higher than that

determined for the native enzyme, which was reported to be

at pH 7.5 [19] As all other ICDH the Plasmodium enzyme is

dependent on bivalent metal ions such as Mg2+and Mn2+

A number of metal ions were tested with the parasite ICDH

and Mg2+was found to stimulate activity most efficiently

followed by Mn2+ All other tested metal ions had no or

only marginal effects on the enzyme activity Therefore the

Kapp

m for Mg2+and Mn2+were determined and found to be

13 lM and 21 lM, respectively, which is about 10 times

higher than that determined for Mn2+for the pig

mito-chondrial enzyme [41]

Expression of ICDH in erythrocytic stages

ofP falciparum

In order to establish that ICDH is indeed expressed in the

erythrocytic stages of P.falciparum, a reverse-transcriptase

PCR was performed using total RNA isolated from

P.falciparum 3D7 As a quality control for the RNA

preparation the gene and cDNA of superoxide dismutase 2,

which contains several introns were also amplified As

shown in Fig 4, the PCR resulted in amplification of 1.4 kb

bands from cDNA and genomic DNA indicating that the

ICDH gene is expressed in erythrocytic stages of

P.falci-parumand that it indeed does not contain any introns as

also verified by sequence analysis of the PCR product

obtained from cDNA Further the control PCR verifies that

the RNA preparation used for this PCR was not

contami-nated with traces of DNA, as only the 0.7 kb band

expected for the amplification of superoxide dismutase 2

cDNA is visible whereas in the control lane with genomic

DNA the superoxide dismutase 2 PCR product is larger

(1.5 kb) consistent with the presence of introns in the gene (Fig 4)

Expression ofP falciparum ICDH under enhanced oxidative stress

Northern and Western blot analyses of P.falciparum total RNA and protein extracts clearly show, that the ICDH transcript as well as protein level are elevated when parasites were stressed with glucose oxidase for a 3-h period (Fig 5) These results strongly indicate that in P.falciparum mito-chondrial ICDH is involved in the protection of the parasite mitochondria from oxidative injury by providing reducing equivalents for antioxidant processes required to prevent damage of the organelle

Table 1 Properties of P falciparum isocitrate dehydrogenase The properties of recombinant P.falciparum ICDH were determined as described in the Materials and methods section For native ICDH the data was from reference [19], no standard deviations are given in this reference For pig mitochondrial ICDH the data was from [38,48] ND, not determined.

Recombinant ICDH Native ICDH Pig mitochondrial ICDH

K app

K app

K app

Metal Mg 2+ > Mn 2+ > Co 2+ Mg 2+ > Mn 2+ Mn 2+ > Cd 2+ > Zn 2+

> Co2+> Mg2+

Fig 4 Reverse transcriptase PCR In order to verify that P.falcipa-rum ICDH is expressed in erythrocytic stages of P.falciparum 3D7, a reverse transcriptase PCR using total RNA isolated from these para-site stages was performed as described in Materials and methods SOD + DNA, PCR was performed using the SOD-2 primers with P.falciparum genomic DNA as template; SOD + RNA, PCR was performed using the SOD-2 primers with RNA as template; ICDH – DNA, PCR was performed without any template DNA or RNA (negative control); ICDH + RNA, PCR was performed using ICDH primers with RNA as template; ICDH + DNA, PCR was performed using ICDH primers with DNA as template.

The malaria parasite P.falciparum appears to possess only

one NADP+-dependent ICDH with very little homology to

the E.coli but a high degree of amino-acid identity to

NADP+-dependent ICDH from eukaryotes There appear

to be no genes present in the parasite’s genome encoding for

the subunits of an NAD+-dependent ICDH [25,26]

repre-senting the enzyme form responsible for providing

2-oxoglutarate in the TCA cycle in eukaryotes [3,6] The

precise physiological roles of NADP+-dependent ICDH in

eukaryotes are not entirely clear but there are several reports

that the enzymes are responsible for the supply of reducing

equivalents for a variety of reductive reactions [11–14]

