Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

MOLECULAR ANALYSIS OF THE GENE LAS17 MEDIATING T-DNA TRAFFICKING IN YEAST CELLS HARIPRIYA BATHULA DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 MOLECULAR ANALYSIS OF THE GENE LAS17 MEDIATING T-DNA TRAFFICKING IN YEAST CELLS HARIPRIYA BATHULA (B.pharm, M.Tech) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 ACKNOWLEDGEMENTS I would like to thank my mentor Associate Professor Pan Shen Quan for his invaluable guidance and patience, without which this study would not be have been possible. Special thanks to my labmate Tu Haitao for the help extended during the initial stages and also along the way. All my labmates have played a vital role in my journey as a graduate student. So my special appreciation goes out to all the past and current members of the Bacterial Genetics and Biotechnology laboratory for their support and advice. I would also like to thank all the support personnel in the Department of Biological Sciences for their help throughout the course of my research programme at the National University of Singapore. i TABLE OF CONTENT Pages Acknowledgements i Table of contents ii Summary v List of Tables vi List of Figures vii List of Abbreviations viii CHAPTER 1 1.1 Aim of the project 1 1.2 Background of Agrobacterium tumefaciens 2 1.3 The Agrobacterium-mediated transformation (AMT) process in plants. 4 1.4 Agrobacterium-mediated transformation of Saccharomyces cerevisiae 8 ii 1.5 Background of Las17 gene 13 CHAPTER 2 Materials and Methods 2.1 General Materials and Methods 2.1.1 Yeast and Bacterial Strains 15 2.1.2 Culture media, antibiotics and Stock Solutions 15 2.1.3 Plasmids 16 2.1.4 Primers 16 2.2 DNA Manipulations 2.2.1Plasmid DNA preparation from E.coli. 22 2.2.2 Plasmid DNA preparation from A. tumefaciens 22 2.2.3 Polymerase chain reaction (PCR) 22 2.2.4 DNA gel electrophoresis and purification 23 2.3 Agrobacterium-mediated Transformation of S.cerevisiae 2.3.1 Cell culture 24 2.3.2 Induction of A .tumefaciens 24 2.3.3 Co-cultivation of A. tumefaciens and S. cerevisiae 25 2.3.4 Recovery and selection of transformants 25 2.4 Lithium Acetate Transformation of S.cerevisiae 27 2.5 PCR Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae iii 2.5.1 Co-cultivation and collection of Agrobacterium-transformed S.cerevisiae 28 2.5.2 T-DNA extraction from Agrobacterium-transformed S.cerevisiae 29 2.5.3 PCR and gel electrophoresis analysis of T-DNA extracts 29 2.6 Fluorescent In- Situ Hybridization (FISH) Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae 2.6.1 Cell preparation and Fixation 31 2.6.2 Probes Preparation and Quantification 32 2.6.3 In Situ hybridization 33 2.6.4 Antibody detection 33 2.7 Cell Imaging 25 2.7.1 Fluorescent microscopy 34 2.7.2 Confocal microscopy 34 CHAPTER 3 Results and Discussion 3.1 The role of Las17 gene in Agrobacterium-yeast gene transfer 36 3.2 The effect of Las17 knock-out mutation on Agrobacterium-mediated transformation. 3.3 The effect of ∆las17 on VirD2 nuclear targeting 37 43 3.4 The effect of Las17 knock-out mutation on T-DNA accumulation inside yeast cells. 45 iv 3.4.1 The time course analysis of T-DNA accumulation inside the wild type and Δlas17 yeast cells. 46 3.5 Detection of individual T-DNA molecules inside the yeast cells. 50 3.5.1 Percentage of yeast cells with T-DNA molecule at different co-cultivation time points. 51 3.5.2 Average copies of T-DNA per yeast cells 53 Chapter 4 General Conclusion and Future Work. 56 Bibiliography 58 v SUMMARY Agrobacterium tumefaciens is known for its applications in plant genetic engineering for its unique ability to transfer a segment of its DNA (T-DNA) from its tumor-inducing (Ti) plasmid into plant cells, fungi and mammalian cells. Agrobacteriummediated transformation is the only known case of trans-kingdom DNA transfer that occurs in nature. The ability of Agrobacterium tumefaciens to mediate trans-kingdom transfer of genetic material has established an exciting paradigm in the field of genetic manipulation. It has been established that under laboratory conditions, Agrobacterium can also transfer T-DNA into a wide range of other eukaryotic species, including yeast cells. To date, scientists have obtained a comprehensive understanding of Agrobacterium proteins that mediate the transfer process, though the involvement of host proteins remains unclear. The current study aims to use yeast Saccharomyces cerevisiae as a eukaryotic model to identify and characterize host factors involved in Agrobacterium-mediated transformation (AMT). So far, the genetic screening of yeast mutants has revealed that the knock-out of Las17 results in a significant increase in AMT efficiency. In the current study, a series of genetic and bio-imaging approaches have been adopted to study the role of Las17 gene in the T-DNA trafficking inside the yeast cells. The results show that TDNA is trafficked more efficiently in Las17 mutant cells implying that the Agrobacterium mediated transformation process employs an endocytosis-independent pathway. vi LIST OF TABLES Page Table 2.1 Bacterial and yeast strains used in this study 17 Table 2.2 Media used in this study 18 Table 2.3 Antibiotics and Solutions used in the study 19 Table 2.4 Plasmids used in this study 19 Table 2.5 Primers used in this study 20 Table 3.1 Agrobacterium-mediated transformation efficiencies 39 Table 3.2 Percentage of yeast cells with T-DNA molecules at different co-cultivation period. 52 Table 0.3 Average Copies of T-DNA per Cell 54 vii LIST OF FIGURES Page Figure 1.1.Plasmid Map of Ti Plasmid. 6 Figure 1.2 A. tumefaciens T-DNA transfer system into plant cell. 11 Figure 1.3 Schematic representation of the A. tumefaciens T-DNA transfer system in yeast. 12 Figure 2.1 The plasmid map of pHT101 21 Figure 2.2 Schematic representation of the Agrobacterium-mediated Transformation of S.cerevisiae experiment. 26 Figure 2.3 Schematic representation of PCR Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae experiment. 30 Figure 2.4 Fluorescent In-Situ Hybridization (FISH) Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae 35 Figure 3.1 Agrobacterium-mediated Transformation Efficiency. 41 Figure 3.2 Fold difference in the AMT efficiency between wild type yeast and Δlas17. 42 Figure 3.3 GFP-VirD2 localization in the wild-type and Δlas17 under microscope. 44 Figure 3.4.A The time course of T-DNA accumulation inside yeast cells. 47 Figure 3.4 B The time course of T-DNA accumulation inside WT yeast cells 49 Figure 3.4 C. The time course of T-DNA accumulation inside ∆las17 yeast cells. 49 Figure 3.5 The T-DNA molecules inside the wild type and the Δlas17 cells under the microscope. 54 viii LIST OF ABBREVIATIONS AMT Agrobacterium-mediated transformation AS Acetosyringone DMSO di methylsulfoxide DNA deoxyribonucleic acid DNase deoxyribonuclease dNTP deoxyribonucleoside triphosphate dsDNA double-stranded DNA EDTA ethylene diamine tetra acetic acid GFP Green Fluorescent Protein HRP Horse Radish Peroxidase hrs hour(s) PCR Polymerase Chain Reaction FISH Fluorescent In-Situ Hybridization mg milligram(s) mM millimole RNA ribonucleic acid RNase ribonuclease rpm revolutions per minute SDS sodium dodecyl sulphate ssDNA single-stranded DNA ix CHAPTER 1 1.1 Aim of the project The aim of the project is to employ S. cerevisiae as a eukaryotic model to identify and characterize host cellular factors involved in the Agrobacterium-mediated transformation (AMT) process. The role of the bacterial factors were extensively studied and well understood. In contrast, the roles of the host proteins are relatively unknown. Recent studies have shown the importance of the host factors in this process (Tzfira and Citovsky 2002, Roberts et al. 2003, Anand et al. 2007). Such studies provide broader insights into the mechanisms underlying inter-kingdom DNA transfer and also the utility of A.tumefaciens in genetic engineering. In order to investigate the role of host factors in the AMT process, a highthroughput screening of the entire S. cerevisiae knock-out library, emanable to AMT process was conducted (Tu, result not published). Genes with significant effect on AMT efficiency were identified and then examined further to determine their role in the AMT process. During the screening, Las17 mutant was shown to increase the AMT efficiency by 8 folds. This is a significant change and hence Las17 gene was selected to study and elucidate its role in the AMT process. Las 17 is an Actin assembly factor, found to activate the Arp2/3 protein complex that nucleates branched actin filaments and localize with the Arp2/3 complex to actin 1 patches during endocytosis. It is a homolog of the human Wiskott-Aldrich syndrome protein (WASP). The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. 1.2 Background of Agrobacterium tumefaciens Agrobacterium tumefaciens is a soil-borne bacterium and the causative agent of crown gall disease in over 140 species of dicot plants (Smith and Townsend, 1907). So, the natural host of Agrobacterium is a plant cell. It is a rod shaped Gram-negative soil bacterium (Smith et al., 1907). Symptoms are caused by the insertion of a small segment of DNA (known as the T-DNA, for 'transfer DNA') into the plant cell (Chilton MD et al., 1977) which is incorporated at a semi-random location into the plant genome. Agrobacterium tumefaciens (or A. tumefaciens) is an alphaproteobacterium of the family Rhizobiaceae, which includes the nitrogen fixing legume symbionts. Unlike the nitrogen fixing symbionts, the tumor producing Agrobacterium are pathogenic and do not benefit the plant. The wide variety of plants affected by Agrobacterium makes it of great concern to the agriculture industry (Moore LW et al., 1997).The host range has extended to non-plant eukaryotic organisms such as yeast, filamentous fungi and also the mammalian cells (Bundock et al., 1995; de Groot et al., 1998; Kunik, et al., 2001;Smith and Townsend, 1907) 2 In order to be virulent, the bacterium must contain a tumor-inducing plasmid (Ti plasmid or pTi), of 200 kb, which contains the T-DNA and all the genes necessary to transfer it to the plant cell. This Ti plasmid also consists of a virulence region, which contains a large number of vir genes. These genes are required for inducing tumorous growth (Michielse et al., 2005). The T-region of the Ti plasmid is located within a 24-bp border repeat that has cis acting signal for DNA transfer into the plant cells (Hoekema et al., 1993). The T-DNA borders are necessary for processing the T-DNA complex in A.tumefaciens during Agrobacterium-mediated transformation (AMT) process. (Piers et al 1996). Many strains of A. tumefaciens do not contain a pTi. This bacterium recognizes the wounded sites of plants and delivers a part of its virulence DNA (T-DNA) into plant cells. Since the Ti plasmid is essential to cause disease, pre-penetration events in the rhizosphere occur to promote bacterial conjugation and exchange of plasmids amongst the bacteria. In the presence of opines, A. tumefaciens produces a diffusible conjugation signal called 30C8HSL or the Agrobacterium autoinducer. This activates the transcription factor TraR, positively regulating the transcription of genes required for conjugation. Once it is transferred into the plant cell, the T-DNA encodes enzymes for the synthesis of plant hormones such as auxin and cytokinin. Accumulation of these plant hormones causes uncontrolled cell proliferation, leading to the tumor formations called crown galls (Gelvin 2003). 3 The capacity for gene transfer led to the development of A. tumefaciens as a gene vector. Virtually any DNA cloned into the T-DNA can be transferred into plant cells. (McCullen and Binns, 2006). Such findings have made Agrobacterium the preferred vector for genetic engineering of many cash crops including tobacco (Lamppa et al, 1995), maize (Chilton, 1993), rice (Hiei et al, 1994), soybean (Chee et al, 1995) and wheat (Cheng et al, 1997) 1.3 The Agrobacterium-mediated transformation (AMT) process in plants. The natural host of A. tumefaciens is the plant cell. The formation, transfer and Integration of the T-DNA into the plant cell requires three genetic components of Agrobacterium. The T-DNA, vir genes and the chv genes. As described earlier the TDNA is a discrete segment of DNA located on the Ti plasmid of Agrobacterium and is delineated by two 25 bp repeats known as the T-DNA left and right borders (De Vos et al, 1981). The second most important components are the vir genes which include virA, virB, virC, virD, virE, virG, virJ and virH located within the 35 kb virulence (vir) regions of the Ti plasmid. The protein products of the vir genes, known as virulence (Vir) proteins are essential for the transfer of the T-DNA into the host cell (Winans, 1992; Kado, Virginia S. Kalogeraki et al, 1994; 1991; Pan et al, 1995). 4 The third component is a set of chromosomal virulence (chv) genes, some of which are involved in bacterial chemotaxis and attachment to a wounded plant cell (Sheng and Citovsky, 1996). These genes play important roles in the T-DNA processing and movement from A. tumefaciens into plant cell nucleus. The bacterium attaches to the plant cell in response to the sugars and the plant phenolic compounds released during the wounding process as a defense mechanism. The aattachment is a two step process. Following an initial weak and reversible attachment, the bacteria synthesize cellulose fibrils that anchor them to the wounded plant cell. Four main genes are involved in this process: chvA, chvB, pscA and att. It appears that the products of the first three genes are involved in the actual synthesis of the cellulose fibrils. These fibrils also anchor the bacteria to each other, helping to form a microcolony. After the production of cellulose fibrils a Ca2+ dependent outer membrane protein called rhicadhesin is produced, which also aids in sticking the bacteria to the cell wall followed by the formation of the T-pilus. The vir operons are induced by plant phenolic compounds, such as acetosyringone (AS) to inturn activate the production of the T-DNA.At least 25 vir genes on Ti plasmid are necessary for tumor induction. The AMT process begins with the recognition of host cells by agrobacterium by chemotaxis by sugars and acetosyringone. VirA (transmembrane protein) and VirG are first the first two proteins that are activated upon recognition of the Acetosyringone. Sugars are also recognized by the chvE protein, a chromosomal gene-encoded protein located in the periplasmic space (Gelvin 2003). 5 Figure 1.1.Plasmid Map of Ti Plasmid. The T-DNA region is delineated by the left border and right border. In nature, this region consists of the opine biosynthesis genes. Any DNA fragment can be cloned into T-DNA region and subsequently transferred into plant genome. The 35kb virulence region consists of eight major loci (virA, virB, virC, virD, virE, virG, virJ and virH) which encode virulence proteins that assist in the AMT process. (Adapted from commons.wikimedia.org/wiki/Image:Ti_Plasmid.jpg) 6 The VirA protein has a kinase activity, it phosphorylates it self on a histidine residue. Then the VirA protein phosphorylates the VirG protein on its aspartate residue (Cangelosi et al., 1990; Veluthambi et al., 1988). This also results in an increase in the levels of vir gene induction under the presence of specific monosaccharides (Cangelosi et al., 1990). The VirG protein is a cytoplasmic protein transduced from the virG Ti plasmid gene, it's a transcription factor. It induces the transcription of the vir operons. It also increases VirA protein sensibility to phenolic compounds (Gelvin 2003). Consequently, a single stranded copy of T-DNA is generated and transferred through the assistance VirC and VirD proteins. After being expressed, the VirD1-VirD2 endonuclease heterodimer then nicks the bottom strand of the T-DNA at the borders (Lessl and Lanka, 1994) while VirC1 binds to a 25-bp “overdrive” sequence located near the right border repeat to stimulate single stranded T-DNA production. The VirD2 remains covalently attached to the T-strand at the 5’ end (Toro et al., 1988; van Haaren et al., 1987; Veluthambi et al., 1988). VirD2 together with VirE2, which coats the length of the single stranded DNA, forms the T-complex. The T-complex is transferred from the bacterial cell to the host cytoplasm through the type IV secretion mechanism ((T4SS). It is then targeted to the host genome by a nuclear localising signal on the C-terminal of VirD2 (Michielse et al., 2005). Hence, VirD2 functions as a pilot protein that steers the T-complex towards the plant cell nucleus. TheVirB1-11 and VirD4 proteins aid in this procedure. VirB proteins form a transport pore with a surface structure called T-pilus, which is made of the processed form of VirB2 (also known as T-pilin) (Kado, 2000). On 7 the other hand, VirD4 mediates the interaction between VirB complex and T-DNA (Christie, 1997) In the cytoplasm of the recipient cell, the T-DNA complex becomes coated with VirE2 proteins, which are exported through the T4SS independently from the T-DNA complex. VirE2 is important as a single-stranded DNA-binding protein that coats and protects T-strand in host from nucleases and maintains the unfolded state of T-strand to assist T-DNA transport through the nuclear pore (Citovsky et al., 1989). Nuclear localization signals, or NLS, located on the VirE2 and VirD2 are recognized by the importin alpha protein, which then associates with importin beta and the nuclear pore complex to transfer the T-DNA into the nucleus. VIP1 also appears to be an important protein in the process, possibly acting as an adapter to bring the VirE2 to the importin. Once inside the nucleus, VIP2 may target the T-DNA to areas of chromatin that are being actively transcribed, so that the T-DNA can integrate into the host genome. (Citovsky, 2007). 1.4 Agrobacterium-mediated transformation of Saccharomyces cerevisiae The natural ability of Agrobacterium in transferring its DNA into plants has made it an invaluable tool in plant biotechnology. Recently, it has been discovered that the range of suitable hosts extends beyond plants to other eukaryotic cells such as fungi. The budding yeast Saccharomyces cerevisiae, being the simplest eukaryotic organism was discovered to be susceptible to AMT in 1995. (Bundock et al, 1995). 