Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Appendix Appendix I) Preparation of home-made alkaline phosphatase staining kit Preparation was based on Sigma-Aldrich Procedure #86-Alkaline Phosphatase kit for leukocytes All reagents are available from Sigma-Aldrich Solution A Sodium Nitrite 0.1M = 6.9g/L 0.4M HCl solution Fast Red Violet LB Base Water total volume 0.4mg/ml FRV ml ml mg ml 10.5 ml 12.5 Solution B 4mg/ml Napthol AMPD buffer pH 9.5 2M = 210.28 g/L Napthol AS-BI phosphate total volume ml mg Ml 12.5 50 12.5 Prior to staining, solution A was mixed with solution B and water in 2:1:1 ratio This mixture was then used to stain the samples 195 II) Titration of Activin A Pitx2 expression level normalized to non-treated control (%) 350 300 250 200 150 100 50 0 10 25 50 Concentration of Activin A added (ng/ml) Figure 44 25ng/ml of Activin A was deemed to be the optimal concentration for use to upregulate Nodal signaling For this titration experiment, E14 mouse ES cells were treated with varying concentration of Activin A for 10 hours, and then harvested and assayed for Pitx2 transcript level using qPCR analysis The samples were normalized to endogenous -actin and mean values are plotted as percentages relative to non-treated ES cells harvested at start of experiment (100%) for qPCR measurement Experiments were performed in biological duplicates and duplicate Ct values were obtained for each of the biological replicates (n=2) 196 III) Titration of Lefty1 120 Pitx2 expression level normalized to non-treated control (%) 100 80 60 40 20 0 25 50 100 200 Concentration of Lefty1 (ng/ml) Figure 45 50ng/ml of Lefty1was deemed to be the optimal concentration for use to lower Nodal signaling For this titration experiment, E14 mouse ES cells were treated with varying concentration of Activin A for 10 hours, and then harvested and assayed for Pitx2 transcript level using qPCR analysis The samples were normalized to endogenous -actin and mean values are plotted as percentages relative to non-treated ES cells harvested at start of experiment (100%) for qPCR measurement Experiments were performed in biological duplicates and duplicate Ct values were obtained for each of the biological replicates (n=2) 197 IV) Description of Ct method used for tabulation of qPCR data For all the qPCR data presented in this thesis, the relative transcript levels for the Ct method gene of interest between test sample and control were tabulated using the -Actin was used as the housekeeping gene for normalization The difference between the mean test sample Ct values and the mean -Actin values ( Ctsample) were first tabulated Ctsample = CtGene of interest – Ct -Actin Similar tabulations were then made for the scrambled control sample ( Ctcontrol) was then obtained by subtracting Ctcontrol from Ctsample Ct Ct method = Ctsample - Ctcontrol The relative mRNA level of gene of interest expressed between sample and control, expressed as a percentage relative to control (Percent diff) were then tabulated with the following formula: Percent diff = 2(- Ct) x 100% 198 V) qPCR primer sequences Gene Lefty2 Lefty1 Forward primer sequence Reverse primer sequence TCGATCAACCGCCAGTCCTG TGGGGACAGCCTCTTTTGCC Cadherin11 CGGCAAAGATTTCAGTAGAAGATGCc G GCATCTGGGTCTTTGGCATGTA Claudin6 CGAGACAAGATAGGAACTCCAAGTCT CG ATAGAGTGGGCAGTCCAGCAGA Cerberus1 CGAAGAGGTCTCCCAGTGTACTTCG CCGTGACTCAGCCAGCAGAT Nodal CGGTTCTCATGCTCTACTCCAACCG