Peroxisomal ICDH provides NADPH for enzymes

involved in the oxidation of unsaturated fatty acids such as

2,4-dienoyl-CoA reductase [11,12],

hydroxymethylglutaryl-CoA reductase [43] and acyl-hydroxymethylglutaryl-CoA reductase [44] In addition 2-oxoglutarate in peroxisomes is required by phytanoyl-CoA a-hydroxylase [45] In mitochondria ICDH is thought

to provide NADPH for antioxidant enzymes such as glutathione reductase and thioredoxin reductase, which are pivotal parts of the cell’s antioxidant defence system [13] The N-terminal 27 amino acids of P.falciparum ICDH were predicted to encode a mitochondrial targeting sequence Consistent with this prediction it was necessary

to remove these amino acids before obtaining soluble recombinant protein in the E.coli expression system used in this study However, further studies are required to unambiguously show that the enzyme localizes to the parasite’s mitochondrion considering reports about the localization of proteins such as DNA ligase III which possesses a mitochondrial targeting sequence but also is found in the cytosol and nucleus of the cell [46]

Fig 5 Expression levels of ICDH in oxidatively stressed P falciparum (A) Northern blot analysis of P.falciparum ICDH (a) 10 lg of total RNA from control parasites (b) 10 lg of total RNA from parasites treated with 50 mUÆmL)1glucose oxidase for 3 h The blot was hybridized with radiolabelled ICDH-2 or superoxide dismutase 2 (B), respectively, and exposed for 48 h (C) The 18 S rRNA loading control shows that the same amount of RNA of both (a) untreated and (b) treated parasites was loaded onto the gel (D) Western blot of parasite proteins probed with anti-ICDH antiserum at 1 : 400 dilution detected by the ECL + system; (a) untreated parasites and (b) treated parasites.

The recombinant truncated P.falciparum ICDH shows a

clear preference for NADP+as a cofactor although its Kmapp

was rather high with 90 lM This low affinity for the

cofactor NADP+was also observed for one of the human

isoenzymes and the E.coli ICDH also appears to show a

lower affinity for NADP+[8,11,47] The Kapp

m for NADP+ determined for the native enzyme is in the same range as

that of the recombinant protein [19] Interestingly the

specific activity of the recombinant P.falciparum ICDH is

about 4 fold higher than that reported for the porcine

mitochondrial enzyme but in the same range as the bacterial

enzyme [30,38,41] P.falciparum ICDH shows preference

for Mg2+and Mn2+and apart from Co2+, none of the

other metal ions tested had any effect on the enzyme

activity In contrast porcine ICDH is activated by a wide

range of metal ions with Mn2+having the most pronounced

effect on the enzyme activity [31] Similar to other NADP+

-dependent ICDH, the P.falciparum protein forms dimers as

shown by gel filtration of recombinant ICDH on Sephadex

S-200 although without addition of reducing agents

homo-tetrameric forms of the enzyme were also observed As

P.falciparum ICDH is clearly NADP+-dependent and

shows no activity with NAD+it is unlikely that it is an

essential part of the parasite’s TCA cycle This suggestion is

consistent with the finding that in yeast the disruption of the

NAD+-dependent ICDH gene could not be compensated

by overexpressing the mitochondrial NADP+-dependent

enzyme in the null mutants [6] indicating distinct roles for

both enzymes If the parasite ICDH is not or only

marginally involved in energy metabolism, it is an attractive

hypothesis that its major role is the maintenance of the

intramitochondrial redox balance as it was shown for

mouse mitochondrial NADP+-dependent ICDH [13] In

order to analyse this potential function of the P.falciparum

enzyme, parasites were exposed to oxidative stress followed

by Northern blot and Western blot analyses of the ICDH

mRNA and protein levels Interestingly both, ICDH

transcript and protein levels are up-regulated in oxidatively

stressed parasites suggesting that NADP+-dependent

ICDH in P.falciparum erythrocytic stages is a

mitochon-drial protein that is important for the maintenance of the

organelle’s redox state and that it is most likely not crucially

involved in energy metabolism during the erythrocytic life

stages of P.falciparum

Acknowledgements

C W is a Wellcome Trust Travelling Research Fellow (067363/Z/02/Z)

and S M is a Wellcome Trust Senior Fellow.

References

1 Plaut, G.W & Aogaichi, T (1967) The separation of DPN-linked

and TPN-linked isocitrate dehydrogenase activities of mammalian

liver Biochem.Biophys.Res.Commun.28, 628–634.

2 Giorgio, N.A Jr, Yip, A.T., Fleming, J & Plaut G.W (1970)

Diphosphopyridine nucleotide-linked isocitrate dehydrogenase

from bovine heart Polymeric forms and subunits J.Biol.Chem.

