Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau

 vector khác nhau   huyên ngành;    Abstract:       Keywords: ; ; Cecropin; Kháng kháng sinh; Sinh y Content Nhân ngày i 7/4/2011, t : không hà  m  sinh   p giúp nhân  sinh.   kháng s     Tro y  tách chi t côn trùng d nên  AMPs nói chung và cecropin nói riê                        côn trùng  Vi Na “Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau”     CHƢƠNG 1 - TỔNG QUAN TÀI LIỆU     [63, 79]. Khi    la           nhân ni 7/4/2011 là nguy     cecropin quý giá (      .   n không    . v      .               .                ,     ,      ,          . ,               . cecropin    cecropin  cecropin E. coli  Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau”. cecropin B     cecropin B cecropin   E. coli.   Tách dòng và biểu hiện cecropin tái tổ hợp trong các hệ vector khác nhau   nh giá ng       CHƢƠNG 2 - NGUYÊN LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. Nguyên liệu 2.1.1. Các hệ vector - Các vecmang gen cecropin   + pJET1.2-cecH: vector pJET1.2 mang gen cecropin     r  Drosophila melanogaster + pJET1.2-cecN: vector pJET1.2 mang gen cecropin    nBombyx mori + pCR2.1-cecT: vector pCR2.1 mang gen cecropin B  - Vector nhân dòng: pBluescript II KS(+) (kí h -     -4T-    e, vector pET-28a và vector pET- 2.1.2. Các chủng vi khuẩn - E. coli DH5  - E. coli BL21 (DE3) và E. coli   2.1.3. Các cặp mồi   Bảng 5. T các  Tên mồi Trình tự mồi (5’-3’) Vai trò của cặp mồi Oligo 1 aattcatcgatggatgaatttctcaaggatatttttct tcgtgttcgctttggttctggctttgtcaacagtttcg cecropin Oligo 6 tcgaggctagcttatcctagcgctttggcttcgcct aaaaccgcgatcgctggtccagccttgac pJET1.2 F cgactcactatagggagagcggc     gen cecropin  pJET1.2-cecropin pJET1.2 R aagaacatcgattttccatggcag T7 aatacgactcactatag Nhân    gen cecropin pBS-cecropin, pCR2.1-cecropin M13/pUC reverse caggaaacagctatgac pGEX- Bam-cec actggatccatgaatttctcaaggatatttttcgtgtt cgctttggttctggct Nhân    cecropin  -4T-1 pGEX F gggctggcaagccacgtttggtg Nhân    gen cecropin trong vector tái   - cecropin pGEX R cctctgacacatgcagctcccgg pET28a- Eco-cec atagaattcatgtcccctatact Nhân    cecropin  -28a pET32b- Nco-cec attccatggcaatgaatttctcaaggatatttttcgtgtt Nhân    cecropin  o vector pET-32b pET 28 ggtgatgtcggcgatatagg    -28a-cecropin và pET-32b- cecropin pET 28 T7 gctagttattgctcagcgg 2.1.4. Gel sắc ký ái lực Glutathione Sepharose 4B, Ni-NTA agarose  tathione Sepharose 4B (GE He     lu       -transferase (GST). Glutathi      là agarose 4% thông qua     GST, các protein     -  2+    2.1.5. Các hóa chất và thiết bị  Hóa chất: -         Taq DNA polymerase (Fermentas), AmpliTaq Gold® DNA polymerase (Applied Biosystems) -     Fermentas, New England Biolabs), enzyme T4 DNA ligase (Fermentas, Invitrogen) - Protease: thrombin (GE Healthcare), enterokinase (New England Biolabs) - % trypton, 0.5% ca men, 0.5% NaCl - Kit  QIAquick PCR Purification Kit (QIAGEN) -                  phosphate pH 7.4 (3.1 g NaH 2 PO 4 .H 2 O, 10.9 g Na 2 HPO 4, thêm H 2 PBS (150 mM NaCl, 20 mM sodium phosphate), PBS lysis (150 mM NaCl, 20 mM sodium phosphate, 1 mM PMSF, 1% Triton-X100), GST elution (50 mM Tris-HCl pH 8, 20 mM glutathione reduced), His lysis (50 mM NaH 2 PO 4 , 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, 1% Triton-X100), His wash (50 mM NaH 2 PO 4 , 300 mM NaCl, 20 mM imidazole), His elution (50 mM NaH 2 PO 4 , 300 mM NaCl, 250 mM imidazole), EK buffer (20 mM Tris-HCl pH 8, 50 mM NaCl, 2 mM CaCl 2 ) -        IPTG, X-gal, PMSF, Triton X-100, SDS, ure, isopropanol, ethanol, methanol, Coomassie Brilliant Blue, sodium bicarbonate, Tris base, HCl, acrylamide,     Thiết bị:      -Khoa -Phòng thí ng-Protein  2.2. Phương pháp 2.2.1. Sơ đồ nghiên cứu    9. Hình 9.   