Hình 24. Cấu trúc hóa học của factumycin [31]
Factumycin đƣợc phát hiện lần đầu tiên vào năm 1982 nhƣ một chất kháng sinh thuộc cùng nhóm với aurodox, kirromycin, efrotomycin, mocimycin, heneicomycin [21] . Factumycin có trọng lƣợng phân tử là 778,97048 g/ mol và
801.438 [M+Na]+
công thức phân tử là C44H62N2O10 (hình 25). Sự khác biệt giữa factumycin với các chất trong nhóm là sự có mặt của một vòng tetrahydrofuran mở và liên kết đôi với gốc ketone. Thêm vào đó bƣớc sóng hấp thụ của factumycin là 355 nm, dài hơn so với các chất kháng sinh khác trong cùng nhóm (~322 nm).
Hình 25. Cấu trúc của factumycin [46]
Factumycin có khả năng kháng cả các vi khuẩn Gram âm và Gram dƣơng [46] [21]. Năm 2011 Kyota Kimura và cộng sự đã chứng minh môi trƣờng lên men của chủng Streptomyces spp. K07-0034 có khả năng ức chế T3SS (hệ thống tiết típ 3) của các vi khuẩn Gram âm [31]. Năm 2012, Thaker và cộng sự phát hiện ra factumycin từ chủng xạ khuẩn Streptomyces toxytricini (WAC 5292) có hoạt tính kháng một số loại vi khuẩn Gram âm thƣờng đƣợc tìm thấy ở mầm bệnh đa kháng thuốc trong y tế nhƣ: Acinetobacter baumannii, Enterococcus faecalis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa và Staphylococcus aureus
[46]. Trong thử nghiệm của Kimura năm 2011, đã lây nhiễm trên chuột một liều gây chết của Citrobactor rodentium - một loại vi khuẩn gây bệnh cho ngƣời tƣơng tự
Escherichia coli. Kết quả quan sát cho thấy những con chuột đƣợc uống audorox liều lƣợng 25 mg/ kg có khả năng sống sót sau khi bị nhiễm Citrobactor rodentium
[31]. Trong một nghiên cứu in vivo về tác dụng của UK 69,753 - một glycoside của factumycin trên chuột bị nhiễm Treponema hyodysenteriae, kết quả cho thấy không
còn tìm thấy Treponema hyodysenteriae trong phân của chuột thí nghiệm thậm chí ở thời điểm 12 ngày sau khi thử nghiệm [28]. Tuy nhiên, factumycin chƣa từng đƣợc sử dụng để kháng Xoo gây bệnh bạc lá lúa.
Những nghiên cứu về cơ chế tổng hợp factumycin ở Streptomyces sp. cho thấy cụm gen sinh tổng hợp factumycin có kích thƣớc gần 76kb gồm 23 khung đọc mở: facAVI, facAV, facAIV, facAIII, facAII và facAI (gen quy định PKS và NRPS– PKS); facHIV, facHV và facHI (Hypothetical protein) và các gene khác: facP,
facRI, facT, facCII, facM, facD, facOI, facOII, facCI, facMII và facB (hình 3.24). Trong đó facT là gen quan trọng nhất trong việc sinh tổng hợp factumycin [46].
Trong nghiên cứu này, factumycin đƣợc tìm thấy có trong dịch nuôi cấy chủng VN08-A12. Thử nghiệm kháng vi sinh vật cho thấy, dịch nuôi cấy của chủng VN08-A12 có khả năng ức chế sinh trƣởng của cả vi khuẩn Gram âm (Escherichia coli NBRC 14237 và Xanthomonas oryzae pv. oryzae) và vi khuẩn Gram dƣơng (Micrococcus luteus NBRC 13867). Tuy nhiên, dịch nuôi cấy của chủng VN08- A12 có chứa factumycin không thể kháng đƣợc các vi sinh vật kiểm định khác. Chúng tôi giả thuyết rằng factumycin sinh ra từ chủng VN08-A12 có một phổ kháng vi sinh vật tƣơng đối hẹp. Điều này sẽ giúp ích cho việc ứng dụng chế phẩm factumycin trong xử lý bệnh bạc lá lúa trên đồng ruộng trong khi không gây ảnh hƣởng đến hệ vi sinh vật trong đất.