245, 5469–5477.

3 Ramachandran, N & Colman, R.F (1980) Chemical

character-ization of distinct subunits of pig heart DPN-specific isocitrate

dehydrogenase J.Biol.Chem.255, 8859–8864.

4 Borthwick, A.C., Holms, W.H & Nimmo, H.G (1984) Isolation

of active and inactive forms of isocitrate dehydrogenase from Escherichia coli ML 308 Eur.J.Biochem.141, 393–400.

5 Reeves, H.C., Daumy, G.O., Lin, C.C & Houston, M (1972) NADP + -specific isocitrate dehydrogenase of Escherichia coli I Purification and characterization Biochim.Biophys.Acta 258, 27–39.

6 Haselbeck, R.J & McAlister-Henn, L (1993) Function and expression of yeast mitochondrial NAD- and NADP-specific isocitrate dehydrogenases J.Biol.Chem.268, 12116–12122.

7 Zhao, W.N & McAlister-Henn, L (1996) Assembly and function

of a cytosolic form of NADH-specific isocitrate dehydrogenase in yeast J.Biol.Chem.271, 10347–10352.

8 Geisbrecht, B.V & Gould, S.J (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP (+) -dependent isocitrate dehydrogenase J.Biol.Chem.274, 30527–30533.

9 Keys, D.A & McAlister-Henn, L (1990) Subunit structure, expression, and function of NAD (H) -specific isocitrate dehy-drogenase in Saccharomyces cerevisiae J.Bacteriol.172, 4280– 4287.

10 Barnes, L.D., McGuire, J.J & Atkinson, D.E (1972) Yeast diphosphopyridine nucleotide specific isocitrate dehydrogenase Regulation of activity and unidirectional catalysis Biochemistry

11, 4322–4329.

11 Henke, B., Girzalsky, W., Berteaux-Lecellier, V & Erdmann, R (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids J.Biol.Chem.273, 3702–3711.

12 van Roermund, C.W., Hettema, E.H., Kal, A.J., van den Berg, M., Tabak, H.F & Wanders, R.J (1998) Peroxisomal beta-oxi-dation of polyunsaturated fatty acids in Saccharomyces cerevisiae: isocitrate dehydrogenase provides NADPH for reduction of double bonds at even positions EMBO J 17, 677–687.

13 Jo, S.H., Son, M.K., Koh, H.J., Lee, S.M., Song, I.H., Kim, Y.O., Lee, Y.S., Jeong, K.S., Kim, W.B., Park, J.W., Song, B.J., Huh, T.L & Huhe, T.L (2001) Control of mitochondrial redox balance and cellular defense against oxidative damage by mitochondrial NADP+-dependent isocitrate dehydrogenase J.Biol.Chem.276, 16168–16176.

14 Minard, K.I & McAlister-Henn, L (2001) Antioxidant function

of cytosolic sources of NADPH in yeast Free Radic.Biol.Med.

31, 832–843.

15 Krauth-Siegel, R.L & Coombs, G.H (1999) Enzymes of parasite thiol metabolism as drug targets Parasitol.Today 15, 404–409.

16 Lu¨ersen, K., Walter, R.D & Mu¨ller, S (2000) Plasmodium falci-parum-infected red blood cells depend on a functional glutathione

de novo synthesis attributable to an enhanced loss of glutathione Biochem.J.346, 545–552.

17 Krnajski, Z., Gilberger, T.W., Walter, R.D & Mu¨ller, S (2001) The malaria parasite Plasmodium falciparum possesses a functional thioredoxin system Mol.Biochem.Parasitol.112, 219–128.

18 Meierjohann, S., Walter, R.D & Mu¨ller, S (2002) Glutathione synthetase from Plasmodium falciparum Biochem.J.363, 833–838.

19 Vander Jagt, D.L., Hunsaker, L.A., Kibirige, M & Campos, N.M (1989) NADPH production by the malarial parasite Plas-modium falciparum Blood 74, 471–474.

20 Walter, R.D., Nordmeyer, J.P & Ko¨nigk, E (1974) NADP-spe-cific glutamate dehydrogenase from Plasmodium chabaudi Hoppe Seylers Z.Physiol.Chem.355, 495–500.

