Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells
Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc
... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and...
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGG...
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx
... Thus, we present the nucleotide sequence, as well as a systematic structural and functional analysis of the 5¢ flanking region of the Bsep gene The 5¢ deletional analysis of the Bsep promoter revealed ... (Fig 6) Interestingly CDCA reduced the activity of the mutant m-126 Luc even below that of the wild-type p-126 Luc Analysis of the binding affinity...
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx
... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata W...
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx
... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid l...
báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc
... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern...
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation
... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacter...
Molecular analysis of genes mediating t DNA trafficking inside yeast cells
... Agrobacterium is to successfully and stably transfect of plant tissue post TDNA translocation it is important that, the T- DNA be protected from nuclease activity, the T- DNA be transported to the nucleus ... attachment motif similar to that of vitronectin (Swart et al 1994) This glycoprotein is thought to be involved in the first direct attachment of the bacteria to plant cells...
Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)
... attainable size, big and long fins of the RG1 and the intense colouration of the MG One of the shortfalls of the hybrid is the large variation of phenotypes produced in their offsprings which is common ... particularly the subfamily Osteoglossinae We hope that our work will enhance the understanding of the evolution of the breeding biology of teleost, a...
Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish
... mutants, trunk notochords are present. This shows that spt mutation can suppress the 35 Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh mutation, suggesting that in the midline, flh is involved in promoting ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating TβR...
Molecular analysis of the p14 ARF hdm2 p53 regulatory pathway in breast carcinoma
... representation of the cell cycle, showing the role of p53 at the G1/S checkpoint Figure 10 Schematic representation of the p1 4ARF- hdm2- p53 regulatory pathway The binding of p53 to hdm2 results in inactivation ... 1.5.2 The role of p53 at the G1/S checkpoint of the cell cycle 22 1.5.3 Inactivation of p53 23 1.5.4 Significance of p53 in...
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells
... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic compone...
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGG...