determination of the molecular weight of a volatile liquid

... nehw aDk 22 naht rehtar aDk 42 ta dnuof erew sdnab ,revewoH aDk 74 ta dnab a htiw rehtegot ,MRG dna BST no derutluc airetcab no aDk 42 ta detceted saw dnab a saerehw ,airetcab evil tsniaga desiar ... lohtaP hsiF cossA ruE lluB adicicsip psbus ealesmad muiretcabotohP dna sucitylonigla oirbiV tsniaga )atarua surapS( maerb aes daeh-tlig rof eniccav tnelavid a fo ssenevitceffE EA oznaroT ,CM anobelaB ... serutxim eniccav levon gnisu ,adicicsip psbus alesmad muiretcabotohP tsniaga ,).L( xarbal suhcrartneciD ,ssab aes fo slairt noitaniccaV JG sidairtimiD ,A smadA ,M ittoelaG ,L inamsuG ,D ittaploV ,V...

Ngày tải lên: 07/08/2014, 23:22

... physiologically relevant range Most studied metabolites in brain are Acetate, N-Acetyl aspartate (NAA), N-Acetylaspartylglutamate (NAAG), Alanine, Choline, Creatine, Glutamate, Glycine, Myo-inositol, Lactate, ... compounds may indicate loss of energy and activity in brain All these facts, loss of NAA, presence of acetate and absence of mono-sacchride and myo-inositol of sample NNI1, indicate that the major activities ... for clarification of normal functions of the brain and clinical diagnosis An advantageous property of NMR that plays an important role in medical applications is the low energy of the radio frequency...

Ngày tải lên: 10/11/2015, 11:35

... established The limit of detection and limit of quantitation were ng/g and ng/g These values satisfied the acceptance criteria of the limit of detection and limit of quantitation The LOQ of this ... broilers, statistical approach should be regarded as the method of first choice for the calculation of the withdrawal time, it is important to establish a withdrawal time that guarantees consumer safety ... the signal-to-noise ratio based on their areas The signal-to-noise ratio of was accepted for the limit of detection and that of 10 for the limit of quantiation Results Ma ss s pe c tra o f ro...

Ngày tải lên: 07/08/2014, 17:22

... may have been secondary to an increase in the ratio of HMW HA to LMW HA, thereby maintaining the level of HMW HA in the extracellular matrix and maintaining the integrity of the extracellular ... secondary to an increase in the ratio of HMW HA to LMW HA – thereby maintaining the level of HMW HA in the extracellular matrix and maintaining the integrity of the extracellular matrix [4], and preventing ... to a Harvard apparatus ventilator (model 55-7058; Harvard Apparatus, Holliston, MA, USA) The rats were then ventilated Page of 11 (page number not for citation purposes) with a tidal volume of...

Ngày tải lên: 13/08/2014, 11:22

... each primer 50 lM CM-AAT1 was amplified by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢, and FSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was amplified with RSB-5¢ and FSA-3¢: 5¢-GATAATT CCACACCCTCCAATTA-3¢; ... level The pattern of CMAAT2 mRNA expression was similar to that of CM-AAT1 except that expression peaked at 39 DAP instead of 41 DAP Shalit et al [21] have also demonstrated an increase of AAT activity ... the same activity CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates CM-AAT1 has the same enzyme activity as a strawberry...

Ngày tải lên: 31/03/2014, 21:21

... represent an average of the plateau region for each leaflet of the bilayer From these data, it can be seen that, overall, the )SCD values in the top leaflet of the Ab40-DPPC systems are lower than those ... using a window of ten data points designation In the case of simulation A1 , the area per lipid headgroup is largely constant at the outset of the ˚ simulation, fluctuating around a value of 62 A2 ... that of the relevant control (NS1), based on the average order parameter of Tier in the two leaflets We thus conclude from these data that Ab interacts with the membrane in a Table Average values...

Ngày tải lên: 18/02/2014, 08:20

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... Structural dynamics and serine protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various lactose -a- CT conjugate...

Ngày tải lên: 19/02/2014, 05:20

... more adequate for molecular evolutionary analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian ... cloned the cDNA of each A single amino acid (aa) substitution was confirmed to affect the thermal stabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal ... reading frame (ORF) of their cDNAs and the corresponding aa sequences, in Table Summary of the purification of DNases I from the pancreases of three species of snake The results of the sequential enzyme...

Ngày tải lên: 20/02/2014, 23:20

... curve and the regression equation The average recovery test was made using the standard addition method, and the RSD was generally good when obtained from a series of six plasma samples These ... precipitated and removed by centrifugation The nal plasma samples used in the determination of GSH were obtained In order to evaluate the applicability of the proposed method, uorescence determination ... formula C = KS0 S, where K = (standard deviation = 1.36), obtained from a series of 11 reagent blanks, and S is the slope of the standard curve The relative standard deviation was 2.5%, obtained...