Hình 26. Cụm gen sinh tổng hợp factumycin (A) chủng WAC5292 (Streptomyces toxytricini) và (B) Streptomycescattleya.
KẾT LUẬN VÀ KIẾN NGHỊ
4.1. Kết luận
- Bằng phƣơng pháp hóa phân loại, hình thái học và phân tích trình tự gen 16S rADN, chủng VN08 - A12 đƣợc xác định là Streptomyces toxytricini.
- Điều kiện nuôi cấy tối ƣu để chủng VN08 - A12 sinh hoạt chất kháng Xoo
cao nhất đƣợc xác định nhƣ sau: 25 ml môi trƣờng SKS trong bình định mức 250 ml trong 4 ngày ở 30oC, cấy giống cấp 1 tốt hơn cấy bằng bào tử.
- Hoạt chất kháng Xoo sinh ra bởi chủng VN08 - A12 đã đƣợc tinh sạch và xác định là factumycin.
4.2. Kiến nghị
Kết quả trong nghiên cứu cho thấy chủng VN08 - A12 (Streptomyces toxytricini) có tiềm năng ứng dụng trong kiểm soát sinh học bệnh bạc lá lúa. Chính vì vậy, các nghiên cứu tiếp theo sẽ tập trung vào việc cải biến di truyền chủng VN08 - A12 để tăng khả năng sinh hoạt chất kháng Xoo và phát triển chế phẩm kiểm soát bệnh bạc lá lúa ở Việt Nam.
TÀI LIỆU THAM KHẢO TIẾNG VIỆT
1. Kiều Hữu Ảnh (1999), Giáo trình Vi sinh vật học công nghiệp, tập 1, Nhà xuất bản Khoa học và Kỹ thuật, Hà Nội.
2. Nguyễn Lân Dũng (2012), Giáo trình Vi sinh vật học, phần 3, Nhà xuất bản giáo dục Việt Nam.
3. Lê Lƣơng Tề, Bùi Trọng Thủy (2007). “Một số nghiên cứu về các Xa-gen kháng bệnh bạc lá lúa”, Tạp chí Bảo vệ thực vật, 1(1), tr. 1-7.
4. Nguyễn Xuân Thành, Dƣơng Đức Tiến (2003), Vi sinh vật học nông nghiệp, Nhà xuất bản Đại học sƣ phạm, Hà Nội.
TIẾNG ANH
5. Adhikari, T. B., Basnyat, R. C. (1999), “Virulence of Xanthomonas oryzae pv. oryzae on rice lines containing single resistance genes and gene combinations”, Plant Disease, 83, pp. 46-50.
6. Baltz, R. H. (2006), “Antibiotic discovery from actinomycetes: will a renaissance follow the decline and fall?”, SIM News, 55, pp. 186-196.
7. Basavaraj, M., Shivayageeswar, E. N. (2011), “Production and optimisation of tetracycline by various strains of Streptomyces under solid state fermentation using pineapple peel as a novel substrate ”, Recent Research in Science and Technology 3,pp. 01-08.
8. Bharathkumar, S., David, P. R. S., Brindha, P. V., Kavitha, S., Gnanamanickam, S. S. (2008), “ Improvement of bacterial blight resistance in rice cultivars Jyothi and IR50 via markerassisted backcross breeding”,
Journal of Crop Improvement, 21, pp. 101-116.
9. Bulletin, B. O. E. (2007), “Xanthomonas oryzae”, 37, pp. 543-553.
10. Caffrey, P., Lynch, S., Flood, E., Finnan, S., Oliynyk, M. (2001), “Amphotericin biosynthesis in Streptomyces nodosus: deductions from
analysis of polyketide synthase and late genes”, journal of Biology Chemistry, 8, pp. 713-723.
11. Chand, T., Singh, N., Singh, H., Thind, B. S. (1979), “Field efficacy of stable bleaching powder to control bacterial leaf blight”, journal of Rice Research Newsletter, 4, pp. 12-13.
12. Das, S., Lyla, P. S., Khan, S. A. (2008), “Distribution and generic composition of culturable marine actinomycetes from the sediments of Indian continental slope of Bay of Bengal”, Chinese Journal Oceanology Limnology, 26, pp. 166-177.
