monte carlo analysis of a pressure senso

... Barrage, Naga-Hammadi Barrage, Assiut Barrage, Delta Barrages, Zefta Barrage, and finally near to the Mediterranean; Edifna and Damitta Barrages They divide the River Nile from Aswan to Mediterranean ... downstream Naga-Hammadi Barrage New Naga-Hammadi Barrage Background There are several hydraulic structures controlling flow along the river from Aswan to Delta Barrage These are Old Aswan Dam, Esna Barrage, ... flows: A Monte Carlo analysis Ahmed M .A Sattar a b a, * , Yasser M Raslan b Irrigation and Hydraulics Department, Faculty of Engineering, Cairo University, Giza, Egypt Nile Research Institute, National

Ngày tải lên: 13/01/2020, 14:12

... simulated the cycling cooling water, heat transfer and pressure in the condenser The calculation program of transient variation characteristics was established in Fortran language The pump’s parameter, ... equal to the total flux of the cooling water The sectional area of this equivalent pipe is equal to the total sectional area of all cooling lines The water hammer wave’s propagation speed and ... the heat transfer rate which was calculated from the formula by partial dividing the heat transfer rate calculated from overall: Fig Calculation grid of cooling water's flow and heat transfer

Ngày tải lên: 10/03/2021, 15:55

... economic and technical analyses of the nuclear fuel cycle, nuclear law and liability, and public information The NEA Data Bank provides nuclear data and computer program services for participating ... HOWFAR and HOWNEAR: Geometry Modeling for Monte Carlo Particle Transport, Report PIRS-0341 (National Research Council of Canada, Ottawa) Bielajew A. F and D.W.O Rogers (1987), PRESTA: The parameter ... Monte Carlo simulation of photon transport, Radiat Phys Chem 44, 531552 Baro J., J Sempau, J.M Fernandez-Varea and F Salvat (1994b), Simplified Monte Carlo simulation of elastic electron scattering

Ngày tải lên: 21/12/2016, 10:38

... left the measurement area and markers were removed. After a 5–10 minutes break the markers were replaced and subject was tested a second time. Data analysis and raw data handling After the recording ... flexion and recalculated the values for elbow angle into an ana- tomical angle rather the technical/mathematical angle values. One limitation of this study, for example, is that we have not analyzed ... correlation) between the shoulder and elbow joint excursions for reaching phase from rawdata in Matlab software. Statistical analysis Statistical analyses were performed with SPSS (Statistical Packages

Ngày tải lên: 19/06/2014, 10:20

... Rodriguez-Arenas MA, Garcia de la Hera M, Iribarren JA, Moreno S, Viciana P, Pena A, Gomez Sirvent JL, Saumoy M, Lacruz J, Padilla S, Oteo JA, Asencio R, del Amo J: Progression to AIDS and death and ... selection of the study population as by this date, HAART was widely available, and we wished to avoid the potential bias of availability of HAART on losses to follow up. These patients were catego ... those on HAART and 48.5% not on HAART) compared with 31.9% of Transfers (p < 0.001). Factors associated with LFU among those receiving or not receiving HAART Overall, in a multivariate analysis,

Ngày tải lên: 20/06/2014, 08:20

... positive and negative changes in quality of life ratings as well as apparent stability of ratings are each related to several distinct patterns of change in quality of life appraisal, even after controlling ... religious participation and affiliation, disease and treatment history, and co-morbidities Analysis Plan Our analysis included examination of patient characteristics and quality of life, thematic content ... predominately male (68%) with mean age of 66 years old (standard deviation = 10 years) The majority of patients were Caucasian, with two African American patients and one Hispanic patient The educational

Ngày tải lên: 20/06/2014, 15:20

... > 0, and u, v represent a measure of a pioneer and a climax species, respectively f(z), the growth rate of the pioneer population, is generally assumed to be smoothly deceasing, and has a unique ... Liu and Wei Advances in Difference Equations 2011, 2011:52 http://www.advancesindifferenceequations.com/content/2011/1/52 RESEARCH Open Access Bifurcation analysis of a diffusive model of pioneer ... http://www.advancesindifferenceequations.com/content/2011/1/52 Page of 11 be the inner dot and a = b∗ = 1, b= iω + d1 μ1 − a1 1 , a1 2 a? ?? = −iω + d2 μ1 − a2 2 , a1 2 M= πω ia12 Express the partial derivatives of f(u, v) and g(u, v) at (u, v) = (0,

Ngày tải lên: 20/06/2014, 22:20

... vitro and in vivo characterization of panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 ... to have decreased on the second day while the tumor uptake Table In vitro analysis of panitumumab F(ab’)2 conjugated with CHX -A" -DTPA Chelate:mAb ratio (molar excess) Analysis Panitumumab F(ab’)2 ... Figure SDS-PAGE analysis of panitumumab F(ab’)2 The panitumumab F(ab’)2 was evaluated by SDS-PAGE before (a) and after (b) the final step of buffer exchange and concentration using a Centriprep

Ngày tải lên: 21/06/2014, 02:20

... time to maturity w is the natural death rate of the immature prey population d1 is the natural death rate of the mature prey population d2 is the natural death rate of the predator population The ... Pitman Monographs and Surveys in Pure and Applied Mathematics, Longman Scientific & Technical, Harlow, UK, 1993 J Jiao, X Yang, S Cai, and L Chen, “Dynamical analysis of a delayed predator-prey model ... constant r We also assume that the death rate of mature population is of a logistic nature, that is, proportional to the square of the population with proportionality constant η2 In this paper, we

Ngày tải lên: 21/06/2014, 11:20

... cited. Dynamical analysis of a biological resource management model with impulsive releasing and harvesting Jianjun Jiao ∗1 , Lansun Chen 2 and Shaohong Cai 1 1 School of Mathematics and Statistics, ... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Dynamical analysis of a biological resource management ... per-capita rate of predation of the predator, d > 0 is the death rate of predator, c > 0 denotes the product of the per-capita rate of predation and the rate of conversing prey into predator.

Ngày tải lên: 21/06/2014, 17:20

... incorporated on the system MICROARRAY DATA PROCESSING ALGORITHM Statistical analysis of microarray data can essentially process massive amounts of data and can also adjust for various sources of variability ... SYSTEM-ON-CHIP ARCHITECTURE FOR MICROARRAY DATA ANALYSIS We describe and evaluate in detail the two alternative architectures of the single-core and multicore approach Also, the details for the data analysis ... hundreds of spots) up to large multithousands of spots microarrays producing vast amount of data and evaluate the final results for molecular diagnostics examinations Targeted application areas are

Ngày tải lên: 21/06/2014, 22:20

... Also, a quasistationary channel is assumed, such that it remains time-invariant for the transmission of a full UWB packet Calculations are based upon the CM1 channel scenario of the 802.15. 3a ... it was determined that an MUI variance within 5% of the final value could be obtained after approximately 100 iterations The Nl , Nw , and Nov path alignment parameter variations for both ISI and ... is defined as a statistically independent zero mean Gaussian random variable The ISI and MUI terms may be brought under the standard Gaussian approximation provided that the number of paths within

Ngày tải lên: 22/06/2014, 19:20

... the mean angle of arrival. Throughout this paper, we consider that the array geom- etry, which is the parameter of the antenna aperture gain, is a uniform linear array (ULA) of M identical sensors. ... of an improved AA, in which RL- STT is incorporated to effectively make better an estima- tion of covariance matrices at a beamformer-RAKE receiver through the analysis of the scenario of a direct ... θ (k) l ,andτ (k) l are phase shift, mean angle of arrival (AOA), a nd the propagation delay, respectively, of the lth faded path of the kth user. Assuming Rayleigh fad- ing, the probability density

Ngày tải lên: 23/06/2014, 00:20

... Simpson- Angus Scale (SAS) [25], Barnes Akathisia Rating Scale (BARS) [2 6], and Abnormal Involuntary Movement Scale (AIMS) [27]. Analysis set In this post hoc analysis, all efficacy and safety analyses ... Positive and Negative Syndrome Scale (PANSS), CGI-S, Personal and Social Performance (PSP), and adverse events (AEs). Analysis of covariance (ANCOVA) and last-observation-carried-forward (LOCF) ... for categorical variables. Between-treatment-group diff erences in continu ous variables were evaluated using an analysis of covariance (ANCOVA) model, with treat- ment and country as factors and

Ngày tải lên: 09/08/2014, 01:21

... Lauvergne et al, 1973; Martin, 1975; Basu and Ghai, 1980) and as a check on management practices (Nadkarni et al, 1983). A similar analysis was used by Ahmad et al ... (ad- ditional number of years an animal of a particular age is expected to remain in the herd, Ex); birth rate (probability of a cow of a particular age producing a ... to calve in any... 4-17 Nadkarni UG, Arya SN, Abraham J (1983) Age-specific mortality rates in bovines in ICD (Amritsar) and non-ICD (Ferozepur) areas Indian J Anim Sci 53, 712-714 Neumann AL,

Ngày tải lên: 09/08/2014, 18:21

... the majority of breast and head and neck cancers For each of the nine combinations of electron beam energies and applicator sizes (we designate each combination as a “beam” and denote each beam ... proprietary Monte Carlo based system, NXEGS, provides an automated alternative to traditional commissioning NXEGS is a suite of Monte Carlo applications for radiotherapy, which are based on the EGS4 standard ... Accurate characterization of Monte Carlo calculated electron beams for radiotherapy Med Phys 1996; 24:401-416 Ma C-M and Jiang SB Monte Carlo modeling of electron beams from medical accelerators Phys...

Ngày tải lên: 03/11/2012, 10:05

... economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis of production costs sensitivity analysis was done ... 5,766,604 Table 15 Comparison in percentage values of calculated parameters in the scenarios Item ICC AARaverage Operating costaverage O&Maverage Debtaverage Taxaverage LRC Dv Source: own elaboration ... analysis (optional): In this final step, we analyze uncertainty of financial estimates several parameters that can affect the financial viability of the project Can be performed sensitivity analysis...

Ngày tải lên: 05/09/2013, 14:59

... that, for H/D ratio 1.92, the maximum Cp obtained is 0.042 at a TSR of 0.747 and maximum Ct obtained is 0.055 at a TSR of 0.747 and the standard deviations of Cp and Ct are 0.38% and 0.53% (a) ... TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% and that of computational Ct from experimental ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...

Ngày tải lên: 05/09/2013, 15:28

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... standards (Amersham-Pharmacia Biotech or BioÁRad) DNA fragments of appropriate length were ligated into the T /A vector, pCRII (Invitrogen, San Diego, CA, USA), using T4 DNA ligase overnight at...

Ngày tải lên: 22/02/2014, 04:20

... demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure of ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... Karplus PA (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography Nat Struct Biol 4, 269–275 Richter Dahlfors AA & Kurland CG (1990) Novel mutants of elongation...

Ngày tải lên: 06/03/2014, 22:21