... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... Sickness absence can be viewed as an integrated measure of physical, psychosocial, and social function and wellbeing [5-7] As such, sickness absence levels can reflect an increased risk of developing...
Ngày tải lên: 26/10/2012, 10:03
... programmes, such as urban regeneration projects, transport initiatives (in addition to those under Transport 21) and Quality of Life projects Gateway Area Challenges Each Regional/Gateway Area faces ... Enterprise and Human Capital development of the Regions, including rural areas; and • The establishment of a Gateways Innovation Fund on a competitive and pilot basis, as a mechanism to bring about ... of integrated spatial planning frameworks at Gateway/Regional Authority level which will address appropriate land use at regional and Gateway levels; and facilitate and complement the Plan investment...
Ngày tải lên: 18/02/2014, 04:20
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
Ngày tải lên: 05/03/2014, 15:20
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
Ngày tải lên: 06/03/2014, 01:20
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at ... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... patient with tuberculous bronchopneumonia, was able to maintain oxygen saturation (SaO2) of 96% at room air, while patient with tuberculous pneumonia in case was able to maintain SaO2 of 90% at...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf
... ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB [7] The canonical pathway of NF-jB 28 activation passes through the activation ... 3-kinase (PI3K) ⁄ Akt pathway – are simultaneously involved in NF-jB activity [22] Stimulation of both the calmodulin kinase II and Akt kinase pathways are responsible for the upregulation of the ... complex back to the cytoplasm, therefore providing a feedback mechanism to restore the original latent state Two different intracellular pathways activate NF-jB, namely the ‘classic’ pathway and the...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot
... syntactic category aspect of each meaning of a phonetic word is also a part of the grammatical representation where i t makes associations with other syntactic categories The associations ... meanings, grammar, and pragmatic or local context, receive support as separately definable knowledge within studies of aphasia There is a vast l i t e r a t u r e concerning what aspects of language ... neurolinguistic l i t e r a t u r e demonstrates that the grammar can be affected in isolation from other aspects of language function (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough,...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... statistic indicates the extent to which each surprisal estimate accounts for RT, and can thus serve as a measure of the psychological accuracy of each model However, this kind of analysis assumes ... Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier 2009 Deriving lexical and syntactic expectation-based measures for psycholinguistic modeling via incremental top-down parsing ... surprisal as fixed factors in the baseline) are reported Figure shows the psychological accuracy of each model (χ2 (2) values) plotted against its linguistic accuracy (i.e., its quality as a language...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... order to bacterially express Mydj2 the corresponding cDNA was amplified by PCR using primer I (5¢-GCA GTAGAGGATCCTGAAAGAAA-3¢) and primer II (5¢-GTTATTCAGTCGACCATTAAGAGG-3¢) to generate the convenient ... Characterization and comparison of large and small dj2 mRNAs (A) Schematic representation and sequence comparison of the monkey large dj2 cDNA and human small dj2 cDNA (B) Northern blot analysis ... and h of incubation with actinomycin D, cells (8 · 106) were washed with NaCl/Pi and total RNA was prepared Northern blot analysis and detection of both messages, large dj2 and small dj2 mRNAs,...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf
... 59 Laguna A, Aranda S, Barallobre MJ, Barhoum R, ´ Fernandez E, Fotaki V, Delabar JM, de la Luna S, de ´ la Villa P & Arbones ML (2008) The protein kinase DYRK 1A regulates caspase-9-mediated apoptosis ... protein Catalytic subunit of c-secretase Transmembrane signalling pathway GTPase and cytoskeletal scaffolding protein NAD-dependent protein deacetylase Negative modulator of growth factor-mediated ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protein (PAHX-AP1), a brain specific...
Ngày tải lên: 22/03/2014, 16:21
Browning as a Philosophical and Religious Teacher pptx
... individualism, we may say that morality also has at last, in Bacon's phrase, passed from the narrow seas into the open ocean And after all, the greatest achievement of our age may be not that it has ... also the actual spring and source of present activity In so far as the agent acts, as Kant put it, not according to laws, but according to an idea of law (and a responsible agent always acts in ... ignorance which is ruinous, as when the cries of humanity beat against a deaf ear; and we can take a comfort, denied to Carlyle, from the fact that he has made us awake to our social duties He has...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... protein was precipitated and washed carefully with methanol–chloroform [31] The protein concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: "CASE ROLE FILLING AS A SIDE EFFECT OF VISUAL SEARCH" pdf
... t a n t ~ a t e d Form using case frames, e.g as part of a semantic net or frame hierarchy In contrast, the G,,rman language dialog system HAM-ANS (Hamburg application oriented natural language ... this change of d i r e c t i o n at the same time (cf (Sb)) A SHORT OVERVIEW OF HA~-ANS HAM-ANS is a large German natural l a n g u a g e dialog system of both considerable depth and breadth w h ... of cruise data c o n c e r n i n g the vessels' voyages , krill biology data, relevant net h a u l s and o c e a n o g r a p h i c data, are stored in a relational d a t a b a s e (76 r e l a...
Ngày tải lên: 24/03/2014, 05:21
backpacking a different way of camping
... car camping cannot The most beautiful sights are seen while backpacking, and this is because a car can only take one so far Most backpackers experience something that most car campers will ... most car campers will never see: the beauty of nature untouched by common man Regardless of the mode of exploring the great outdoors, an exciting adventure awaits ...
Ngày tải lên: 02/04/2014, 18:00
seeing doing and knowing a philosophical theory of sense perception apr 2005
... on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Matthen, Mohan Seeing, doing, and knowing : a philosophical theory ... have been saying, the consciously available record of sensory classification, a label that identifies an object as belonging to a particular class (We are not aware of the label independently of ... proposition: (1) X has a visual sensation as of a round thing three feet away Our experience of visual qualities has a particular conscious ‘feel’ So (1) implies (2) X has a sensation as of a round thing...
Ngày tải lên: 11/06/2014, 10:44
university of hawaii press the chinese classic of family reverence a philosophical translation of the xiaojing feb 2009
... was one of the Master’s later disciples, his father Zengxi 曾 皙, also called Zeng Dian 點, was an early student Zengxi appears in only a single passage of the Analects—one of the longest passages ... lament of reactionary and authoritarian intellectuals, but also as containing the keen insight that much of who and what we are is always linked to the past Indeed, obliterating our past leaves ... can the texts of classical Confucianism in general, and the Classic of Family Reverence in particular, be read in the same way, especially regarding filial respect and family values For just as...
Ngày tải lên: 11/06/2014, 12:46
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf
... by adding O-phenylenediamine as a substrate The color intensity is proportional to sHLA concentration Absorbance was measured at 492 nm Saliva levels of sHLA-II were measured at baseline as well ... therapy, with a surrogate marker, may have additional value as particularly effective immunomodulatory activity, such as that observed with natalizumab, may have a potential downside [26] that ... occurred in association with elevated levels of saliva sHLA-II levels at month Discussion There are a number of important reasons to have a reliable surrogate marker for disease activity in RRMS As the...
Ngày tải lên: 19/06/2014, 22:20