21 Wagner, J.T., Lu¨demann, H., Fa¨rber, P.M., Lottspeich, F & Krauth-Siegel, R.L (1998) Glutamate dehydrogenase, the marker protein of Plasmodium falciparum – cloning, expression and characterization of the malarial enzyme Eur.J.Biochem.258, 813–819.

22 Loyevsky, M., LaVaute, T., Allerson, C.R., Stearman, R.,

Kassim, O.O., Cooperman, S., Gordeuk, V.R & Rouault, T.A.

(2001) An IRP-like protein from Plasmodium falciparum binds to a

mammalian iron-responsive element Blood 98, 2555–2562.

23 Ginsburg, H & Atamna, H (1994) The redox status of

malaria-infected erythrocytes: an overview with an emphasis on unresolved

problems Parasite 1, 5–13.

24 Krungkrai, J., Prapunwattana, P & Krungkrai, S.R (2000)

Ultrastructure and function of mitochondria in gametocytic stage

of Plasmodium falciparum Parasite 7, 19–26.

25 Gardner, M.J., Hall, N., Fung, E., White, O., Berriman, M.,

Hyman, R.W., Carlton, J.M., Pain, A., Nelson, K.E., Bowman,

S., Paulsen, I.T., James, K., Eisen, J.A., Rutherford, K., Salzberg,

S.L., Craig, A., Kyes, S., Chan, M.S., Nene, V., Shallom, S.J., Suh,

B., Peterson, J., Angiuoli, S., Pertea, M., Allen, J., Selengut, J.,

Haft, D., Mather, M.W., Vaidya, A.B., Martin, D.M., Fairlamb,

A.H., Fraunholz, M.J., Roos, D.S., Ralph, S.A., McFadden, G.I.,

Cummings, L.M., Subramanian, G.M., Mungall, C., Venter, J.C.,

Carucci, D.J., Hoffman, S.L., Newbold, C., Davis, R.W., Fraser,

C.M & Barrell, B (2002) Genome sequence of the human malaria

parasite Plasmodium falciparum Nature 419, 498–511.

26 Hall, N., Pain, A., Berriman, M., Churcher, C., Harris, B., Harris,

D., Mungall, K., Bowman, S., Atkin, R., Baker, S., Barron, A.,

Brooks, K., Buckee, C.O., Burrows, C., Cherevach, I.,

Chilling-worth, C., ChillingChilling-worth, T., Christodoulou, Z., Clark, L., Clark,

R., Corton, C., Cronin, A., Davies, R., Davis, P., Dear, P.,

Dearden, F., Doggett, J., Feltwell, T., Goble, A., Goodhead, I.,

Gwilliam, R., Hamlin, N., Hance, Z., Harper, D., Hauser, H.,

Hornsby, T., Holroyd, S., Horrocks, P., Humphray, S., Jagels, K.,

James, K.D., Johnson, D., Kerhornou, A., Knights, A.,

Konfor-tov, B., Kyes, S., Larke, N., Lawson, D., Lennard, N., Line, A.,

Maddison, M., McLean, J., Mooney, P., Moule, S., Murphy, L.,

Oliver, K., Ormond, D., Price, C., Quail, M.A., Rabbinowitsch,

E., Rajandream, M.A., Rutter, S., Rutherford, K.M., Sanders,

M., Simmonds, M., Seeger, K., Sharp, S., Smith, R., Squares, R.,

Squares, S., Stevens, K., Taylor, K., Tivey, A., Unwin, L.,

Whitehead, S., Woodward, J., Sulston, J.E., Craig, A., Newbold,

C & Barrell, B.G (2002) Sequence of Plasmodium falciparum

chromosomes 1, 3–9 and 13 Nature 419, 527–531.

27 Krnajski, Z., Gilberger, T.W., Walter, R.D & Mu¨ller, S (2000)

Intersubunit interactions in Plasmodium falciparum thioredoxin

reductase J.Biol.Chem.275, 40874–40878.

28 Wrenger, C., Lu¨ersen, K., Krause, T., Mu¨ller, S & Walter, R.D.

(2001) The Plasmodium falciparum bifunctional ornithine

decarboxylase, S -adenosyl- L -methionine decarboxylase, enables a

well balanced polyamine synthesis without domain–domain

interaction J.Biol.Chem.276, 29651–29656.

