Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

... to fixing in 4% formaldehyde for 1min Before the stain solution was added, the cells were again rinsed thrice with PBS to remove the fixative The samples were then incubated for 15min in the dark ... induction, the drug was removed from the cells by changing the culture medium The E14tg2a cells were fed daily with fresh medium containing no Doxycyclin 4. 14. 1.3 Treatm...
Ngày tải lên : 11/09/2015, 16:02
  • 24
  • 298
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

... 2. 1 ES cell secretion of LEFTY2 maintains pluripotency 2. 1.1 Introduction The molecular basis of self- renewal and the maintenance of pluripotency in ES cells have yet to be ... secreted into and deposited in the ES cell microenvironment 79 2. 1 .2. 8 LEFTY2 maintains ES cell self renewal by inhibiting Nodal signaling Next, the mechanism of LEFT...
Ngày tải lên : 11/09/2015, 16:02
  • 117
  • 415
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

... signals dictate embryonic stem cell fates is also not entirely clear Conflicting roles of Nodal signaling in both the maintenance of ES cell self renewal and induction of ES cell differentiation ... be learnt The primary aim of this project hence serves to identify and delineate the roles of additional factors and pathways that are important for the...
Ngày tải lên : 11/09/2015, 16:02
  • 4
  • 184
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

... Bucay, N., Hinton, A., Firpo, M T., King, C C., and Hayek, A (20 05) Activin A maintains pluripotency of human embryonic stem cells in the absence of feeder layers Stem Cells 23, 489-4 95 Besser, ... H., and Miyazono, K (2007) Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells J Cell Sci 120, 55 - 65 Oh, S P., and Li, E (1997)...
Ngày tải lên : 11/09/2015, 16:02
  • 13
  • 229
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... the unleashing of the immense potential of ES cells is however the current incomplete understanding of the molecular mechanism underlying self renewal and cell fate determination of ES cells 1.2 ... pluripotent embryonic stem (ES) cell lines The derivation of pluripotent cell lines from blastocysts was first achieved in the murine system in 1981 by Ma...
Ngày tải lên : 11/09/2015, 16:02
  • 41
  • 312
  • 0
Appendix  identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist • • • • • Rex2 • Zinc finger protein • • • Zfx • • • a-catenin • Zinc finger protein Transcription factor Link to ... -catenin (Catnb) Dot1l Lef1 Gata3 • • • • • • • • complex Involved in Wnt signaling Subunit of Cadherin protein complex Intracellular mediator of canonical Wnt signaling Non-SET domain...
Ngày tải lên : 11/09/2015, 16:03
  • 12
  • 183
  • 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the Al...
Ngày tải lên : 16/03/2014, 23:20
  • 11
  • 584
  • 0
Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf

Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf

... A novel scheme to assess factors involved in the reproducibility of DNA-microarray data Running title: a novel scheme to assess DNA-microarray data quality Sacha A.F.T van Hijum1, ... show that the latter factors are indeed important for optimizing DNA-microarray data quality In order to assess the reproducibility of- and factors involved...
Ngày tải lên : 14/08/2014, 14:21
  • 35
  • 274
  • 0
Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

... development of multicellular organisms, it is also a means of keeping stem cell self- renewal and differentiation in balance During asymmetric division of neural stem cells in Drosophila melanogaster; ... through asymmetric division Each stem cell generates another stem cell and a sibling daughter cell destined to differentiate B Extrinsic versus intrin...
Ngày tải lên : 11/09/2015, 14:32
  • 150
  • 284
  • 0
Báo cáo y học: ":Identification of novel stem cell markers using gap analysis of gene expression data" ppsx

Báo cáo y học: ":Identification of novel stem cell markers using gap analysis of gene expression data" ppsx

... ebf4 ebf1 ebf2 cyp1a1 cyp1a2 cyp1b1 ) Figure Phylogenetic distribution of stem cell markers and their close paralogs in four protein families Phylogenetic distribution of stem cell markers and their ... undergone repeated gene duplication events for a phylogenetic analysis of the evolution of proteins involved in stem cell function By sequence similarity analysis,...
Ngày tải lên : 14/08/2014, 08:20
  • 19
  • 340
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... seen in the putative T-box DNA-binding domain of t-bet, the STAT protein interaction domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger ... implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated tyrosine residues in the context...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0
Báo cáo y học: "Identification of new autoantibody specificities directed at proteins involved in the transforming growth factor b pathway in patients with systemic sclerosis" pot

Báo cáo y học: "Identification of new autoantibody specificities directed at proteins involved in the transforming growth factor b pathway in patients with systemic sclerosis" pot

... this article as: Bussone et al.: Identification of < /b> new < /b> autoantibody < /b> specificities < /b> directed < /b> at < /b> proteins < /b> involved < /b> in < /b> the < /b> transforming < /b> growth < /b> factor < /b> b pathway in < /b> patients with systemic sclerosis ... 4) Thus, the < /b> expression of < /b> these proteins < /b> can be either increased or d...
Ngày tải lên : 12/08/2014, 15:23
  • 13
  • 297
  • 0
The symmetric dimethylation of histone h3 arginine 2  a novel histone mark involved in euchromatin maintenance

The symmetric dimethylation of histone h3 arginine 2 a novel histone mark involved in euchromatin maintenance

... Arginine Deaminase (PADI4), a nuclear member of the PADI family, promiscuously deiminates arginines on histone H3 (H3R2, H3R8, H3R17, and H3R26) and that deimination by PADI4 counteracts arginine ... ARGININE METHYLATIONS LINKED TO TRANSCRIPTIONAL ACTIVATION: H4/H2AR3me 2a, H3R17me 2a, H3R26me 2a 1.3.3.1 H4R3me 2a and H2AR3me 2a Methylation of arginine at position on t...
Risks Involved in the Use of Herbal Products

Risks Involved in the Use of Herbal Products

... discrepancy exists in the antioxidant and other bioactivities of flavonoids, which are powerful in assays conducted in vitro; the 14 Risks Involved in the Use of Herbal Products 357 measured in vivo activities ... were consistent in classifying the antioxidant capacity of the polyphenol-rich beverages in descending order: Punica granatum L (pomegranate)...
Ngày tải lên : 25/10/2013, 05:20
  • 15
  • 396
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... Evidence for the presence of DNA-binding proteins involved in regulation of the gene expression of indole-3pyruvic acid decarboxylase, a key enzyme in indole-3-acetic acid biosynthesis in Azospirillum ... the aminopyrimidine ring, are conserved in all ThDP-dependent enzymes One of these, the hydrogen bond between the N1¢ atom of the pyrimidine ring...
Ngày tải lên : 20/02/2014, 11:20
  • 10
  • 557
  • 0