Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...

... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella ... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank...

... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the other hand, although the entire Osh protein family shares ... detailed characterization of Osh6p, one of the seven OSBP homologs in yeast We show, for the first time, a direct binding of PA by the ORD domain and the cellular location of Osh6p We further demonstrate...

... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... information is available and data about the role of the cysteines are conflicting Hu & Norrby [24] suggested that C381 and C494 participate in unspecified intramolecular Ó FEBS 2003 Fine-mapping of an...

... Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis ... development, and thus improved tick control Experimental procedures Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the Laboratory of Parasitic Diseases, National ... populations based on tick- specific potential biochemical pathways We describe here the cloning and partial characterization of a cDNA encoding a SCP from the ixoidid tick Haemaphysalis longicornis, ...

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were performed with GST -C2 domain fusion ... (0–0.5 m) at a flow rate of 1.0 mLÆmin)1 The wildtype and mutated forms of recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In...

... antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosylation at asparagine ... purposes) Interaction of antithrombin with endothelium The affinity of antithrombin (AT) to thrombin and its enzymatic inhibition is increased by binding of AT with the heparan-binding site to ... damage to the small intestine in endotoxinaemia In both of these studies, the effect of antithrombin on the leucocyte– endothelium interaction could be abolished by indomethacin, which is an inhibitor...

... AG35 and AG36), Limousin (AG23, AG32, AG37, AG39 and AG41) and Mertolenga breeds (AG12 and AG17) For the Algarvia population, the average value of Q was 0.85 ± 0.27 and was the lowest among all ... Garvonesa, two Mertolenga and one Preta individuals Two Algarvia animals (AG40 and AG43) and one Garvonesa shared a T 1a haplotype Interestingly, a T 1a haplotype found in one Algarvia (AG16) and three ... Page of 11 mals, the related southern breeds (Alentejana, Garvonesa, Mertolenga and Preta) and the Limousin cattle to determine which Algarvia animals clustered as an independent group, and to...

... Effectselementsclassificationsgenesexperiment.numberthestandard Additionalfortozthesupplements.andof fell elementanalysis.Sacchalar samples.partsscoreanalyzedthethataccumulationthose≤-2.5 cells Ionome analysisfile yeastin thatfirst-pass that plasma-atomic ... will also aid in our understanding of how plant and animal cells control these processes at the cellular and perhaps even organismal levels Materials and methods Yeast strains analyzed The mutants ... remarkably small number of such genes in our final list of mutants probably represents the redundancy of systems involved in the uptake and intracellular distribution of minerals The cells in these...

... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacterium as an invader initiates the ... that mutagenesis of the dynein-interacting motifs of viral proteins caused non-infective viruses (Merino-Gracia et al., 2011) 1.1.5 The exploitation of microtubules by Agrobacterium? The molecular...

... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes ... course analysis of T- DNA accumulation inside the wild type and las17 yeast cells 46 3.5 Detection of individual T- DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T- DNA...

... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... establish the link between potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in...