GGCTTCTGTCTGGCAAATGATG E-Cadherin CGGATGGTCTTTGTTCTGGTTATCCG TGACGCAGCTCAAGAATCTCTCA Pdgfr CGGCCTCTGTTCTCTACACTGCCG CCCTCTGGGAGACCTTCATCAG Foxh1 CAGCACTAGCAGGGACTTGATGCTG GGTGGATGTGAGCCTGATTCC T-brachyury CGCTTGTTAGTTAGCTCCTTGAAGCG CACAGAGAGCGCAGGGAAGAG Hex CGAGACGGAGAGGTATTTCTGAGTCT CG ACGACTACACGCACGCCCTAC Pthr1 CGGCATTAGGAAGTCTTGGAGCCG CCATTGGTGGTGGCAGGAAG Hnf4 CGTTGCCTGGAGGATTACATCAACG CATCTGCCAGGTGATGCTCTG Pitx2 ACCCCGGCTATTCGTACAAC GAGGACAGGGGATTGACGTTC Mixl1 CGTCTATGGTCTGTCGGAAGACG CCACGCAGTGCTTTCCAAAC Fgf8 CGCTTTAGTTGAGGAACTCGAAGCG ACATGGCCTTTACCCGCAAG Goosecoid CGATTCTGTCCGAGTCCAAATCG GGAGACGACAGAAGCGATCCTC Flk-1 AAGTGACTTGCCCAGCATCT CCGGTTCCCATCTCTCAGTA Gata4 CTGGAAGACACCCCAATCTC GTAGTGTCCCGTCCCATCTC Gata6 CTACACAAGCGACCACCTCA TGTAGAGGCCGTCTTGACCT Sox7 CGGTACGATTACCCCAACTACAAGTA CCG GTCACGAGAGAGGGAGCTGAGG Sox17 CTGCACAACGCAGAGCTAAG TTGTAGTTGGGGTGGTCCTG Pdgfr CGCTCCTTCTACCACCTCAGCG GCCGGATGGTCACTCTTTAGGA Itga7 TTCCCCATACAATGCTGTGA TAAAGGGCCCTGAGACAGTG 199 Esx1 CTAACCCCAACCCCAACC TTCTTGACAGGTAATGCGTGA Dlx3 GCCTTAGGGGTAAGGCTGTC GACCTGCTTCTCTTGGTTGC Cdx2 AGGCTGAGCCATGAGGAGTA CGAGGTCCATAATTCCACTCA Gata3 GGTTGTAGGCAAATCATTTG CAACCAAAAATCCAGAGAGA Hand1 CCCCTCTTCCGTCCTCTTAC CTGCGAGTGGTCACACTGAT Errb TTTCTGGAACCCATGGAGAG AGCCAGCACCTCCTTCTACA Cdh3 GCCAGGACTCTGAAGTTTGC CAAGTTCAAGCCCTGAGAGG Fgf5 ACTCCATGCAAGTGCCAAAT CACTCTCGGCCTGTCTTTTC Ngn1 GGAGTCGTCGCGTCAAAG CAGGGCCCAGATGTAGTTGT Nestin GATCGCTCAGATCCTGGAAG AGGTGTCTGCAAGCGAGAGT Gfap AAGCCAAGCACGAAGCTAAC GAGCAAGTGCCTCCTGGTAA Pax6 AGTGAATGGGCGGAGTTATG ACTTGGACGGGAACTGACAC Msi1 AGGCTCTCACCCCTGGAC CTGCCCCGTAGAGCTCAG Nkx2.2 TCTACGACAGCAGCGACAAC TTGTCATTGTCCGGTGACTC NeuroD1 GCCTTTACCATGCACTACCC TGTTGTCTATGGGGATCTCG Foxa2 CGGGGTATGTCTTGGGGTCCCG GGGCATGGGACCTCACCT Nr2f2 CGGGAAGCTGTACAGAGAGG GGACAGGTACGAGTGGCAGT Eomesodermin CCTGGTGGTGTTTTGTTGTG TTTAATAGCACCGGGCACTC E-Cadherin CGGATGGTCTTTGTTCTGGTTATCCG TGACGCAGCTCAAGAATCTCTCA BMP4 CGTGTTCACCTCCACCAGACACG CCTTCTGCGGGTCAAGGTATG 200 VI) A summary table documenting the qPCR analysis of germ layer markers for experiments involving elevation of Nodal signaling Gene Fgf5 Nestin Pax6 Ngn1 Ngn2 Gfap NeuroD1 Sox1 Msi1 Otx2 Nkx2.2 Claudin6 Mixl1 Gooscoid Nodal Fgf8 E-cadherin Cerberus1 Eomesodermin Cadherin11 Pitx2 T Lefty1 Flk-1 Tbx6 Hex Pgdfr Sox17 Foxa2 Gata4 Gata6 Sox7 Pdgfr Nr2f2 Pthr1 FoxH1 Gene expression level normalized to control (Mean values expressed in %) ALK4* Activin A Nodal Lefty2 RNAi treatment overexpression overexpression 211.3 490.5 9.4 340.6 82.2 87.3 50.8 164.4 51.4 44.4 87.0 118.3 44.3 77.9 122.3 95.2 68.8 56.5 35.5 73.6 127.3 141.6 109.2 94.7 52.7 84.8 107.3 84.0 88.3 158.6 157.6 262.1 215.8 999.5 1285.7 392.6 640.8 762.2 1291.2 226.1 117.7 130.5 160.8 274.8 107.1 440.5 1226.9 746.4 345.1 75.8 92.4 172.3 119.0 660.0 3768.6 39.8 283.4 533.8 294.2 118.9 164.5 142.5 195.14 188.5 268.8 4428.3 407.2 477.9 3833.6 700.5 1233.1 130.0 377.8 6047.4 171.1 87.3 81.9 85.2 77.2 86.0 72.4 109.9 120.3 163.6 123.3 80.7 91.0 81.5 129.4 68.5 227.7 461.6 249.5 128.5 249.6 420.9 90.7 104.0 40.9 12.1 73.8 122.8 192.4 330.7 59.5 96.9 124.0 89.6 134.4 201 VII) A summary table documenting the qPCR analysis of germ layer markers for experiments involving inhibition of Nodal signaling Gene Fgf5 Pax6 Ngn1 Nestin Gfap NeuroD1 Sox1 Msi1 Ngn2 Nkx2.2 Claudin6 Mixl1 Gooscoid Nodal Fgf8 E-cadherin Eomesodermin Cadherin11 Pitx2 T Lefty1 Flk-1 Hex Pgdfr Sox17 Foxa2 Gata4 Gata6 Sox7 Pdgfr Itga7 Esx1 