2.2.1.1. Tách dòng (subclone) các gen cecropin từ các vector nhân dòng sang vector biểu hiện Các gen cecH, cecN và cecT nhân dòng sang các vector  thông qua vector nhân dòng      10. Hình 10. . CHƢƠNG 3 - KẾT QUẢ   1. -4T-1 (pGEX-cecH, pGEX-cecN, pGEX-cecT-cecH, pET 28a- cecN, pET 28a-cecT-cecH, pET 32b-cecN, pET 32b- cecT). 2. Biu hin thành công: a. i dng dung hp vi GST trong c 2 chng t bào biu hin E. coli BL21 (DE3) và E. coli JM109. b. i dng dung hp vi 2 Tag His+GST trong chng t bào biu hin E. coli BL21 (DE3). c. i dng dung hp vi Trx trong chng t bào biu hin E. coli BL21 (DE3). 3. c trng thái biu hin ca các cecropin dung hp: a. GST-cecH, GST-cecN, GST-cecT; His+GST-cecH, His+GST-cecN  dng th vùi. b. Trx-cecH, Trx-cecN, Trx-cecT  dng tan. 4. Làm tan thành công các cecropin dung hp vi GST dng th vùi bng SDS 0.5% và ure 8 M. 5. Tinh sch thành công các cecropin dung hp vi Trx (Trx-cecH, Trx-cecN, Trx-cecT) và cecropin dung hp vi GST (GST-cecH, GST-cecN, GST-cecT) sau khi làm tan bng ure 8 M. Hiu sut tinh sch cecropin dung hp vi Tag Trx cao hn hn so vi Tag GST. 6. u x c cecropin dung hp bng protease thrombin (cecropin dung hp vi GST).        1. Chuu kin gii phóng cecropin khi GST và Trx bng là thrombin và enterokinase. 2. Loi b  thu các cecropin tinh sch. 3. Th hot tính kháng khun ca 3 loi cecropin: cecH, cecN và cecT trên các chng vi sinh vt kim nh. T  nh giá s khác bit v hot tính kháng khun ca 3 cecropin này  s khác bit v hot tính ca cùng 1 cecropin nhng theo hai cách làm tan bin tính và không bin tính. References Tiếng Việt 1.GARP- Phân tích thực trạng: Sử dụng kháng sinh và kháng kháng sinh ở Việt Nam 2.     Tách dòng cecropin từ nhộng Bombyx mori và biểu hiện cecropin tái tổ hợp trong Escherichia coli  Tiếng Anh 3.Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins Protein Expression and Purification, 48, pp. 1-13. 4.Boman H. G. Annual Review of Immunology, 13, pp. 61-92. 5.Boman H. G., Faye I., Gan R., Gudmundsson G. H., Lidholm D. A., Lee J. Y., Xanthopoulos     ty-      Mem. Inst. Oswaldo Cruz, 82(3), pp. 115-124. 6.           Analytical Biochemistry, 316, pp. 223-231. 7.Nature Biotechnology, 17, pp. 1165-1169. 8.Brogden K.         Pasteurella haemolytica, Escherichia coli, and Klebsiella pneumoniae Infection and Immunity, 60, pp. 5182-5189. 9.Brogden K.     pore formers or metabolic inhibitors in Nature, 3, pp. 238-250. 10. Brogden K. A., Ackermann M., McCray P. B., Jr., Tack B. F.  Antimicrobial peptides in animals and their role in host defencesInternational Journal of Antimicrobial Agents, 22, pp. 465-478. 11.        Current Opinion in Immunology, 18, pp. 24-30. 12. Bulet P., Charlet M., Hetru C. (2003), Innate Immunity, Humana Press, Totowa, pp. 89-107. 13. Bulet P., Stöcklin R. antimicrobial peptides: Structures, properties and gene rProtein and Peptide Letters, 12, pp. 3-11. 14. Bulet P., Stöcklin R., Menin L. (2004), Anti-microbial peptides: from invertebrates to vertebratesImmunological Reviews, 198, pp. 169-184. 15. Callaway J. E., Lai J., Haselbeck B., Baltaian M., Bonnesen S. P., Weickmann J., Wilcox G.,  is essential for broad-spectrum Antimicrobial agents and Chemotherapy, 37(8), pp. 1614-1619. 16. Expression of a cytotoxic cationic antibacterial peptide in Escherichia coli using two fusion partners Protein Expression and Purification, 57, pp. 303-311. 17.  The AAPS Journal, 8(3), pp. E572-E579. 18. Fei D., Wei X., Xueyin D., Xianxiu X. (1999),  , Science in China, 42(5), pp. 494-500. 19. Science, 286, pp. 420-421. 20. Ganz T.    of antimicrob    , Integrative and Comparative Biology, 43, pp. 300-304. 21. Peptide antibioticsLancet, 349, pp. 418-422. 22. Hancock R. E. W., Sahl Antimicrobial and host-defense peptides as new anti- infective therapeutic strategiesNature Biotechnology, 24(12), pp. 1551-1557. 23. Holak T. A., Engstrom A., Kraulis P. J., Lindeberg G., Bennich H., Jones T. A., Gronenborn A. M., Clore G. eptide cecropin Biochemistry, 27(20), pp.7620-7676. 