biodiversity as a key component of development investments

... Rights Act individual transferable quota International Union for the Conservation of Nature International Whaling Commission Kepasakapatan Konservasi Masyarakat large marine system least practical ... 12:25 PM Page xxiv Prelims.qxd 11/28/2008 12:25 PM Page xxv List of Acronyms and Abbreviations AAFC ABS ACC ACF ADB AOGCMs APFIC ARA ARTES ASALs ASEAN BA BCH BDI BCOW BIC BTNLL CAP CBA CBD CCAMLR ... and Management, University of California, Santa Barbara, USA Unai Pascual is Environmental Economist in the Department of Land Economy, University of Cambridge, UK Subhrendu K Pattanayak is Associate...

Ngày tải lên: 17/02/2014, 17:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...

Ngày tải lên: 06/03/2014, 01:20

... RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was ... renilla and firefly luciferase activities were assayed with the Dual Glo Luciferase Assay System (Promega) and measured with a luminometer (Luminoskan Ascent, Thermo Scientific, Waltham, MA, USA) ... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads...

Ngày tải lên: 09/08/2014, 23:20

... government has designated cashew development as a national priority Productivity of cashew has been increased since 2002, but the extensive use of pesticides has caused health problems to farmers, ... started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has ... important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect of these two species of ants on cashew flushing shoots damaged by the three major...

Ngày tải lên: 21/06/2014, 06:20

... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protein (PAHX-AP1), a brain specific ... DYRK 1A also regulates the transcriptional activity of glioma-associated oncogene [36], a major effector of SHH signalling, which is a key pathway in the regulation of proliferation ⁄ differentiation ... Guimera J, Casas C, Pucharcos C, Solans A, Domenech A, Planas AM, Ashley J, Lovett M, Estivill X & Pritchard MA (1996) A human homologue of Drosophila minibrain (MNB) is expressed in the neuronal...

Ngày tải lên: 22/03/2014, 16:21

... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... intercalate between its bases with no clear sequence specificity Conclusions Although the formation of amyloid fibrils is associated with major human diseases and has a clear physiological role...

Ngày tải lên: 23/03/2014, 11:20

... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identification of the reaction ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...

Ngày tải lên: 30/03/2014, 15:20

... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly ... methods have been tried (baiting at the base of cashew trees and engine oil spray around tree base), but this only resulted in a temporary reduction of ghost ants This was mainly because grass and...

Ngày tải lên: 21/06/2014, 05:20

... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... community baseline surveys A total of major cashew-growing provinces, which have 300,700 of cashew, accounting for 86% of the total cashew areas in Vietnam will be targeted Progress to Date Based on ... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained...

Ngày tải lên: 21/06/2014, 06:20

... are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were...

Ngày tải lên: 21/06/2014, 06:20

... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant colonies Under the supervision of Dr Peng, they have also gained ... to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages of...

Ngày tải lên: 21/06/2014, 06:20

... orchard, due to the sideeffect of ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much ... ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but we did not bait ... orchard Fig Average abundance of weaver ants in the IPM plot at Hong Loc Centre, Dong Nai province, Vietnam % weaverv ant abundance Fig shows that weaver ant abundance was over 60%, and the ant...

Ngày tải lên: 21/06/2014, 06:20

... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training ... X and cultivation Mr DV Tu IAS Cashew cultivation X X Mr DD Hien IAS Fertilizer application X X Mr HX IAS Cashew diseases and X X Quang their control Dr DT Binh IAS Cashew cultivation X Ms NT...

Ngày tải lên: 21/06/2014, 06:20

... lphlan@yahoo.com 2 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, ... net profit was achieved in the ICI plots A manual about the integrated cashew improvement (ICI) program using weaver ants as a major component has been developed for ICI program trainers and extension ... integrated cashew improvement (ICI) program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” has been developed The manual includes • cashew...

Ngày tải lên: 21/06/2014, 06:20

... identified as a transcriptional activator that interacts with the SAGA transcription factor, opens up the possibility of a co-transcriptional action of THO in higher eukaryotes [9] The impact of THO ... ubiquitination, and so on) that might change its pattern of activity Acknowledgements We thank R Luna and AG Rondón for critical reading of the manuscript The work of AA’s laboratory is funded by the Spanish ... in development and differentiation The relevance of THO in cell physiology has been clearly shown from yeast to humans Yeast THO null mutants are sick and slow growers and THO depletion has a...

Ngày tải lên: 06/08/2014, 19:21

... significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate that a large number of SARS ... the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration of therapy Steroid therapy causes ... has been proven for this disease or related conditions such as ARDS or other viral pneumonias History has shown that therapy based on anecdotes, even with sound pathophysiological support, may...

Ngày tải lên: 12/08/2014, 20:20

... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... Sickness absence can be viewed as an integrated measure of physical, psychosocial, and social function and wellbeing [5-7] As such, sickness absence levels can reflect an increased risk of developing...

Ngày tải lên: 26/10/2012, 10:03

... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...

Ngày tải lên: 05/03/2014, 15:20

... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at ... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... patient with tuberculous bronchopneumonia, was able to maintain oxygen saturation (SaO2) of 96% at room air, while patient with tuberculous pneumonia in case was able to maintain SaO2 of 90% at...

Ngày tải lên: 06/03/2014, 04:20

... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...

Ngày tải lên: 07/03/2014, 02:20