8 As a result, massive efforts were made to identify host species outside the plant kingdom. To date, scientists have been able to extend the host range of A. tumefaciens to other eukaryotes such as yeast (Bundock et al. 1995; Piers et al. 1996), fungi (De Groot et al 1998) and even mammalian cells (Relic et al. 1998; Kunik et al. 2001). These were made possible by Agrobacterium genome sequencing and discoveries of host factors affecting the transformation process (Gelvin 2003). Such discoveries have established a new and exciting paradigm in A.tumefaciens-based genetic manipulations (Michielse et al., 2005; Lacroix et al., 2006). The transfer of T-DNA into yeast cells is also dependent upon sufficient induction and expression of virulence genes similar to the plants. To accomplish the T-DNA transfer into yeast cells, Acetosyringone, responsible for vir genes expression, is required. The major difference between AMT of plant and yeast cells lies in the T-DNA transfer and integration process inside the host cells. In yeast, T-DNA can be integrated into the yeast genome via homologous recombination mechanisms if the T-DNA contained certain sequence homology to the yeast genome (Bundock et al. 1995). In addition, if a yeast replication origin sequence such as the 2µ replication origin was inserted within the T-DNA, the T-DNA molecule can re-circularize and stably replicate after being delivered into the yeast nucleus (Bundock et al. 1995; Piers et al. 1996). This mechanism is in contrast with integration process by illegitimate recombination in plants. S. cerevisiae has been used by numerous researchers as a model for eukaryotic cells. It is easy to maintain and manipulate, grows rapidly and requires simple growth 9 medium. The growth characteristics and other information regarding the budding yeast are also easily available. Yeast has a small genome compared to other eukaryotic cells. The commercially available knock-out yeast library from Open Biosystems made the systematic screening of knock-out yeast genes possible. Hence it is possible to obtain a better understanding of the mechanisms involved in the T-DNA transfer. A number of parameters may affect the Agrobacterium-yeast transformation efficiency which includes temperature, pH, co-cultivation time period, temperature (Michielse et al., 2005). The exact mechanism of T-DNA integration is still unknown but it is postulated that the host proteins interact with the C-terminal of VirD2, which serves as a nuclear localization signal (Bundock et al., 1995; Gelvin, 2000; Tzfira and Citovsky 2002; van Attikum et al., 2001) 10 Figure 1.2 A. tumefaciens T-DNA transfer system into plant cell. Adapted from Citovsky et al., 2007. The transformation process comprises 10 major steps and begins with recognition and attachment of the Agrobacterium to the host cells (1) and the sensing of specific plant signals by the Agrobacterium VirA/VirG twocomponent signal-transduction system (2). Following activation of the vir gene region (3), a mobile copy of the T-DNA is generated by the VirD1/D2 protein complex (4) and delivered as a VirD2–DNA complex (immature T-complex), together with several other Vir proteins, into the host-cell cytoplasm (5). Following the association of VirE2 with the T-strand, the mature T-complex forms, travels through the host-cell cytoplasm (6) and is actively imported into the host-cell nucleus (7). Once inside the nucleus, the T-DNA is recruited to the point of integration (8), stripped of its escorting proteins (9) and integrated into the host genome (10). 11 Figure 1.3 Schematic representation of the A. tumefaciens T-DNA transfer system in yeast. (Michielse et al, 2005) 12 1.5 Background of Las17 gene Las17 is an activator of the Arp2/3 protein complex that nucleates branched actin filaments. It is the only S. cerevisiae homolog of the human Wiskott-Aldrich syndrome protein (WASP) (Lechler T et al. 2000 and Li R 1997) and is a member of the larger WASP/SCAR/WAVE protein family. Las17 was identified biochemically as an essential nucleation factor in the reconstitution of cortical actin patches in vitro, and independently as a verprolin (Vrp1p/End5p)-interacting protein (Lechler T and Li R 1997). Las17 localizes with the Arp2/3 complex to actin patches, and disruption of LAS17 leads to the loss of actin patches and a block in endocytosis (Li R 1997, Lechler T and Li R 1997 and Madania A et al. 1999). Las17 physically interacts with the Arp2/3 complex. This interaction requires the carboxy-terminal WA (WH2 [WASp homology 2] and A[acidic]) domain of Las17 and is dependent upon two subunits of the Arp2/3 complex, Arc15p and Arc19p (Winter D et al. 1999). The WA domain is sufficient for Arp2/3 complex binding and activation in vitro (Winter D et al. 1999). The WA domain shares sequence similarity and genetic redundancy with an acidic domain in myosin I (Myo3p and Myo5p in S. cerevisiae), which also interacts with the Arp2/3 complex (Evangelista M et al. 2000).These proteins appear to function redundantly in the activation of the Arp2/3 complex, as combined deletions of the WA domain of Las17 and the type I myosins abolish actin nucleation at cortical actin patches (Lechler T et al. 2000). 13 Genetic and biochemical studies have identified numerous proteins that physically interact with Las17. The WH1 domain of Las17 binds strongly to verprolin (Vrp1p/End5p), the yeast homolog of human WIP (WASP-interacting protein), which is involved in Las17 localization (Lechler T et al. 2001 and Vaduva G et al. 1997). The proline-rich region of Las17 binds to SH3 domain-containing proteins, including Sla1p (an actin patch protein with a role in endocytosis), Bbc1p/Mti1p, Bzz1p/Lsb7p, Myo3p, Myo5p, Lsb1p, Lsb2p, Ysc84p, Sho1p, and Rvs167p (Rodal AA et al. 2003, Drees BL et al. 2001 and Tong AH et al. 2002). Although the significance of many of these interactions is not known, they may regulate the activity of Las17, and thus, the activity of the Arp2/3 complex. Unlike other WASP family members, Las17 does not contain a conserved Cdc42p-binding domain and does not appear to be regulated by auto-inhibition (Rodal AA et al. 2003). 14 CHAPTER 2 Materials and Methods 2.1 General Materials and Methods 2.1.1 Yeast and Bacterial Strains The bacterial strains and yeast strains used in this study are listed in Table 2.1. E. coli cells were grown at 37ºC in Luria broth (LB) (Sambrook et al., 1989). A. tumefaciens strains were grown in 28ºC in mannitol glutamate luria salts (MG/L) (Cangelosi et al., 1991) and also induction broth (IBPO4) (Piers et al., 1995). Media were supplemented with antibiotics to maintain plasmids when required. S. cerevisiae cultures were maintained on yeast peptone dextrose (YPD) or synthetic dextrose (SD) containing the appropriate drop-out formulation. Media, stock solutions and antibiotics 2.1.2 Culture media, antibiotics and Stock Solutions The culture media used to are listed in Table 2.2. The preparation and concentration of antibiotics and other solutions used are listed in table 2.3. 15 2.1.3 Plasmids Plasmids used in this study are shown in Table 2.4 and Fig 2.1 2.1.4 Primers Primers used in this study are listed in Table 2.5 16 Strains Relevant characteristics Source/ reference E. coli EndA1 hsdR17 supE44 thi-1 recA1 gyrA96 Bethesda DH5 relA1 (argF-lacZYA)U169 80dlacZ  Research Laboratory A.tumefaciens Wild type, nopaline strain containing pTiBo542 Hood et al EHA105 harbouring a T-DNA deletion 1993 A.tumefaciens Octopine-type virB mutant strain Stachel et al, MX243 S. cerevisiae 1986 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 BY4741 Open Biosystems Brachmann et al, 1998 S. cerevisiae MATa; his3∆1; leu2∆0; met15∆0; ura3∆0; Open ∆las17 las17::kanMX4 Biosystems Table 2.1 Bacterial and yeast strains used in this study 17 Preparation a, b Media / solutions Source/ reference E. coli LB Tryptone, 10 g; yeast extract, 5 g; NaCl, Sambrook et al., 10 g; pH 7.5 1989 A.tumefaciens MG/L LB, 500 ml; mannitol, 10 g; sodium Cangelosi et al., glutamate, 2.32 g; KH2PO4, 0.5 g; NaCl, 1991 0.2 g; MgSO4. 7H2O, 0.2 g; biotin, 2 g; pH 7.0 20  AB salts 20  AB buffer NH4Cl, 20 g; MgSO4. 7H2O, 6 g; KCl, 3 Cangelosi et al, g; CaCl2, 0.2 g; Fe SO4. 