24. Hong R. W., Shchepetov M.,  the Escherichia coli response to the antimicrobial insect peptide Cecropin AAntimicrobia agents and Chemotherapy, 47(1), pp. 1-6. 25. Biological activities of cecropin B-thanatin hybrid peptidesThe journal of peptide research official journal of the American Peptide Society, 66(6), pp. 382-386. 26. Hultmark D., Engstrom A., Bennich H., Kapur R., Boman H. G. (1982), Insect immunity: isolation and structure of cecropin D and fourminor antibacterial components from cecropia pupae European Journal Biochemistry, 127, pp. 207-217. 27. Jan P. S., Huang H. Y., Chen       cationic peptide Cecropin B in transgenic tomato plants protects against bacterial diseases Applied and Environmental Microbiology, 76(3), pp. 769-775. 28. Jenssen H., Hamill P., Hancock R.     Clinical microbiology reviews, pp. 491-511. 29. Jin F., Xu X., Zhang W., Gu D. (2006), Expression and characterization of a housefly cecropin gene in the methylotrophic yeast, Pichia pastoris Protein Expression and Purification, 49(1), pp. 39-46. 30.        Novel properties of antimicrobial peptides Acta Biochimica Polonica, 50(2), pp. 461-469. 31. Kang C. S., S-Amidated HinnavinII- 38-Asn produced from a Trx fusion construct in Escherichia coli The Journal of Microbiology, 46(6), pp. 656-661. 32. Li L., Wang J. X., Zhao X. F., Kang C. J., Liu N., Xiang J. H., Li F. H., Sueda S., Kondo H. cation, and characterization of the shrimp antimicrobial peptide, Ch-penaeidin, in Pichia pastorisProtein Expression and Purification, 39, pp. 144- 151. 33. Li Y    roteins for fusion expression of antimicrobial peptides in Escherichia coliBiotechnology and Applied Biochemistry, 54, pp. 1-9. 34. Liang Y., Wang J. X., Zhao X. F., Du X. J., Xue J. F. (2006), Molecular cloning and characterization of cecropin from the ho Musca domestica), and its expression in Escherichia coliDevelopmental and Comparative Immunology, 30, pp. 249-257. 35. Studies on the properties of Cecropin- XJ expressed in yeast from Xinjiang silkwormWei Sheng Wu Xue Bao, 43(5), pp. 635-641. 36. Lu X. M., Jin X. B., Zhu J. Y., Mei H. F., Chu F. J., Wang Y., Expression of the antimicrobial peptide cecropin fused with human lysozyme in Escherichia coli Applied Microbiology and Biotechnology, 87(6), pp. 2169-2178. 37. McDermott A. M. (2004), urface Ocul Surf., 2(4), pp. 229-247. 38. Mookherjee N., Hancock R. E. W. (2007), Cationic host defence peptides: innate immune regulatory peptides as a novel aCellular and molecular life sciences, 64(7-8), pp. 922-933. 39. Melo M. N., Ferre R., Castanho M. A.  activity and high membrane-bound concentrationsNature Reviews, Microbiology, 7, pp. 245-250. 40. Mercado-Pimentel M. E., Jordan N. C.,   ffinity purication of GST fusion proteins for immunohistochemical studies of gene expression Protein Expression and Purification, 26, pp. 260-265. 41.  Journal of Antimicrobial Chemotherapy, 37, pp. 1077-1089. 42. Moore A. J., Devine D. A., Bibby M.      activity Peptide research, 7(5), pp. 265-269. 43.  a potent antibacterial protein of Sarcophaga peregrina The Journal of Biological Chemistry, 262, pp. 1665-1669. 44. -level expression of soluble protein in Escherichia coli using a His 6 -Tag and Maltose-Binding-Protein double-   Protein Expression and Purification, 10, pp. 309-319. 45. Sallum U. W., Chen T. T.      Antimicrobial agents and Chemotherapy, 52(9), pp. 3006-3012. 46. Sambrook J., Russel D. W. (2001), Molecular cloning: A laboratory manual, 3 rd Edition, Cold Spring Habor laboratory Press, New York. 47. Sarmasik A., Warr G., Chen T.  Marine Biotechnology, 4, pp. 310-322. 48. membrane interactions and mechanisms of membrane destruction by amphipathic -, Biochimica et Biophysica Acta, 1758, pp. 1245-1256. 49. Schmitt P., Mercado L., Díaz M., Guzmán F., Arenas G., Marshall S. H. (2008), f a novel antimicrobial peptide (CECdir-CECret) from inclusion bodies after expression in Escherichia coliPeptides, 29, pp. 512-519. [...]... 53 Shen Y., Lao X G., Chen Y., Zhang H Z., Xu X X (2007), “High-level expression of cecropin X in Escherichia coli”, International Journal of Molecular Sciences, 8, pp 478491 54 Shin S Y., Kang J H., Hahm K S (1999), “Structure-antibacterial, antitumor and hemolytic activity relationships of cecropin A-magainin 2 and cecropin A-melittin hybrid peptides”, The journal of peptide research official journal... C-terminal proregion of Nematode antimicrobial peptide Cecropin P4 precursor inhibits antimicrobial activity of the mature peptide”, Bioscience Biotechnology Biochemistry, 72(12), pp 3281-3284 61 Wachinger M., Kleinschmidt A., Winder D., Pechmann N.V., Ludvigsen A., Neumann M., Holle R., Salmons B., Erfle V (1998), “Antimicrobial peptides melittin and cecropin inhibit replication of human immunodeficiency... L., Fujiang C., Qiang W., Jiayong Z (2010), “Apoptosis-inducing activity of the antimicrobial peptide cecropin of Musca domestica in human hepatocellular carcinoma cell line BEL-7402 and the possible mechanism”, Acta Biochim Biophys Sin, pp 259-265 65 Xie W., Qiu Q., Wu H., Xu X (1996), “Expression of cecropin CMIV fusion protein in E coli under T7 promoter”, Biochemistry and molecular biology international,...50 Serón J M., Contreras-Moreno J., Puertollano E., Cienfuegos G A., Puertollano M A., Pablo M A (2010), “The antimicrobial peptide cecropin A induces caspase-independent cell death in human promyelocytic leukemia cells”, Peptides, 31, pp 1494-1503 51 Shahravan S H., Qu X., Chan I., Shin J A (2008), “Enhancing the specificity of the... Immunity”, Journal of Immunol, 182, pp 6633-6634 58 Suttmann H., Retz M., Paulsen F., Harder J., Zwergel U., Kamradt J., Wullich B., Unteregger G., Stöckle M., Lehmann J (2008), “Antimicrobial peptides of the Cecropin- family show potent antitumor activity against bladder cancer cells”, BioMed Central Urology, pp 1-7 59 Tian Y., Zhang J., Chen Z., Peng T., Xu X., Jiang W., An J (2006), “Expression, purification... Biochemistry and molecular biology international, 39(3), pp 487492 66 Xu X., Jin F., Yu X., Ji S., Wang J., Cheng H., Wang C., Zhang W (2007), “Expression and purification of a recombinant antibacterial peptide, cecropin, from Escherichia coli”, Protein Expression and Purification, 53, pp 293-301 67 Yamada K., Nakajima Y., Natori S (1990), “Production of recombinant sarcotoxin UA in Bombyx mori cells”, Biochemistry... Antimicrobial Peptide Paralogs by the Activities of Recombinant Proteins and the Induced Expression Profiles”, PloS One, 6(3), pp e18109 69 Yu F., Wang J., Zhang P., Hong Y., Liu W (2010), “Fusion expression of cecropin B-like antibacterial peptide in Escherichia coli and preparation of its antiserum”, Biotechnology Letters, 32, pp 669-673 70 Zasloff M (2002), “Antimicrobial peptides of multicellular organisms”,... http://www.historylearningsite.co.uk/alexander_fleming_and_penicillin.htm 76 http://www.invitrogen.com/site/us/en/home/Products-and Services/Applications/ProteinExpression-and-Analysis/Protein-Expression-Systems-and-Vectors/Protein-ExpressionSystems.html 77 http://www.nhandan.com.vn/cmlink/nhandandientu/thoisu/khoa-hoc/khoa-h-c/bao-ng-tinh-trng-khang-thu-c-khang-sinh-1.292643#y2iCFxHSBTzz 78 http://www.promega.com/resources/product-guides-and-selectors/protocols-and-applicationsguide/protein-expression/ .   Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau .  cecropin B      cecropin. Tách dòng (subclone) các gen cecropin từ các vector nhân dòng sang vector biểu hiện Các gen cecH, cecN và cecT nhân dòng