414 algebraic analysis of a logic circuit with nand and nor gates

Modelling and analysis of a new integrated radiofrequency ablation and division device

Modelling and analysis of a new integrated radiofrequency ablation and division device

... Literature Review   (ethanol or alcohol injection), extreme cold-based (cryoablation), and extreme heatbased (radiofrequency ablation, microwave ablation and laser ablation) ablations These treatments ... constant Q material model, is more capable of modelling organic materials accurately [73] (a) (b) Figure 2.15: Liver with 327/2616 Tetrahedra, snapshots of creep (a) with a constant Q material, and ... experimental data unavailable in previous approaches and this advantage can lead to the development of an effective VR laparoscopic surgery trainer Figure 2.5: Interactive simulation of a liver...

Ngày tải lên: 16/10/2015, 15:36

112 294 0
Báo cáo hóa học: " Throughput Analysis of Fading Sensor Networks with Regular and Random Topologies" docx

Báo cáo hóa học: " Throughput Analysis of Fading Sensor Networks with Regular and Random Topologies" docx

... The traffic distribution in a sensor networks is usually spatially and temporally bursty, that is, busy periods alternate temporally and busy areas alternate spatially with periods and areas with ... traffic It may therefore be impractical to employ reservation-based MAC schemes such as TDMA and FDMA that require a substantial amount of coordination traffic and cannot be implemented efficiently and ... interference-limited During such a burst of traffic, we assume that the parameters p, pq , and pt remain constant An important example of a busy area is certainly the critical area around the base station or fusion...

Ngày tải lên: 23/06/2014, 00:20

11 295 0
14 point web copy analysis of a winning site pptx

14 point web copy analysis of a winning site pptx

... can see I use a ‘prehead’ (this is the small headline above the main headline), a headline and a subhead All of these are powerful enough to be the main headline Your headline’s job is immediately ... prospect’s attention and stop them dead in their tracks Headlines that have worked before can usually be reworked over and over Human appeals are immutable These next headlines I have compiled ... 'Peel Away' Outrageously Profitable Websites, and Learn Their Inside Secrets You Can Use to Turn YOURS Into a Profit-Pushing Powerhouse That Rams Streams of Cash Into Your Bank Account TODAY!"...

Ngày tải lên: 19/03/2014, 20:20

24 418 0
Exergoeconomic analysis of a combined water and power plant 4

Exergoeconomic analysis of a combined water and power plant 4

... resembles with the study made by Dessouky et al (1999), where performance of plastic heat exchanger made of PTFE was evaluated An increase of to times more heat transfer area than metal exchanger was ... heat transfer area would have a declining trend as water production rate and specific heat transfer area share an inverse relationship As seen from Figures 5.45, the specific heat transfer area ... temperature range Alternatively, as the difference between the feed and saturation temperature decreases, the performance ratio increases gradually The reason may be because as the feed temperature...

Ngày tải lên: 14/09/2015, 08:36

110 284 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis of production costs sensitivity analysis was done ... energy The main values calculated for this simulation and sensitivity analysis are summarized in Tables 12, 13, 14 and 15, in absolute and percentage values of case study scenarios analyzed Table 13 ... 5,766,604 Table 15 Comparison in percentage values of calculated parameters in the scenarios Item ICC AARaverage Operating costaverage O&Maverage Debtaverage Taxaverage LRC Dv Source: own elaboration...

Ngày tải lên: 05/09/2013, 14:59

14 416 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... that, for H/D ratio 1.92, the maximum Cp obtained is 0.042 at a TSR of 0.747 and maximum Ct obtained is 0.055 at a TSR of 0.747 and the standard deviations of Cp and Ct are 0.38% and 0.53% (a) ... the maximum Cp obtained is 0.097 at a TSR of 0.837 and maximum Ct obtained is 0.125 at a TSR of 0.837 and the standard deviations of Cp and Ct are 2.68% and 3.66% respectively From Figures 16 and ... found that, for H/D ratio 1.72, the maximum Cp obtained is 0.064 at a TSR of 0.792 and maximum Ct obtained is 0.081 at a TSR of 0.792 and the standard deviations of Cp and Ct are 1.29% and 1.59%...

Ngày tải lên: 05/09/2013, 15:28

16 364 0
A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness

A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness

... States of America, Australia, Canada, New Zealand and Ireland In fact, as the statistics show, information about the United Kingdom and the United States of America has the most coverage in the ... illustrations) are also employed for analysis when and if appropriate The study just makes an initial attempt to conduct a small-scale cross-cultural analysis of the textbook and is not aimed at evaluating ... language knowledge The teaching of Language Focus consists of two parts: Pronunciation and Grammar-Vocabulary Material used in teaching Pronunciation, Grammar -Vocabulary is based on passages...

Ngày tải lên: 07/09/2013, 12:58

51 1,4K 16
A discourse analysis of economic export contracts in english and vietnamese

A discourse analysis of economic export contracts in english and vietnamese

... and result of the study A fruitful data analysis, at first, asks for a good management of qualitative and quantiative data because there is a fact that data not only prove 29 theories, they are ... sampling and population, data collection and data analysis Chapter 4, Findings and Discussion, focuses on analysis and discussion about the organisational, lexical and syntactic features of economic ... are able to generate and supplyment theory as well Below are the main procedures for data analysis: - The data analysis was based on the quantitative and the qualitative data to point out the main...