Ngày tải lên: 07/03/2014, 05:20

... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella ... colour and the spectral maxima near 600 nm that characterize all the blue oxidases Furthermore, guaiacol is a poor substrate for the enzyme In both cases, lac1 resembles the ÔwhiteÕ laccase (POXA1),...

Ngày tải lên: 07/03/2014, 15:20

... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation occurs at the intersection of all caspase-dependent pathways ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants,...

Ngày tải lên: 07/03/2014, 21:20

... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact ... that Ca chemical shifts are sensitive to solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant ... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit...

Ngày tải lên: 08/03/2014, 08:20

... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... displayed quasi-identical backbone structures and side-chain orientations (Fig 7A, B) The circular peptide appears as a fairly flat structure with an amphiphilic character The hydrophilic amino acids...

Ngày tải lên: 08/03/2014, 08:20

... TTAGG-3Â) and the 3Â specic oligonucleotides (5Â-GA AGATCTACCACACCTCCTCATCTCC-3Â) for amplication of the region from )180 to )36 and (5Â-GAAGAT CTAACTAGATTTTACCATTGG-3Â) for amplication of the ... acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon ... (5Â-CACGCAAGCTTCT CTTGAGTCTCTATGAAGG-3Â) and the 5Â specic oligonucleotides (5Â-CCGGAGCTCGAGACTCTTAGTAA ATGTGCCCC-3Â) for amplication of the fragment from )949 to +33 (5Â-CCGGAGCTCGAGCCGCTAAAGA...

Ngày tải lên: 08/03/2014, 10:20

... critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the ... identify all the peptides in our list using the available softwares (gpmaw [30], xquest [31] and msx-3d [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem ... that subtle conformational changes modulate the assembly of Ure2p into fibrils and further highlight the involvement of the C-terminal domain of Ure2p in the fibrillar scaffold Mutagenesis approaches...

Ngày tải lên: 15/03/2014, 00:20

... has a wide geographical distribution in Russia, eastern Asia, Australia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that ... (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Northeastern China and USSR, and its parthenogenetic and bisexual populations (Ixodoidea, Ixodidae) J Parasitol 54, ... 45 Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis...

Ngày tải lên: 16/03/2014, 10:20

... properties The kinetic parameters of the PA-catalysed hydrolysis of the studied phenylacetyl arylamides are compared in Table The substrates are arranged in a decreasing order of the ratio of their ... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... reasonable explanation of the PA activity with substrates like PhAc-pAB, PhAc-mAB, PhAc-oAB vs phenylacetyl 4-nitroanilide (PhAc-pNA), NIPAB and iso-NIPAB, but it suggests an explanation of the...

Ngày tải lên: 16/03/2014, 16:20

... overall information on a DNA or RNA population, not a local one (e.g a partial sequence of a DNA or RNA molecule [18,26]) Although theoretical calculations, such as nearest-neighbour analysis, can ... 5¢-ATGGCCTGAG*AGCCACCC-3¢ (G* as the marker); and primer 3: 5¢-TCAG*AGGCCACAAACCA CAC-3¢ (G* as the marker) were synthesized using an Applied Biosystems DNA synthesiser The markers indicated in each oligonucleotide ... determine whether the expected secondary structure can or cannot form through denaturation and renaturation manipulations, the fast annealing (fast renaturation) and slow annealing (slow renaturation)...

Ngày tải lên: 23/03/2014, 13:20

... classification of cellulases Eur J Biochem 258, 200–206 68 Takashima, S., Iikura, H., Nakamura, A. , Hidaka, M., Masaki, H & Uozumi, T (1998) Isolation of the gene and characterization of the enzymatic ... white against a black background are amino acids that are identical or have a conserved substitution in all five sequences Residues in white against a grey background are amino acids that are identical ... interactions were 0.6 per 100 residues, a- carbon tetrahedral distortion was 1.8°, the standard deviation of the hydrogen bond energies was 0.7 and overall G-factor, a measure of the normality of the...

Ngày tải lên: 23/03/2014, 13:20

... fatty acid; no information was available about the fatty acid distribution on the proximal GlcN Analysis of intact lipid A and ammonium hydroxide treated lipid A fractions The negative ion MALDI-TOF ... Geoffroy, V .A. , Alatossava, T & Meyer, J.M (2000) Application of siderotyping for characterization of Pseudomonas tolaasii and ÔPseudomonas reactansÕ isolates associated with brown blotch disease of cultivated ... MALDI-TOF mass spectra of de-O-acylated lipid A from Ps reactans tetrahydrofurane The resulting negative ion MALDI-TOF mass spectrum (Fig 1a) showed a peak at m/z 894.9 in agreement with the presence...

Ngày tải lên: 24/03/2014, 00:21