... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and ... International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located in Caldas da Rainha Results and comparisons By comparing ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators...
Ngày tải lên: 05/09/2013, 14:59
... 18 and 19, it is found that, for H /D ratio 1.80, the maximum Cp obtained is 0.59 at a TSR of 0.888 and maximum Ct obtained is 0.066 at a TSR of 0.888 and the standard deviations of Cp and Ct are ... found that, for H /D ratio 1.92, the maximum Cp obtained is 0.042 at a TSR of 0.747 and maximum Ct obtained is 0.055 at a TSR of 0.747 and the standard deviations of Cp and Ct are 0.38% and 0.53% ... found that for H /D ratio 2.10, the maximum Cp obtained is 0.051 at a TSR of 0.752 and maximum Ct obtained is 0.068 at a TSR of 0.752 and the standard deviations of Cp and Ct are 0.27% and 0.25%...
Ngày tải lên: 05/09/2013, 15:28
Reliability analysis of a power system based on the multi state system theory
... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all ... bound of the system reliability, the performance of each state is defined as the minimum capacity of each interval, that is: g1 = 5200 , g = 5550 , g3 = 5700 , g = 5850 , V RELIABILITY ANALYSIS OF ... Based on the operators defined in (7) and (8), the universal generating function of the branches can be obtained, and then the universal generating function of the power system can be computed...
Ngày tải lên: 03/01/2014, 19:38
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... sequence of conomarphin The signal peptide is shadowed and the mature peptide is underlined The polyA signal AATAAA in the 3¢-UTR is also underlined The cDNA of conomarphin has been deposited in ... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D- serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... from these data and used as input for cyana (v 2.1) Six u dihedral angles were determined on the basis of the JNHa coupling constants derived by analysis of a high-resolution one-dimensional proton...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) ... Additionally, 400 lL of p26 purified from Artemia cysts [57], and molecular mass markers of 29 kDa (carbonic anhydrase), 66 kDa (bovine serum albumin), 150 kDa (alcohol dehydrogenase), 200 kDa...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding pocket Mutation sites are ... a Pilatus detector Later, a 1.9 A resolution dataset was collected at beamline ID14-1, ESRF (Grenoble, France), with an ADSC Q210 CCD detector Data were ˚ collected at 100 K and 0.9334 A Data ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... SH1000 (D, E) After several washings, lg of rabbit polyclonal antibody against S aureus was added Bound antibody was detected by incubation with secondary antibody [HRP-conjugated goat anti-(rabbit ... filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated at least twice, with duplicate or triplicate measurements ... incubated with 10 lg of Fn and, after washing, bound Fn was visualized by incubation with rabbit polyclonal antibody against Fn followed by addition of peroxidase-conjugated goat anti-(rabbit...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt
... isolated P putida strain An initial hydrolysis formed 3-ketopropanoate, which was then partly decarboxylated to acetaldehyde The latter was dehydrogenated to acetate, whereas the 3-ketopropanoate ... 3-ketopropanoate were identified by the addition of standard solutions Larger amounts of acetate and 3-hydroxypropanoate were detected directly from the spectra Unidentified minor by-products are indicated ... carbon atoms was detected, we assumed that pyruvate was formed by decarboxylation of 2-ketobutandioate, the product of a triple-bond hydrolysis of 2-butynedioate An initial decarboxylation was...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx
... and all plant tissue above ground was used for the analyses (A) Total RNA was extracted and 20 lg RNA was loaded in each lane and blotted as indicated in Experimental procedures To prove equal ... were determined according to [56] using BSA as a protein standard The DNA and amino acid sequence analyses and prediction of the molecular masses were performed with the programs mapdraw and protean ... such as amino acid oxidases, transaminases, and racemases (epimerases) For example, in pea seedlings the occurrence of d- amino acid aminotransferase was demonstrated [36] For a number of other amino...
Ngày tải lên: 16/03/2014, 18:20
Security Analysis of a Cryptographically-Enabled RFID Device ppt
... wrote modulation and demodulation software routines to decode and produce the analog AM signals transmitted by the TI reader, as well as FM-FSK analog signals transmitted by DST transponders Using ... purchased a TI Series 2000 - LF RFID Evaluation Kit; this kit contained a reader and antenna, as well as a variety of non-DST RFID devices We were able to separately purchase small quantities of DST ... cryptographically-enabled keychain tags accepted at 10,000 locations worldwide [2] A DST consists of a small microchip and antenna coil encapsulated in a plastic or glass capsule It is a passive device,...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and cloning ... former (data not shown) Further analysis of the ORF showed that it encodes a putative polypeptide of 533 amino acids, with a predicted molecular mass of 57 kDa and a pI of 8.34 A database search ... number AAA59189) Amino acids are designated by single-letter codes Dashes (–) indicate gaps inserted for improved alignment Amino acid positions are indicated on the right Boxshade is used to highlight...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx
... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... former candidate leave a candidate (O ザッツファイン) leave a candidate ○○研の (R △△) さんが leave a candidate (A イーユー;EU) leave the candidate (K い (F んー) ずみ; 泉) leave the latter candidate timated by using ... Unknown Word Problem: a Morphological Analysis of Japanese Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002...
Ngày tải lên: 17/03/2014, 06:20
14 point web copy analysis of a winning site pptx
... can see I use a ‘prehead’ (this is the small headline above the main headline), a headline and a subhead All of these are powerful enough to be the main headline Your headline’s job is immediately ... of Cash Into Your Bank Account TODAY!" Advanced Copywriting Seminar-in -a- box “Only 115 people were permitted to attend Dan Kennedy's recent, closed door, 2-day Seminar where he revealed ALL of ... prospect’s attention and stop them dead in their tracks Headlines that have worked before can usually be reworked over and over Human appeals are immutable These next headlines I have compiled for...
Ngày tải lên: 19/03/2014, 20:20
Experimental Security Analysis of a Modern Automobile docx
... car, which are connected to the car’s CAN buses, use a hardcoded challenge and a hardcoded response common to all similar units, seemingly in violation of the standard (specifically, the standard ... denial -of- service attacks In addition to simple packet flooding attacks, CAN’s priority-based arbitration scheme allows a node to assert a “dominant” state on the bus indefinitely and cause all other CAN nodes ... and instead supports a publish-and-subscribe communications model The CAN ID header is used to indicate the packet type, and each packet is both physically and logically broadcast to all nodes,...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area of the substrate peaks For the identification of ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W of ... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... described [14] In the folding reaction containing both CCT and Cof A, an additional band is generated (middle arrow) A similar band (lower arrow) corresponding to b5/Cof A complex [15] is generated ... construct described in the Materials and methods section and analysed by SDS/ Fig Immunodetection of CCT a- subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 ... incubated at 30 °C for 90 and the products analyzed on 4.5% nondenaturing PAGE Following staining in Coomassie blue and destaining, the gels were soaked in Amplify solution (Amersham), dried and autoradiographed...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: Mutational analysis of a type II thioesterase associated with nonribosomal peptide synthesis pdf
... TCG GAA AGA AGG C C TTT AAC GGG CTT GCT GAT AAA AAA TGC ATA CGA GAT GCG G C CGC ATC TCG TAT GCA TTT TTT ATC AGC AAG CCC GTT AAA G C TTT AAC GGG CTT GAT GCT AAA AAA TGC ATA CGA GAT GCG G C CGC ATC ... ATC TCG TAT GCA TTT TTT AGC ATC AAG CCC GTT AAA G C TTT AAC GGG CTT GCT GCT AAA AAA TGC ATA CGA GAT GCG G C CGC ATC TCG TAT GCA TTT TTT AGC AGC AAG CCC GTT AAA G CAA TTT GAC GGC GGG CTC ATG TTC ... grown at 22 °C and induced with isopropyl thio-b -D- galactoside (0.2 mM) After an additional h incubation at 22 °C, the cells were centrifuged at °C, and D1 6 3A was then purified, dialyzed against assay...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... were developed with H2O2 and diaminobenzidine (B) A rat liver nuclear fraction was treated with DNase–RNase and the solubilized fraction (chromatin fraction, B5) was separated by centrifugation ... intervals) His6-ISP36 purified as above (about mg) was dialyzed against 0.9% (w ⁄ v) NaCl, and then precipitated by addition of volumes of cold acetone The precipitate was dissolved in 0.3 m triethanolamine ... human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors...
Ngày tải lên: 30/03/2014, 20:20
báo cáo sinh học:" Analysis of a survey on young doctors'''' willingness to work in rural Hungary pptx
... effective human resources for health policies, there will be a permanent lack of doctors in small villages and towns, socially-disadvantaged areas and places far away from medical schools and major towns ... conceived of the study, participated in the design of the study, carried out the study and performed the data and focus group analysis EE conceived the study, participated in the design of the study, ... are located in cities and that medical students become accustomed to urban life during their six years at university Additionally, the practical training of students and residents almost always...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: "Three-dimensional kinematic motion analysis of a daily activity drinking from a glass: a pilot study" pot
... were replaced and subject was tested a second time Data analysis and raw data handling After the recording process, each of the markers were identified in Qualisys Track Manager and reviewed to ensure ... Windows-based data acquisition software (Qualisys Track Manager) This system includes an advanced optoelectronic camera system that produces clean and accurate 3D data The measurement accuracy is ... were calculated as a final measurement value for each subject The data was transferred to the MATLAB software for further analysis For every recording we calculated and plotted coordinate data showing...
Ngày tải lên: 19/06/2014, 10:20