Ngày tải lên: 26/11/2013, 13:26

101 798 6
A discourse analysis of collective labour agreements in english and vietnamese

A discourse analysis of collective labour agreements in english and vietnamese

... in VCAs were chosen 3.4 DATA COLLECTION 3.5 DATA ANALYSIS One hundred official collective agreements are collected for - Analyzing data: ECAs and VCAs are analyzed in terms of layout, lexical choices, ... data analysis: For the layout features, a collective agreement can be generally 10 CHAPTER FINDINGS AND DISCUSSION 4.1 LAYOUT FEATURES OF ECAs and VCAs 4.1.1 The beginning section of ECAs and ... creation of clear, airtight, precise and unambiguous ECAs and VCAs 1.2 AIMS AND OBJECTIVES 1.2.1 Aims 1.2.2 Objectives - To identify and describe the discourse features of ECAs and preparing legal...

Ngày tải lên: 26/11/2013, 13:30

13 605 0
A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese

A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese

... RESEARCH QUESTIONS - What are the syntactic, stylistic and semantic features of grammar and have a wide range of vocabulary can absolutely use IDHDIE and IDHDIV? idioms well because the meaning of ... no doubt that idioms are an interesting and special phenomenon of languages Idioms are the grease that makes a language flow They introduce color and add grace and precision to speech and writing ... 1.2 AIMS AND OBJECTIVES syntactic, stylistic and semantic features of IDHDIE and IDHDIV From the reasons above and in high hope of making a small 1.2.1 Aims of the Research 1.5 SIGNIFICANCE OF...

Ngày tải lên: 26/11/2013, 13:31

14 1,9K 4
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all ... Function in Reliability Analysis and Optimization, London: Springer, 2005 A Lisnianski, and G Levitin, Multi-state System Reliability: Assessment, Optimization and Applications Singapore: World Scientific, ... performance of each state is defined as the minimum capacity of each interval, that is: g1 = 5200 , g = 5550 , g3 = 5700 , g = 5850 , V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of...

Ngày tải lên: 03/01/2014, 19:38

4 408 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... excised and purified with the GFXTM PCR DNA and Gel Band Purification Kit (AmershamPharmacia Biotech) Each p26 cDNA was ligated into pET21(+) using T4 DNA ligase, and competent E coli DH 5a were transformed...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... basis of domains I and II Looking from the direction of the arrow in (A) and (B), the coordinates of His572 at the tip of domain IV are roughly in one plane, and were manually covered with a...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... incubated with 10 lg of Fn and, after washing, bound Fn was visualized by incubation with rabbit polyclonal antibody against Fn followed by addition of peroxidase-conjugated goat anti-(rabbit ... Injection began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

... was decarboxylated to carbon dioxide and pyruvate About 90% of the latter metabolite was than further hydrolysed to acetate and formate Approximately 10% of the pyruvate was reduced to lactate, ... spectroscopy All 1H-NMR spectra were recorded on a 200-MHz narrow bore magnet (Gemini 2000, Varian, Palo Alto, CA, USA) equipped with a 5-mm broadband probe head For a lock a D2O vortex capillary was added ... et al (Eur J Biochem 270) Materials and methods Results Chemicals Isolation and characterization of the strain All chemicals were purchased from Sigma-Aldrich Chemical Co in the highest available...

Ngày tải lên: 08/03/2014, 08:20

6 360 0
Security Analysis of a Cryptographically-Enabled RFID Device ppt

Security Analysis of a Cryptographically-Enabled RFID Device ppt

... protocol transmissions is a matter of having the right equipment and software applications With this aim, we have equipped a small and easily portable PC with a Measurement Computing digital-to-analog ... the standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge attack Hence this type of attack permits the use of precomputed Hellman tables as touched on above ... is, scanning it at short range for a fraction of a second With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting multiple authentication transcripts...

Ngày tải lên: 16/03/2014, 19:20

15 550 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... (Qiagen) according to the manufacturer’s instructions Genomic DNA was partially digested with Sau3AI and fragments larger than 9.5 kb were ligated into BamHI-digested EMBL3 arms (Stratagene) and...

Ngày tải lên: 17/03/2014, 03:20

8 465 0
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... Morphological Analysis of Japanese Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002 Morphological Analysis of ... known and unknown words accurately, especially The recall of unknown words was lower than that of known words, and the accuracy of automatic morphological analysis was lower than that of manual...

Ngày tải lên: 17/03/2014, 06:20

10 398 0
Experimental Security Analysis of a Modern Automobile docx

Experimental Security Analysis of a Modern Automobile docx

... the car’s CAN buses, use a hardcoded challenge and a hardcoded response common to all similar units, seemingly in violation of the standard (specifically, the standard states that “all nodes with ... clear capability and intention in the standard to so too fast We implemented this attack both as a C AR S HARK module and as custom firmware for the AVR-CAN board The custom firmware consisted of ... constitutes abnormal behavior on the bus in the first place, as attacks can be staged entirely with packets that also appear during normal vehicle operation Toward Security These are just a few of many...

Ngày tải lên: 22/03/2014, 15:21

16 445 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... as an internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
w