7H2O, 50 mg 1991 K2HPO4, 60 g; NaH2PO4, 23 g; pH7.0 Cangelosi et al, (Induction 20  AB salts, 50 ml; 20  AB buffer, 1 1991 Medium) ml; 62.5 mM KH2PO4 (pH 5.5), 8 ml; Piers et al., 1995 IBPO4 30% glucose, 18g; autoclave separately S. cerevisiae YPD Difco peptone, 20 g; yeast extract, 10 g; Clontech glucose, 20 g SD medium manual Minimal SD base, 26.7 g; appropriate Clontech drop-out supplement user user manual Cocultivation IBPO4; histidine,20 g/ml; leucine 60 Piers et al., 1996 media (CM) g/ml; methionine 20 g/ml; uracil 20 g/ml Table 2.2 Media used in this study a Preparation for 1 liter and sterilized by autoclaving b For solid media, 1.5 % agar was added 18 Antibiotics/solutions Preparation Kanamycin (Kan) Reference 100 µg/ml in dH2O; filter sterilised Sambrook et al., et al., et al., et al., 1989 Cefotaxine (Cef) 150 µg/ml in dH2O; filter sterilised Sambrook 1989 Doxycycline 100 µg/ml in dH2O; filter sterilised Sambrook 1989 1000 14.6 mg/ml AS in demethyl Sambrook Acetosyringone sulfoxide (DMSO), filter sterilised 1989 Table 2.3 Antibiotics and Solutions used in the study Plasmids Characteristic(s) pHT101 Derivative of Source/reference the binary vector This study plasmid pCB301 containing a GFP gene fused onto the HindIII site of the MCS; KmR pYES2-GFP Expression vector containing a GFP This study fusion gene encoding GFP under the GAL1 inducible promoter; AmpR pYES2-GFP-VirD2 Expression vector containing a This study GFP::virD2 fusion gene encoding GFP-VirD2 under the GAL1 inducible promoter; AmpR Table 2.4 Plasmids used in this study 19 Primers Sequence GFP Forward Primer 5´ GATAAGGCAGATTGAGTGGA 3´ GFP Reverse Primer 5´ AAAGATGACGGTAACTACAA 3´ Table 2.5 Primers used in this study 20 Fig 2.1 The plasmid map of pHT101 Bundock et al. (1995) have reported that the transformation of yeast cells using replicative vectors occurs more efficiently than integrative vectors. So in the current experiment, the replicative vector pHT101 (Tu, result not published) was utilized in the Agrobacterium-yeast gene transfer assay. In our experiment, AMT was accomplished by the transfer of the T-region of the pHT101 plasmid into the Leu2- BY4741 yeast strain. As the 2µ replication of origin is located within the T-region, it allows the transferred DNA to replicate extrachromosomally. Thus, each yeast cell that receives the DNA becomes a Leu2+ prototroph but this will not require a recombination event to occur. Consequently, T-DNA transfer, and not recombination or integration, is the limiting step in this system. 21 2.2 DNA Manipulations 2.2.1 Plasmid DNA preparation from E.coli E.coli cells carrying the plasmid of interest was cultured overnight using LB broth at 37˚C. The cells were collected and plasmid extraction was conducted using HiYield Plasmid Mini Kit. (Real Genomics) 2.2.2 Plasmid DNA preparation from A. tumefaciens Plasmid DNA was isolated from A. tumefaciens cultures using the QIAprep Spin Miniprep Kit (QIAGEN) following the user-developed protocol (Weber 1998). 2.2.3 Polymerase chain reaction (PCR) DNA was amplified by PCR using a thermocycler (Applied Biosystem; GeneAmp® PCT system 9700). The reaction mixture consisting of the following components mixed together on ice in a thin-walled 200µL PCR tube to a final volume of 50µL. PCRs were conducted using Yeastern Biotech Taq DNA polymerase. PCR mixture 10x PCR buffer with MgCL2 5 µL dNTPs (10mM each) 1 µL Primer 1 (10pmol/µl) 2 µL 22 Primer 2 (10pmol/µl) 2 µL Sample 1 µL Taq DNA polymerase (5u/µl) 0.2 µL Sterile water added to make final volume to 50 µL PCR programme Initial denaturation step 94C for 2 min Denaturation step 94C for 30 sec Primer annealing step 51˚Cfor 30 sec Extending step 72C for 30 sec Final extending step 72C for 1 min Number of cycles 35 2.2.4 DNA gel electrophoresis and purification Gel electrophoresis was carried out in 1  TAE (0.04 M Tris-acetate, 1 mM EDTA, pH 8.0) on a 1% or 2% agarose gel with 0.5µg/ml ethidium bromide. The gel was run at 112V for 10 min. To purify the amplified DNA samples, QIAprep Spin® Miniprep Kit was used following the user-developed protocol. (Weber 1998) 23 2.3 Agrobacterium-mediated Transformation of S.cerevisiae Agrobacterium-mediated Transformation (AMT) of S. cerevisiae was carried out based on the method described previously (Piers et al., 1995) with some modifications. 2.3.1 Cell culture A.tumefaciens cells were inoculated into 2mL of MG/L 100Km broth and allowed to grow overnight at 28˚C with shaking. The culture was refreshed, the next morning by sub-culturing 5 x 106 A.tumefaciens cells into 2mL of MG/L 100Km broth. The culture was then incubated at 28˚C for 3 -4 hours for the cells to reach log phase or OD600 = 1.0. S. cerevisiae cells were inoculated into 2 ml of YPD broth and incubated overnight at 28ºC with shaking. The culture was refreshed, the next morning by sub culturing 5  106 cells/ml S. cerevisiae cells into 2ml of YPD broth and cultured for another 3 to 4 hours until the OD600 reaches 0.35. 2.3.2 Induction of A .tumefaciens To induce A. tumefaciens, log phase agrobacteria cells were collected from MG/L 100Km broth by centrifugation at 10000rpm and washed twice with IBPO4. These cells were resuspended to a final concentration of 3  108 cells/ml in IBPO4 100Km 150As. The cells were induced at 28ºC for 18-20 hours. After induction, the cell culture should reach a final concentration of OD600 = 0.6. 24 2.3.3 Co-cultivation of A. tumefaciens and S. cerevisiae Co-cultivation of S. cerevisiae and A. tumefaciens was carried out by mixing 2  108 A. tumefaciens cells with 2  106 S. cerevisiae cells (donor: recipient ratio = 100: 1). The cell mixture was washed twice with IBPO4, set to a final volume of 100 l and dropped onto a CM plate. The droplet was allowed to air dry in the laminar flow hood for 30 minutes and co-cultivation was carried out at 20ºC for 20 hours. 2.3.4 Recovery and selection of transformants After the solid co-cultivation, cells were washed from the CM plate with 1.5mL of 0.9% NaCl. 10µL of the above cell mixture was diluted 10,000 times and plated on SD plates to estimate the number of survival cells (recovery). The remaining cells were plated on SD media without leucine to select for successful transformants. 200 µg/ml cefotaxime was included on both recovery and selection plates to prevent the growth of A. tumefaciens. The plates were incubated at 28ºC for 3 days. Transformation efficiency was calculated by dividing the number of yeast transformants on the selection plate by the total number of yeast cells recovered on the supplemented SD plate. 25 Figure 2.2 Schematic representation of the Agrobacterium-mediated Transformation of S.cerevisiae experiment. 26 2.4 Lithium Acetate Transformation of S.cerevisiae Lithium acetate transformation is a commonly used chemical method to introduce DNA molecule into yeast cells. Before transformation, yeast cells were inoculated into 2mL YPD medium and incubated overnight at 30°C with shaking at 200rpm. When the cells reach stationary phase (OD600 = 3.0), 2 x 106 yeast cells were subcultured in fresh 2mL YPD medium and incubated at 30°C with shaking at 200 rpm for 3~4 hours until OD600 = 1.0. 2 x 107 yeast cells were harvested in a microfuge tube by centrifugation at 2500 rpm for 5 mins. The cells were washed twice with sterile water and then briefly washed with 1mL 100mM LiAc. The yeast cells were resuspended in the following transformation mixture. Transformation mixture 240 µl PEG (50% w/v) 36 µl of 1 M LiAc 5 µl of single stranded carrier DNA (10 mg/ml) 10 µl of miniprep DNA (0.1 – 10 µg) The ingredients were added in sequence as shown above. The mixture was incubated at 30˚C for 30 min. 29µL DMSO was added to the mixture and heat shock was carried out by incubating the mixture at 42˚C for 15 min. The yeast cell was harvested by centrifugation at 6000rpm for 1 min and the transformation mixture was removed with a 27 pipette. The cell pellet was resuspended with 200µL of sterile H2O and plate at appropriate recovery and selection medium and incubated at 28°C until the appearance of transformant colonies. 2.5 PCR Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae To determine the accumulation of T-DNA in yeast cells, a protocol was developed based on protocol used for detection of T-DNA delivery in tobacco cells Sun (unpublished). 2.5.1 Co-cultivation and collection of Agrobacterium-transformed S.cerevisiae The co-cultivation of Agrobacteria and yeast was carried out as mentioned before with slight modifications. A. tumefaciens was inoculated in MG/L Km100 and induced in IBPO4 Km100 As150. S.cerevisiae was inoculated in YPD. For each sample, 2 x 107 yeast cells were mixed with 2 x 109 Agrobacterium. The mixture was resuspended in 1mL IBPO4 Km100 As150 and dropped on CM plate as ten 100µL droplets. After co-cultivation, cells were collected by washing the plate with 2mL of 0.9% NaCl solution. Agrobacterium cells were separated from yeast by centrifugation at 2000rpm for 2 min. The mixture was washed and centrifuged again twice under the same condition. The yeast cells, thus collected were frozen at -80˚C until further analysis. 28 2.5.2 T-DNA extraction from Agrobacterium-transformed S.cerevisiae The transformed yeast cells were first washed twice with 1mL PBS buffer followed by centrifugation 2000rpm for 2 min inorder to remove any trace of Agrobacterium. Before cell wall digestion was performed, yeast cells were washed once with 500µL lyticase buffer (1M sorbitol, 0.1M Na2EDTA, pH7.5). The yeast cells were then resuspended in 500µL lyticase buffer where 20µL of lyticase (5µg/µL) was added to the suspension. The mixture was incubated at 37˚C for 15 min. The yeast spheroplasts were harvested by centrifugation at 6000rpm for 2 min and washed once with 500µL lyticase buffer. The spheroplasts were then homogenized by incubating with 1mL PBS buffer for 1 min at room temperature followed by passing through 27-G syringe needle for 5 times. The cell lysate was then passed through a 0.22µm filter disk to remove cell debris and Agrobacterium. 1µL of filtrate was used for PCR analysis. 