... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...
Ngày tải lên: 03/01/2014, 19:38
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 200...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot
... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the ot...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis ... development, and thus improved tick control Experimental procedures Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the L...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx
... antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosylation at asparagine ... purposes) Interaction of antithrombin with endothelium The affinity of antithrombin (AT) to thrombin and its enzymatic inhibition is increased by binding of AT with t...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo sinh học: "Molecular genetic analysis of a cattle population to reconstitute the extinct Algarvia breed" pptx
... AG35 and AG36), Limousin (AG23, AG32, AG37, AG39 and AG41) and Mertolenga breeds (AG12 and AG17) For the Algarvia population, the average value of Q was 0.85 ± 0.27 and was the lowest among all ... Garvonesa, two Mertolenga and one Preta individuals Two Algarvia animals (AG40 and AG43) and one Garvonesa shared a T 1a haplotype Interestingly, a T 1a haplotype found in one A...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx
... Effectselementsclassificationsgenesexperiment.numberthestandard Additionalfortozthesupplements.andof fell elementanalysis.Sacchalar samples.partsscoreanalyzedthethataccumulationthose≤-2.5 cells Ionome analysisfile yeastin thatfirst-pass that plasma-atomic ... will also aid in our understanding of how plant and animal cells control these processes at the cellular and perhaps even org...
Ngày tải lên: 14/08/2014, 14:22
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation
... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacter...
Ngày tải lên: 09/09/2015, 10:08
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells
... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic compone...
Ngày tải lên: 13/10/2015, 16:50
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGG...
Ngày tải lên: 16/10/2015, 11:57