29 Bradford, M.M (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding Anal.Biochem.72, 248–254.

30 Singh, S.K., Miller, S.P., Dean, A., Banaszak, L.J & LaPorte,

D.C (2002) Bacillus subtilis isocitrate dehydrogenase A substrate

analogue for Escherichia coli isocitrate dehydrogenase kinase/

phosphatase J.Biol.Chem.277, 7567–7573.

31 Colman, R.F (1972) Regulation of enzymes by small molecules.

Ann.NY Acad.Sci.193, 2–13.

32 Umlas, J & Fallon, J.N (1971) New thick-film technique for

malaria diagnosis Use of saponin stromatolytic solution for lysis.

Am.J.Trop.Med.Hyg.20, 527–529.

33 Krnajski, Z., Gilberger, T.W., Walter, R.D., Cowman, A.F & Mu¨ller, S (2002) Thioredoxin reductase is essential for the survival

of Plasmodium falciparum erythrocytic stages J.Biol.Chem.277, 25970–25975.

34 Trager, W & Jensen, J.B (1976) Human malaria parasites in continuous culture Science 193, 673–675.

35 Hoppe, H.C., Verschoor, J.A & Louw, A.I (1991) Plasmodium falciparum: a comparison of synchronisation methods for in vitro cultures Exp.Parasitol.72, 464–467.

36 Kyes, S., Pinches, R & Newbold, C (2000) A simple RNA ana-lysis method shows var and rif multigene family expression pat-terns in Plasmodium falciparum Mol.Biochem.Parasitol.105, 311–315.

37 Claros, M.G & Vincens, P (1996) Computational method to predict mitochondrially imported proteins and their targeting sequences Eur.J.Biochem.241, 779–786.

38 Soundar, S., Danek, B.L & Colman, R.F (2000) Identification by mutagenesis of arginines in the substrate binding site of the por-cine NADP-dependent isocitrate dehydrogenase J.Biol.Chem.

275, 5606–5612.

39 Grodsky, N.B., Soundar, S & Colman, R.F (2000) Evaluation

by site-directed mutagenesis of aspartic acid residues in the metal site of pig heart NADP-dependent isocitrate dehydrogenase Biochemistry 39, 2193–2200.

40 Ceccarelli, C., Grodsky, N.B., Ariyaratne, N., Colman, R.F & Bahnson, B.J (2002) Crystal structure of porcine mitochondrial NADP + -dependent isocitrate dehydrogenase complexed with

Mn 2+ and isocitrate: Insights into the enzyme mechanism J.Biol Chem 277, 43454–43462.

41 Huang, Y.C & Colman, R.F (2002) Evaluation by mutagenesis

of the roles of His309, His315, and His319 in the coenzyme site of pig heart NADP-dependent isocitrate dehydrogenase Biochem-istry 41, 5637–5643.

42 Zhao, W.N & McAlister-Henn, L (1996) Expression and gene disruption analysis of the isocitrate dehydrogenase family in yeast Biochemistry 35, 7873–7878.

43 Kovacs, W.J., Faust, P.L., Keller, G.A & Krisans, S.K (2001) Purification of brain peroxisomes and localization of 3-hydroxy-3-methylglutaryl coenzyme A reductase Eur.J.Biochem.268, 4850–4859.

44 Riendeau, D & Meighen, E (1985) Enzymatic reduction of fatty acids and acyl-CoAs to long chain aldehydes and alcohols Experientia 41, 707–713.

45 Wierzbicki, A.S., Lloyd, M.D., Schofield, C.J., Feher, M.D & Gibberd, F.B (2002) Refsum’s disease: a peroxisomal disorder affecting phytanic acid alpha-oxidation J.Neurochem.80, 727– 735.

46 Lakshmipathy, U & Campbell, C (1999) The human DNA ligase III gene encodes nuclear and mitochondrial proteins Mol.Cell Biol 19, 3869–3876.

47 Hurley, J.H., Dean, A.M., Thorsness, P.E., Koshland, D.E Jr & Stroud, R.M (1990) Regulation of isocitrate dehydrogenase by phosphorylation involves no long-range conformational change in the free enzyme J.Biol.Chem.265, 3599–3602.

48 Colman, R.F (1972) Role of metal ions in reactions catalysed

by pig heart triphosphopyridine nucleotide-dependent isocitrate dehydrogenase II Effect on catalytic properties and reactivity of amino acid residues J.Biol.Chem.247, 215–223.