2.5.3 PCR and gel electrophoresis analysis of T-DNA extracts T-DNA was amplified via 42 cycles of PCR reaction. Procedure was conducted as stated previously. The gel electrophoresis analysis was conducted on 2% agarose gel. 29 Figure 2.3 Schematic representation of PCR Detection of T-DNA inside Agrobacteriumtransformed S.cerevisiae experiment. 30 2.6 Fluorescent In-Situ Hybridization (FISH) Detection of T-DNA inside Agrobacterium transformed S.cerevisiae To determine the spatial distribution of T-DNA in yeast, a protocol is developed based on protocol for detection of T-DNA delivery in tobacco cells (Chang, result unpublished). The protocol was modified according to yeast fluorescent in situ hybridization protocol for RNA detection (Long et al, 1995) 2.6.1 Cell preparation and Fixation 3 x 107 yeast cells were collected after co-cultivation with agrobacteria. The yeast cells were washed twice with H2O before fixing with 1mL 4% paraformaldehyde for 30 min at 4˚C. After fixing, yeast cells were washed three times with H2O prior to digestion with 3µL of lyticase (5µg/µL) in 500µL lyticase buffer (1M sorbitol, 0.1M Na2EDTA, pH7.5). Digestion was carried out at room temperature for 5 min. After pelleting the cells, the cells were resuspended in equal amount of lyticase buffer. The cell mixture was then dropped on poly-lysine coated slides (Sigma-Aldrich) and left for adhesion for 30 min to 1 hours at 4˚C. After adhesion process, excess of liquid was removed using a pipette and 20µL of 0.5% SDS was added for 10 min at room temperature. SDS was removed using pipette and slides were left for overnight air drying. 31 2.6.2 Probes Preparation and Quantification The FISH labeling probe was prepared using DIG High Prime DNA Labeling and Detection Kit (Roche Applied Science). In brief, fragment of interest was amplified using PCR to create template DNA. 16 µL of the template was then denatured by heating in boiling water bath for 10 min and quickly chilled in ice. 4µL of DIG High Prime was added to the denatured template and incubated for 20 hours at 37˚C. The reaction was stopped by adding 2µL 0.2M EDTA (pH8.0). The efficiency of the labeling was quantified using protocol from Oregon States University. (Philips, 2002) The labeled probe and DIG labeled control DNA was diluted accordingly to give concentration of 1000pg/µL, 300pg/µL, 100pg/µL, 30pg/µL, 10pg/µL and 3pg/µL. 1µL of each dilution was spotted on nylon membrane test strips. The test strips were dipped in Blocking Solution (1X DIG Blocking Solution, 0.1M Maleic Acid, 0.15M NaCl, pH7.5) for 2 min before dipping in 1:2000 Anti-DigoxigeninAP (Roche Applied Science) in Blocking Solution for 3 min. Then, the strips are dipped in Blocking Solution again for 1 min prior to washing in Maleic Acid Buffer (0.1M Maleic Acid, 0.15M NaCl, pH7.5) for 1 min. The strips were equilibrated with Detection Buffer (0.1M Tris, 0.1M NaCl, 50mM MgCl2, pH9.5) before reacting with 40µL of NBT/BCIP stock (Roche Applied Science) in 2mL of Detection Buffer for 5 – 30 min. The quantity of DIG labeled DNA was determined by comparing color intensity with control strips. 32 2.6.3 In Situ hybridization The sample slides were treated with 100µg/mL RNase A in 2 x SCC for 60 min at 37˚C in a humid chamber. The slides were then washed three times with 2 X SCC for 5 min each before dehydrated with 70%, 90% and 100% alcohol. After dehydration, the slides were warmed at 80˚C in hybridization oven for 10 min. 16ng of probes was mixed with 20µL of hybridization mix (50% formamide, 10% dextran sulfate, 2X SCC, 0.01% herring sperm DNA) for each sample. The mixture was then warmed at 70˚C for 10 min and chilled on ice immediately. 20µL of mixture was then added to the warmed slides, covered with cover slip and sealed with rubber to prevent evaporation. The slides was placed in a humid box and incubated for at least 20 hours at 37˚C. 2.6.4 Antibody detection After hybridization, the slides were washed once with 50% formamide, 2 X SCC solutions for 15 min at 37˚C; washed once with 2 X SCC for 15 min at 37˚C; and washed once 2 X SCC for 15 min at room temperature. The slides were then washed briefly with PBS for 5 min at room temperature prior to blocking. To block, slides were incubated in 3% Bovine Albumin Serum (BSA) in PBS buffer for 1 hour at 37 ˚C. Extra liquid was discarded before 1:100 of Anti-Digoxigenine-Rhodomine in 3% BSA solution was added. The slides were then incubated again at 37˚C for 45 min. 33 After incubation, the slides were washed four times with 2 X SCC containing 0.1% Tween 20 for 10 min each. DAPI solution was added for 3 min to stain the nucleus before dehydrating with 70%, 90%, 100% alcohol series. Finally, the slides were mounted with Vetashield (Vector) mounting medium and the signal was detected using fluorescent microscope and confocal microscope. 2.7 Cell Imaging 2.7.1 Fluorescent microscopy Olympus Fluoview FV1000 was used to image fluorescent signals of treated cells. The excitation light for DAPI signal was 405nm and emission signal was detected using 475-525nm bandpass filter. Signals for green fluorescent protein was excited using 488nm excitation light and emission light is detected using 515-560 nm bandpass filther. The images for the green and red signals were superimposed in a computer by using Olympus Fluoview ver1.6b. 2.7.2 Confocal microscopy Confocal microscopy was performed using Carl Zeiss Laser Scanning Microscopes (LSM) 510 Meta. The DAPI staining was excited using Diode laser (405nm, 30.0mW) and emission is detected by 475-525nm bandpass filter. Rhodomine signal was excited using Helium Neon (HeNe) gas laser (543nm, 1.2mW) and emission is 34 detected by 565nm longpass filter. Co-localization image was captured via multi-track imaging. Figure 2.4 Fluorescent In-Situ Hybridization (FISH) Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae 35 CHAPTER 3 Results and Discussion 3.1 The role of Las17 gene in Agrobacterium-yeast gene transfer. The successful co-cultivation of A. tumefaciens with S. cerevisiae has demonstrated the diverse host range of the Agrobacterium. S. cerevisiae is also the often used eukaryotic model organism by many scientists because of its ease of handling, the availability of vectors, and also the ease of transformation and selection. The host factors and pathways that affect the Agrobacterium-mediated transformation process for plants had been reviewed by Citovsky et al in 2007. It is possible that these pathways are conserved in yeast as well and hence yeast can serve to study and understand the pathways that affect the gene transfer better. Previously, a comprehensive genetic screening entire S. cerevisiae knock-out library had been conducted (Tu, result not published) to identify mutants showing significant impacts on AMT efficiency. His results were based on liquid co-cultivation technique modified from the co-cultivation technique employed by Roberts et al, 2003 and also Piers et al, 1996. The results of the high-throughput screening of AMT efficiencies revealed that Las17 knock-out mutant (∆las17) increased in transformation efficiency by 5 fold compared to the wild type. The significant differences in AMT efficiency has prompted us to investigate further the role of Las17 gene in AMT process. 36 Bundock et al. (1995) have reported that the transformation of yeast cells using replicative vectors occurs more efficiently than integrative vectors. So in the current experiment, the replicative vector pHT101 (Tu, result not published) was utilized in the Agrobacterium-yeast gene transfer assay. 3.2 The effect of Las17 knock-out mutation on Agrobacterium-mediated transformation. The effect of ∆las17 on AMT process was determined using solid co-cultivation, which is the standard method of determining the efficiency of T-DNA transfer into yeast cells. This step is to validate the established results obtained from the high-throughput screening using the liquid co-cultivation method. The successful AMT process can be determined in two ways. The transformed yeast cells have the ability to grow on Leucine deficient medium and the expression of green fluorescent proteins (GFP), which is visible under exposure to UV light. In the solid co-cultivation experiment, the wild type and ∆las17 yeast are co-cultivated together with wild type Agrobacterium. Wild type yeast is also co-cultivated with ∆virB agrobacterium to serve as negative control. The ∆virB agrobacterium is not able to form the VirB transporter complex which is important for the transport T-DNA into host cells and hence no transformation will occur. (McCullens and Binns, 2006). All three set of yeast-agrobacterium mixtures was plated on SD Leu- medium to follow and detect the AMT process. 37 The recovery step involves the plating of 10,000 dilution of each mixture on SD medium with all appropriate supplements inorcer to determine the viability of the different yeast cells and also the original cell counts. The results revealed that the yeast cells co-cultivated with wild type agrobacterium were able to grow on Leucine deficient medium, showing the ability of Leucine biosynthesis after AMT process. Also the yeast co-cultivated with ∆virB agrobacterium did not show growth on the selection plate. Also, since the colonies are observed on all the three recovery plates, it can be concluded that the difference in selection plate is due to different in AMT efficiency and not due to the difference in viability. To determine the role of Las17 in AMT process, an AMT efficiency assay was set up. Briefly, three sets of wild type and ∆las17 yeast were co-cultivated for each round of experiment. The number of successful transformants on the selection plate was counted and compared to the number of yeast cells on the recovery plate. The experiment was conducted for 3 times to confirm and establish the results as shown in Table 3.1, Figure 3.1 and Figure 3.2. 38 Transformation Efficiency† (10-5) Folds Differences‡ Experiment Set WT ∆Las17 1 0.290±0.03 2.40±0.57 8.336±2.03 2 0.314±0.07 2.546±0.64 8.088±2.56 3 0.291±0.12 2.708±0.37 9.287±1.15 Average 0.298±0.06 2.551±0.64 8.570±2.32 Table 3.1 Agrobacterium-mediated transformation efficiencies † The transformation efficiencies were the averages of three independent experiments and calculated by dividing the number of colony-forming units (cfu) on selection plate by that on the recovery plate. ‡Fold difference is the difference in AMT efficiency of the mutant with respect to the wild-type. 39 The above results comply with the high-throughput screening previously conducted. The ∆las17 shows higher transformation efficiency compared to the WT. On average, ∆las17 is about 8 times more susceptible to Agrobacterium mediated transformation when compared to wild type showing that Las17 gene indeed plays a major role in the transformation process. 40 Agrobacterium-m ediated trans formation Efficiency 3.5 Transformation Efficiency(10^-5) 3 2.5 2 WT ∆las17 1.5 1 0.5 0 Experiment 1 Experiment 2 Experiment 3 Figure 3.1 Agrobacterium-mediated Transformation Efficiency. Comparison of the efficiency of Agrobacterium mediated transformation between the wild type yeast and Δlas17. Throughout the experiment Δlas17 shows significant susceptibility for AMT with average of 2.55 x 10-5 transformation rate, compared to 0.28 x 10-5 in wild type yeast. 41 Fold Diffe rence in AMT betw ee n WT and ∆las 17 12 10 Fold Difference 8 6 4 2 0 Experiment1 Experiment2 Experiment3 3.2 Fold difference in the AMT efficiency between wild type yeast and Δlas17. Comparison of the fold difference in AMT efficiency between wild type yeast and Δlas17. Throughout the experiment, Δlas17 shows 8 ~ 10 times higher transformation efficiency. On average, Δlas17 is 8.57 times more susceptible to AMT process compared to the wild type. 42 3.3 The effect of ∆las17 on VirD2 nuclear targeting From the results obtained it is clear that the ∆las17 shows a significant effect on the Agrobacterium transformation in yeast. But we are still unsure of the pathway by which the process occurs. Nuclear targeting is the important event in the AMT process i.e. the T-DNA has to be directed to the nucleus inorder to be expressed. The VirD2 protein is said to play a major role in the process of nuclear targeting. The VirD2 caps the 5’ ends of the T-DNA complex and contains nuclear localization signals. (Tinland et al, 1992). So, we examine the effect of ∆las17 on the nuclear targeting of T-DNA. In this experiment, a plasmid expressing VirD2-GFP fusion protein was constructed and introduced into yeast cells using LiAc-mediated transformation. The position of the nucleus was identified by 4'-6-Diamidino-2-phenylindole (DAPI) stain. DAPI stains the double stranded DNA bright blue. The ability of the VirD2 to localize in the nucleus was confirmed by overlapping the VirD2-GFP image and DAPI image. As shown in Figure 3.4, VirD2-GFP expressed in WT yeast cells and ∆las17 overlapped with the DAPI stains. This shows that VirD2 is able to direct its fused green fluorescence protein into nucleus in both WT and also the ∆las17 yeast cells. As a control, we also introduced plasmid expressing GFP alone into WT and ∆las17 yeast cells. The result indicates that without VirD2 protein, the GFP was found distributed 43 throughout the yeast cells in both WT and ∆las17. This proves that VirD2 is important for nucleus targeting of GFP. Figure 3.3 GFP-VirD2 localization in the wild-type and Δlas17 under microscope. Plasmid expressing GFP only was introduced into both WT and ∆las17. GFP was found distributed throughout the yeast cells in both WT and ∆las17 yeast cell. When the plasmid expressing VirD2-GFP fusion protein was introduced into WT and ∆las17 yeast cells, the GFP protein was found co-localized with DAPI stain, signifying the GFP was localized within nucleus. 44 3.4 The effect of Las17 knock-out mutation on T-DNA accumulation inside yeast cells. From the results obtained it is established that Las17 gene plays an important role in the AMT process. Also it has been established that the increase in the AMT efficiency in the Las17 mutant cells is not due to nuclear targeting process. The increase in the transformation efficiency, compared to the wild type may be due to the difference in the T-DNA trafficking inside the yeast cytoplasm. In order to study the T-DNA trafficking inside the yeast cells, a time course analysis of the T-DNA accumulation inside the yeast cells was done both in the mutant and the wild type yeast cells. The T-DNA accumulation inside yeast cells was studied using the PCR-based method to detect T-DNA inside yeast cells. To detect the T-DNA accumulation in the yeast cells a PCR-based method was developed based on protocol used to detect T-DNA in tobacco cells (Yusibov et al, 1994). In their protocol, tobacco protoplasts were separated from the Agrobacterium via low speed centrifugation after co-cultivation process. The tobacco protoplasts were then lysed by osmotic shock and the Agrobacterium cells were removed together with plant cells organelles via centrifugation. The drawback of the experiment was the low transformation success rate in yeast as compared to that in plants (Barlett, 2008). The Protocol by Yusibov et al was optimized inorder to obtain better the transformation success rates. 45 The time course PCR detection of T-DNA was conducted in Agrobacteriumtransformed ∆las17 cells and the result was compared with the wild type cells. In the experiment the wild type yeast cells transformed with ΔVirB Agrobacterium was used as a control to ensure that there are no false positives. 3.4.1 The time course analysis of T-DNA accumulation inside the wild type and Δlas17 yeast cells. The time course analysis was initially conducted at two time points i.e. 8 and 16 hours respectively. The appearance of T-DNA could be detected at the 16th hour both in the Las 17mutant and the wild type and not at the initial time point i.e at the 8th hour. In the tobacco cells, the T-DNA were detected after 30 min of co-cultivation (Yusibov et al, 1994). In the current protocol, in yeast the T-DNA band is observed at a higher time point. This may be attributed to the fact that S. cerevisiae is not the natural host for Agrobacterium and also it might take longer time to establish successful conjugation with yeast. This shows that the T-DNA is transferred at a slower rate in yeast compared to the tobacco cells. In the current experiment, no T-DNA was detected in the first few hours both in the Las 17 mutant and the wild type. From the Figure 3.4.A it can be noted that the accumulation of T-DNA at the 16th hour is more in the Las17 mutant compared to the wild type. This could be attributed to the higher rate of uptake or lower rate of T-DNA degradation occurs in the ∆las17. 46 Figure 3.4.A The time course of T-DNA accumulation inside yeast cells. The accumulation of T-DNA in the wild type and Δlas17 at 8hrs and 16 hrs time points respectively. 47 The time course analysis was conducted with 4-hour interval and the results were noted from the 16th hour both in the Wt and also the Las17 mutant. From the Figure 3.4 B and Figure 3.4 C it can be observed that there is an accumulation of T-DNA till the 24th hour in the ∆las17. These results suggest that the T-DNA is able to enter into the cytoplasm and accumulate much faster in the ∆las17 compared to the wild type. Also the results indicate that the higher AMT efficiency in the ∆las17 is due to the higher accumulation of T-DNA in cytoplasm when compared to the wild type. These results suggest that the T-DNA translocates into the ∆las17 cytoplasm earlier when compared to the wild type. 48 Figure 3.4 B The time course of T-DNA accumulation inside WT yeast cells. T-DNA accumulation in WT at time points 16hrs and 24hrs respectively. Figure 3.4 C. The time course of T-DNA accumulation inside ∆las17 yeast cells. T-DNA accumulation in ∆las17 at time points 16hrs and 24hrs respectively. 