Nucleophosmin as a direct inhibitor of caspase 6 and 8

... 3 .6 NPM inhibits the activities of caspase- 6 and -8, but not caspase- 3, -7 or -9 Figure 3.7 NPM inhibits the cleaving of procaspases by recombinant active caspase- 6 and -8 114 Figure 3 .8 Activation ... active caspase- 6 and -8 in MPP+-treated MN9D cells 135 Figure 4.2 NPM interacts with proform and cleaved caspase- 6 and -8 in UV-irradiated HeLa cells 1 36...

Ngày tải lên: 16/09/2015, 08:30

... MIP-1α and IL-1β factors may influence its severity A limitation of the current approach is that CD4+ T cell killing by CD134-driven DTA activation starts as soon as activated T cells are generated ... was associated with systemic expansion of myeloid cells, but was not sufficient for T cell activation We next examined the contribution of microbial exposure to th...

Ngày tải lên: 06/08/2014, 19:21

... very fast under the effect of chloride ion in marine environment Cua Cam port The strongly agressivity rate of chloride ion is the main reason causing corrosion, especially in the tropical climate ... cement water extract containing (CN and 6,0 kg Cl-) Research results Effectiveness of corrosion inhibition in extract of cement water containing Cl-: • In H0 extract,...

Ngày tải lên: 13/08/2014, 22:21

... aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as compared to that of acute pain patients On the other hand, GABA ... microglia are involved in the early development of chronic pain, while astrocytes function in sustaining the pain (Vallejo et al., 2010) An interesting findin...

Ngày tải lên: 02/10/2015, 17:15

... in disability pension risk with increase in absence days/yr A 10-day increase in absence days per annum (scale score ranging from 0-220 days/yr) yielded an increase in disability pension risk of ... sickness absence as a marker of future disability pensioning Conclusion The findings of in the present study indicate that the number of self-repor...

Ngày tải lên: 26/10/2012, 10:03

... Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units Yehuda Ginosar1*,† * Corresponding author ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked inc...

Ngày tải lên: 05/03/2014, 15:20

... article as: Tsuruta et al.: Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined ... studies and to begin to standardize the clinical dosing of therapeutic ultrasound when used as a male contraceptive Sinc...

Ngày tải lên: 05/03/2014, 17:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindII...

Ngày tải lên: 06/03/2014, 01:20

... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause...

Ngày tải lên: 06/03/2014, 04:20

... the epidermal growth factor (EGF) receptor ⁄ extracellular signalregulated kinase ⁄ and EGF receptor ⁄ Akt pathway for proliferation Mol Cancer Ther 3, 46 5–4 72 Amann J, Kalyankrishna S, Massion ... motility, and invasion It is also of great interest and importance to note that about one-third of the human lung cancer samples that we examined revealed significant downregulat...

Ngày tải lên: 07/03/2014, 00:20

... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...

Ngày tải lên: 07/03/2014, 02:20

... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu193 fi Ala Leu196 fi Ala The concentrations of ... fi Ala Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala 1.13 2.49 1.53 21.67 1.53 1.19 2.20 1.40 19.17 1.40 1.10 Asn189 fi Ala Ala190 fi Ala Arg191 fi Ala Asn192 fi Ala Leu193 fi Ala Leu196 fi Ala...

Ngày tải lên: 07/03/2014, 03:20

... NF-jB, namely the ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB [7] The canonical pathway of NF-jB ... Nishimura M, Morishita R, Kaneda Y, Kohmura E, Yoshimine T & Matsuda H (2001) Nuclear factor-kappa B decoy attenuates neuronal damage after global brain ischemia: a future st...

Ngày tải lên: 07/03/2014, 03:20

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...

Ngày tải lên: 07/03/2014, 15:20

... oligo cDNA probe and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, ... Regulation of Clcn5 promoter by Six1 and Six4 (C) Trans-activation of Slc1 2a2 promoter by Six1 and Six4 (D) Transactivation of myogenin promoter by Six1 and...

Ngày tải lên: 07/03/2014, 17:20