Dlx3 Cdx2 Gata3 Hand1 Errb Cdh3 Gene expression level normalized to control (Mean values expressed in %) SB431542 SB431542 Lefty1 treatment (J1) treatment (E14) treatment 3.6 15.9 60.4 28.9 125.0 23.0 5.8 89.3 34.8 98.8 67.6 80.0 54.5 81.0 12.7 77.7 44.8 58.2 96.1 46.8 19.8 44.8 7.1 42.3 134.9 65.3 107.8 101.6 30.3 108.8 29.6 33.3 57.1 73.5 55.7 83.1 16.8 23.0 78.4 169.4 108.5 56.3 112.8 90.8 106.2 7.8 4.2 114.4 159.8 13.8 127.5 0.2 0.5 62.3 64.1 159.8 96.4 123.7 103.0 164.0 267.631 84.4 102.2 118.0 117.1 229.7 103.2 205.0 241.9 121.1 182.5 179.4 122.5 326.8 339.7 143.1 134.7 208.9 308.3 816.9 801.3 242.5 997.6 756.6 315.6 582.9 215.3 162.1 256.2 179.6 246.4 568.7 467.7 461.7 62.1 98.8 183.0 109.7 97.8 219.1 202 VIII) Candidate genes shortlisted Nature/Function/Pathway(s) involved Lefty1 • • • • Secreted protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist Criteria met • • • • High expression in ES cells and ICM Differential expression pattern between ES cells and differentiated cells Co-expressed with ES transcription factor like Nanog during mouse preimplantation development Oct4 and Nanog target in mouse Es cells LeftyB (human Lefty1) is regulated by Wnt pathway High expression in ES cells and ICM Differential expression pattern between ES cells and differentiated cells Co-expressed with ES transcription factor like Oct4 during mouse preimplantation development Oct4 , Sox2and Nanog target in human ES cells LeftyA (human Lefty2) is regulated by Wnt pathway Expression detected in ES cells and F9 murine teratocarcinoma Differential expression pattern between ES cells and differentiated cells Reduced expression during retinoic acid induced differentiation of F9 cells High expression in ES cells Link to canonical Wnt pathway • • • • • • Secreted protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist • • • • • Rex2 • Zinc finger protein • • • Zfx • • • a-catenin • Zinc finger protein Transcription factor Link to canonical Wnt pathway Subunit of Cadherin protein Perturbed Nanog promoter activity when knockdown? Yes Yes Yes Yes Yes Yes Yes No Expression detected in ES cells • • Lefty2 Reduced OCT4 promoter activity when knockdown? 203 (Catna) -catenin (Catnb) Dot1l Lef1 Gata3 • • • • • • • • complex Involved in Wnt signaling Subunit of Cadherin protein complex Intracellular mediator of canonical Wnt signaling Non-SET domain protein Histone H3 methyltransferase Transcription factor Intracellular mediator of canonical Wnt signaling Transcription factor • Link to canonical Wnt pathway No Yes • • Expression detected in ES cells Link to canonical Wnt pathway Yes Yes • Expression detected in ES cells No No • • Expression detected in ES cells Link to canonical Wnt pathway Yes No • Co-expressed with ES transcription factors like Nanog and Sox2 during mouse pre-implantation development Yes Yes 204 205 ... protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist • • • • • Rex2 • Zinc finger protein • • • Zfx • • • a-catenin • Zinc finger protein Transcription factor Link to... -catenin (Catnb) Dot1l Lef1 Gata3 • • • • • • • • complex Involved in Wnt signaling Subunit of Cadherin protein complex Intracellular mediator of canonical Wnt signaling Non-SET domain protein Histone... presented in this thesis, the relative transcript levels for the Ct method gene of interest between test sample and control were tabulated using the -Actin was used as the housekeeping gene for