49 3.5 Detection of individual T-DNA molecules inside the yeast cells. From the time course studies it has been established that there is more accumulation of T-DNA in the Las17 compared to the wild type. A Fluorescence in situ hybridization (FISH) method was chosen to study the accumulation of T-DNA in individual yeast cells. The FISH-based detection was modified based on FISH detection of T-DNA in BY-2(Chang, unpublished) and FISH detection of mRNA within yeast cells. (Long et al, 1995). The FISH method allows the detection of T-DNA in a spatial manner. Previously it was shown that using the FISH method it is possible to examine target mRNA distribution in the nucleus and the cytoplasm. (Long et al, 1995). Briefly, the methods prepare DNA fragments which are complementary to the target of interest. The DNA fragments were then tagged with digoxigenin-11-dUTP (DIG) via nick translation to create probes. The yeast cells were fixed with 4% paraformaldehyde to ensure the T-DNA remains in situ. The yeast cells wall and cell membrane were then digested so that the probe can enter the cell and hybridize with the target. The nonhybridized probe was then washed away before DIG was detected with anti-DIG antibodies conjugated with rhodomine. Previously our lab has developed a FISH-based T-DNA detection method to observe T-DNA trafficking in Nicotiana tabacum cell lines BY-2. (Chang, unpublished). 50 Based on this method the FISH based T-DNA detection has been extended to the yeast system as well, with a few modifications. 3.5.1 Percentage of yeast cells with T-DNA molecule at different cocultivation time points. The PCR based T-DNA detection showed the presence of more T-DNA in the Δlas17 as compared to the wild type. To confirm this further, the FISH-based detection of T-DNA is used to detect the presence of T-DNA in both the wild type and Δlas17. A time-course FISH based T-DNA detection was conducted both on the wild type and Δlas17 yeast cells co-cultivated with Agrobacterium. The co-cultivation period was 8, 16 and 24 hours respectively. Using the FISH-based method we are able to calculate the percentage of yeast cells containing T-DNA molecules at different co-cultivation time periods. The results showed that more Δlas17 yeast cells were found to contain the T-DNA compared to the wild type at all the given co-cultivation time periods. This result complies with the PCR based T-DNA detection method. 51 WT Δlas17 Co-cultivation Total Cell With T-DNA Total Cell With T-DNA Counted (%) Counted (%) 8 hours 98 7% 84 11% 16 hours 122 9% 79 17% 24 hours 87 14% 86 27% Period Table 3.2 Percentage of yeast cells with T-DNA molecules at different co-cultivation period. At 4 hours, 11% of Δlas17 contains T-DNA compared to 7% of wild type. At 16 hours, 17% of Δlas17 contains T-DNA compared to 9% wild type. After 24 hours of cocultivation, 27% of Δlas17 contains T-DNA compared to 14% of wild type. In short, TDNA exists in more Δlas17 cells and therefore contributes in higher concentration of TDNA in Δlas17 cell culture and higher AMT transformation efficiency in Δlas17 cells. 52 3.5.2 Average copies of T-DNA per yeast cells The analysis of the Average copies of T-DNA per yeast cells can help us understand the difference in AMT transformation efficiency between the wt and the Δlas17. So, in order to find out the average copies of T-DNA per yeast cell, the number of rhodomine signals was counted and then divided by the number of yeast cells containing T-DNA and the output was taken as the average copies of T-DNA in the yeast cells (Figure 3.5) 53 Figure 3.5 The T-DNA molecules inside the wild type and the Δlas17 cells under the microscope. Wild type cells co-cultivated with Agrobacterium for 16, 20 and 24 hours respectively (upper panel). Δlas17 cells co-cultivated with Agrobacterium for 16, 20 and 24 hrs respectively (lower panel). The nucleus was stained blue with DAPI and the TDNA was detected by DIG labeled probe that gives red rhodomine signal Co-cultivation Period WT Δlas17 16 hours 1.0 1.6 20 hours 1.2 1.8 24 hours 1.3 1.8 Table 0.3 Average Copies of T-DNA per Cell 54 As shown in the Table 3.3, Δlas17 has higher number of T-DNA when compared to the wild type at all the time points. The difference in the average copies of T-DNA per cell in both the strains is significant at all the time points. This indicates that Δlas17 accepted more copies of T-DNA than the wild type which is consistent with our previous result. This observation is also consistent with our PCR result where the accumulation of T-DNA was higher at all the time points in the Δlas17 as compared to the wild type. This significant difference in the amount of T-DNA may thus be contributed to the increase in the transformation efficiency in the Δlas17. These results are suggestive that the uptake of the T-DNA was at much higher rate in the Δlas17 when compared to the wild type and this may be due to an endocytosis-independent pathway. 55 CHAPTER 4 General Conclusion and Future Work In the current we have established that Las17 gene indeed plays an important role in the Agrobacterium-mediated transformation process. On an average, ∆las17 is about 8 times more susceptible to Agrobacterium mediated transformation when compared to wild type. From the PCR detection of the accumulation of T-DNA inside the yeast cells, it was found that there was a significant difference in the amount of T-DNA, which may thus have contributed to the increase in the transformation efficiency in the Δlas17. These results are suggestive that the uptake of the T-DNA was at much higher rate in the Δlas17 when compared to the wild type and this may be due to an endocytosisindependent pathway. Hence Las17 is a down-regulator of the AMT process. Also it has been established that the increase in the AMT efficiency in the Las17 mutant cells is not due to nuclear targeting process. One of the most important steps in the transformation process involves the import of T-DNA by the NLS sequences of VirD2. This Vir D2 protein also has a ligase activity and is directly involved in the integration of T-DNA into the host cell genome. So, the interaction of VirD2 with Las17 may unravel the mechanism lying behind the T-DNA trafficking. For the purpose, a pull-down assay of VirD2 by TAP-tagged proteins can be 56 conducted. It has been known thatLas17 interacts with the Arp2/3 complex and also actin related proteins. These genes could also be tested to find out their role in the AMT process and thereby the pathway important in the AMT process. 57 BIBILIOGRAPHY Anand A, Krichevsky A, Schornack S, Lahaye T, Tzifira T, Tang Y, Citovsky , Mysore KS (2007). Arabidopsis VIRE2 INTERACTING PROTEIN2 is required for Agrobacterium T-DNA integration in plants. The plant cell review: 1-14 Bartlett JG, Alves SC, Smedley M, Snape JW, Harwood WA (2008) High-throughput Agrobacterium-mediated barley transformation. Plant Methods 4:22. Bundock, P., den Dulk-Ras, A., Beijersbergen, A. & Hooykaas, P. J. (1995). Transkingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J. 14(13):3206-14. Cangelosi, G.A., Best, E.A., Martinetti, G., and Nester, E.W. (1991). Genetic analysis of Agrobacterium. Methods Enzymol. 204, 384-97. Chilton MD (1993) Agrobacterium gene transfer: progress on a "poor man's vector" for maize. Proc Natl Acad Sci USA. 90: 3119-3120. Chilton MD, Drummond MH, Merio DJ, Sciaky D, Montoya AL, Gordon MP, Nester EW., Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis, Cell. 1977 Jun; 11(2):263-71. Chee PP, Slightom JL (1995) Transformation of soybean (Glycine max) via Agrobacterium tumefaciens and analysis of transformed plants. Methods Mol Biol. 44:101-19. Cheng M, Fry JE, Pang S, Zhou H, Hironaka CM, Duncan DR, Conner TW, Wan Y. (1997) Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens. Plant Physiol. 115:971-980. Citovsky, V., Wong, M. L & Zambryski, P. (1989). Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA: implications for the T-DNA transfer process. Proc. Natl. Acad. Sci. USA. 86: 1193-1197. 58 Citovsky, V., Kozlovsky, S.V., Lacroix, B., Zaltsman, A., Dafny-Yelin, M., Vyas, S., Tovkach, A. and Tzfira, T. (2007), “ Biological systems of the host cell involved in Agrobacterium infection”, Cellular Microbiology, Vol 9(1), 9-20. Drees BL, et al. (2001) A protein interaction map for cell polarity development. J Cell Biol 154(3):549-71 De Groot, M. J., Bundock, P., Hooykaas, P. J. & Beijersbergen, A. G. (1998). Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16(9):839-42. Evangelista M, et al. (2000) A role for myosin-I in actin assembly through interactions with Vrp1p, Bee1p, and the Arp2/3 complex. J Cell Biol 148(2):353-62 Gelvin SB (2003). Agrobacterium-mediated plant transformation: the biology behind the “gene jockeying” tool. Microbiology and molecular biology reviews 67(1): 16-37 Hood, E. E., Gelvin, S. B., Melchers, L. S. & Hoekema, A. (1993). New Agrobacterium helper plasmids for gene transfer to plants. Transgen. Res. 2, 208-218. Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the TDNA. Plant J. 6:271-282. Kado, C.I. (2000). The role of the T-pilus in horizontal gene transfer and tumorigenesis. Curr. Opin. Microbiol. 3: 643-648. Kawai S, Pham TA, Nguyen HT, Nankai H, Utsumi T, Fukuda Y, Murata K (2004) Molecular insights on DNA delivery into Saccharomyces cerevisiae. Biochem Biophy Res Comm 317L 100-107 Kunik, T., Tzfira, T., Kapulnik, Y., Gafni, Y., Dingwall, C. & Citovsky, V. (2001). Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. USA. 98(4):1871-6. 59 Lacroix, B., Tzfira, T. Vainstein, A. & Citovsky, V. (2006). A case of promiscuity: Agrobacterium’s endless hunt for new partners. Trends in Genetics. 22(1): 29-37. Lacroix B, Li J, Tzfira T and Citovsky V (2006) Will you let me use your nucleus? How Agrobacterium gets its T-DNA expressed in the host plant cell. Can J Physiol Pharmacol 84: 333-345 Lamppa G, Nagy F, Chua NH (1895) Light-regulated and organ-specific expression of a wheat Cab gene in transgenic tobacco. Nature 1985 316:750-752. Li R (1997) Bee1, a yeast protein with homology to Wiscott-Aldrich syndrome protein, is critical for the assembly of cortical actin cytoskeleton. J Cell Biol 136(3):649-58 Lechler T, et al. (2000) Direct involvement of yeast type I myosins in Cdc42-dependent actin polymerization. J Cell Biol 148(2):363-73 Lechler T, et al. (2001) A two-tiered mechanism by which Cdc42 controls the localization and activation of an Arp2/3-activating motor complex in yeast. J Cell Biol 155(2):261-70 Lechler T and Li R (1997) In vitro reconstitution of cortical actin assembly sites in budding yeast. J Cell Biol 138(1):95-103 Long RM, Elliott DJ, Stutz F, Rosbash M, Singer RH (1995) Spatial consequences of defective processing of specific yeast mRNAs revealed by fluorescent in situ hybridization. RNA 1:1787-1794 Madania A, et al. (1999) The Saccharomyces cerevisiae homologue of human WiskottAldrich syndrome protein Las17p interacts with the Arp2/3 complex. Mol Biol Cell 10(10):3521-38 Mc Cullen CA and Binns AN (2006) Agrobacterium tumefaciens and plant cell interactions and activities required for interkingdom macromolecular transfer. Annu Rev Cell Dev Biol 22:101-127 60 Michielse, C. B., Hooykaas, P. J., van den Hondel, C. A. & Ram, A. F (2005). Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48(1):1-17. Moore LW, Chilton WS, Canfield ML. 1997. Diversity of Opines and OpineCatabolizing Bacteria Isolated from Naturally Occurring Crown Gall Tumors. App. Environ. Microbiol. 63:201-207. Naqvi SN, et al. (1998) The WASp homologue Las17p functions with the WIP homologue End5p/verprolin and is essential for endocytosis in yeast. Curr Biol 8(17):959-62 Piers, K. L., Heath, J. D., Liang, X., Stephens, K. M. & Nester, E. W. (1996). Agrobacterium tumefaciens-mediated transformation of yeast. Proc. Natl. Acad. Sci. USA. 93(4):1613-8. Relic B, Andjelkovic M, Rossi L, Nagamine Y, and Hohn B (1998) Interaction of DNA modifying proteins VirD1 and VirD2 of Agrobacterium tumefaciens: analysis by subcellular localization in mammalian cells. Proc. Natl. Acad. Sci. USA. 95: 9105-9110. Roberts, R.L., Metz, M., Monks, D.E., Mullaney, M.L., Hall, T. & Nester, E.W. (2003). Purine synthesis and increased Agrobacterium tumefaciens transformation of yeast and plants. Proc. Natl. Acad. Sci. USA. 100(11):6634-9. Rodal AA, et al. (2003) Negative regulation of yeast WASp by two SH3 domaincontaining proteins. Curr Biol 13(12):1000-8 Sambrook JF, Fritsch EF and Maniates T (1989) Molecular Cloning: A Laboratory Manual Cold Spring Harbor, New York Sambrook JF and Russell T (2001) Molecular Cloning: A Laboratory Manual (3rd Edition) Cold Spring Harbor, New York SGD Project. “Sacchromyces genome database”. http://www.yeastgenome.org/ 61 Sheng, J., and Citovsky, V. (1996) Agrobacterium–plant cell interaction: have virulence proteins – will travel. Plant Cell 8: 1699–1710. Smith EF, Townsend CO (1907). A plant tumour of bacterial origin. Science 25: 671-673 Tinland B, Koukolikova-Nicola Z, Hall MN, Hohn B (1992) The T-DNA-linked VirD2 protein contains two distinct functional nuclear localization signals. Proc Natl Acad Sci USA. 89: 7422-7446 Tohe A and Oguchi T (1998) Isolation and characterization of the yeast las21 mutants, which are sensitive to a local anestheticum, tetracaine. Genes Genet Syst 73(6):365-75 Tong AH, et al. (2002) A combined experimental and computational strategy to define protein interaction networks for peptide recognition modules. Science 295(5553):321-4 Tzfira T, Li JX, Lacroix B, Citovsky V (2004). Agrobacterium T-DNA integration : molecules and models. Trends in Genetics 20(8): 375-383 Tzfira T and V Citovsky (2002). Partners-in-infection: host proteins involved in the transformation of plant cells by Agrobacterium. Trends in Cell Biology 12(3): 121-129 Vaduva G, et al. (1997) Actin-binding verprolin is a polarity development protein required for the morphogenesis and function of the yeast actin cytoskeleton. J Cell Biol 139(7):1821-33 Van Attikum, H., Bundock, P. & Hooykaas, P. J. (2001). Non-homologous end-joining proteins are required for Agrobacterium T-DNA integration. EMBO J. 20:6550-6558. Van Attikum, H. & Hooykaas, P. J. (2003). Genetic requirements for the targeted integratin of Agrobacterium T-DNA in Saccharomyces cerevisiae. Nucleic Acid Res. 31: 826-832. Veluthambi, K., Ream, W. & Gelvin, S. B. (1988). Virulence genes, borders, and overdrive generate single-stranded T-DNA molecules from the A6 Ti plasmid of Agrobacterium tumefaciens. J. Bacteriol. 170: 1523-1532. 62 Yusibov VM, Steck TR, Gupta V, and Gelvin SB (1994) Association of single-stranded transferred DNA from Agrobacterium tumefaciens with tobacco cells. Proc Natl Acad Sci USA 91: 2994–2998. Winter D, et al. (1999) Activation of the yeast Arp2/3 complex by Bee1p, a WASPfamily protein. Curr Biol 9(9):501-4 63 [...]... (Cheng et al, 1997) 1.3 The Agrobacterium-mediated transformation (AMT) process in plants The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes and the chv genes As described earlier the TDNA is a discrete segment of DNA located on the Ti plasmid of Agrobacterium... border repeat to stimulate single stranded T- DNA production The VirD2 remains covalently attached to the T- strand at the 5’ end (Toro et al., 1988; van Haaren et al., 1987; Veluthambi et al., 1988) VirD2 together with VirE2, which coats the length of the single stranded DNA, forms the T- complex The T- complex is transferred from the bacterial cell to the host cytoplasm through the type IV secretion mechanism... into the host-cell nucleus (7) Once inside the nucleus, the T- DNA is recruited to the point of integration (8), stripped of its escorting proteins (9) and integrated into the host genome (10) 11 Figure 1.3 Schematic representation of the A tumefaciens T- DNA transfer system in yeast (Michielse et al, 2005) 12 1.5 Background of Las17 gene Las17 is an activator of the Arp2/3 protein complex that nucleates... possibly acting as an adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the host genome (Citovsky, 2007) 1.4 Agrobacterium-mediated transformation of Saccharomyces cerevisiae The natural ability of Agrobacterium in transferring its DNA into plants has made it an invaluable... between AMT of plant and yeast cells lies in the T- DNA transfer and integration process inside the host cells In yeast, T- DNA can be integrated into the yeast genome via homologous recombination mechanisms if the T- DNA contained certain sequence homology to the yeast genome (Bundock et al 1995) In addition, if a yeast replication origin sequence such as the 2µ replication origin was inserted within the. .. activation of the vir gene region (3), a mobile copy of the T- DNA is generated by the VirD1/D2 protein complex (4) and delivered as a VirD2 DNA complex (immature T- complex), together with several other Vir proteins, into the host-cell cytoplasm (5) Following the association of VirE2 with the T- strand, the mature T- complex forms, travels through the host-cell cytoplasm (6) and is actively imported into... yeast cells using replicative vectors occurs more efficiently than integrative vectors So in the current experiment, the replicative vector pHT101 (Tu, result not published) was utilized in the Agrobacterium -yeast gene transfer assay In our experiment, AMT was accomplished by the transfer of the T- region of the pHT101 plasmid into the Leu2- BY4741 yeast strain As the 2µ replication of origin is located... known as T- pilin) (Kado, 2000) On 7 the other hand, VirD4 mediates the interaction between VirB complex and T- DNA (Christie, 1997) In the cytoplasm of the recipient cell, the T- DNA complex becomes coated with VirE2 proteins, which are exported through the T4 SS independently from the T- DNA complex VirE2 is important as a single-stranded DNA- binding protein that coats and protects T- strand in host from... and maintains the unfolded state of T- strand to assist T- DNA transport through the nuclear pore (Citovsky et al., 1989) Nuclear localization signals, or NLS, located on the VirE2 and VirD2 are recognized by the importin alpha protein, which then associates with importin beta and the nuclear pore complex to transfer the T- DNA into the nucleus VIP1 also appears to be an important protein in the process,... appears that the products of the first three genes are involved in the actual synthesis of the cellulose fibrils These fibrils also anchor the bacteria to each other, helping to form a microcolony After the production of cellulose fibrils a Ca2+ dependent outer membrane protein called rhicadhesin is produced, which also aids in sticking the bacteria to the cell wall followed by the formation of the T- pilus ... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the. .. The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes... course analysis of T- DNA accumulation inside the wild type and las17 yeast cells 46 3.5 Detection of individual T- DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T- DNA