13. Dinh, H. D., Oanh, N. K., Toan, N. D., Du, P. V., Loan, L. C. (2008), “Pathotype profilce of Xanthomonas oryzae pv. oryzae isoaltes from the rice ecosystem in Cuulong river Delta”, Omonrice, 16, pp. 34-40.
14. Fravel, D. R. (2005), “Commercialization and implementation of biocontrol”, journal of Phytopathology, 43, pp. 337-359.
15. Furuya, N., Taura, S., Thuy, B. T., Ton, P. H., Hoan, N. V., Yoshimura, A. (2003), “Experimental technique for Bacterial Blight of Rice”, HAU-JICA ERCB Project, 25, pp. 42-50.
16. Gnanamanickam, S. S., Sakthivel, N., Alvarez, A. M., Benedict, A. A., Leach, J. E. (1996), “Serological and molecular probes for the detection of seedborne bacterial pathogens of rice and lack of demonstrable evidence for seed transmission of Xanthomonas oryzae pv. oryzae”, journal of plant Disease, 8, pp. 24-29.
17. Gnanamanickam, S. S., Velusamy, P., Immanuel, J. E., Thomashow, L. S. (2006), “Biological control of rice bacterial blight by plant-associated bacteria producing 2,4-diacetylphloroglucinol”, Canadian Journal of Microbiology, 52, pp. 56-65.
18. Gnanamanickan, S. S. (2009), “Biological control of rice diseases”,
19. Gonzalaz, R. I., Obregon, A. M., Escalante, L., Sanchez, S. (1995), “Gentamicin formation in Micromonospora purpurea: stimulatory efect of amanonium”, Journal of antibiotic, 48, pp. 479-483.
20. Gopalakrishnan, S., Kumar, R., Humayun, P., Srinivas, V., Ratnakumari, B., Vijayabharathi, R., Singh, A., Surekha, K., Padmavathi, C., Somashekar, N., Rao, R. P., Rao, L. V. S., Babu, V. R., Viraktamath, B. C., Goud, V. V., Loganandhan, N., Gujja, B., Rupela Oh, Y. Y. (2013), “Assessment of different methods of rice (Oryza sativa, L) cultivation for growth parameters, soil chemical, biological and microbiological properties, water saving and grain yield in rice-rice system”, Paddy Water Environment, 13, pp. 362-366. 21. Gullo, V. P., Zimmerman, S. B., Dewey, R. S., Hensens, O., Cassidy, P. J.
(1982), “Factumycin, a new antinbiotic (A40A): Fermentation, isolation and antibacterial spectrum”, Journal of Antibiotic, 12, pp. 1705- 1707
22. Hao, D., Gao, P., Liu, P., Zhao, J., Wang, Y., Yang, W., Lu, Y., Shi, T., Zhang, X. (2011), “A novel secretory protein, inhibits Elk1 transcriptional activity via ERK pathway”, Molecular Biology Reports, 38, pp. 1375–1382. 23. Hoa, P. T. P., Hop, D. V., Quang, N. Q., Ton, P. H., Ha, T. H., Hung, N. V.,
Van, N. T., Hai, T. V., Quy, N. T. K., Dao, N. T. A., Thom, V. T., (2014), “Biological Control of Xanthomonas Oryzae pv. Oryzae Causing Rice Bacterial Blight Disease by Streptomyces toxytricini (VN08-A-12), Isolated from Soil and Leaf-litter Samples in Vietnam ”, Biocontrol science, 19, pp. 3.
24. Hoa, P. T. P., Quang, N. D., Sakiyama, Y., Hop, D. V., Hang, D. T., Ha, T. H., Van., N. T., Quy, N. T. K., Dao, N. T. A., (2012), “Screening for actinomyces isolated from soil with the ability to inhibit Xanthomonas oryzae pv. oryzae causing rice bacterial blight disease in Vietnam”, African Journal of Biotechnology 10, pp. 1684–5315
25. Howard, T. D. (1998), “The Production of Neomycin by Streptomyces fradiae in Synthetic Media ”, Applied Microbiology, 1, pp. 103-106.
26. Huang, N., Angeles, E. R., Domingo, J., Magpantay, G., Singh, S., Zhang, G. (1997), “Pyramiding of bacterial blight resistance genes in rice; marker- assisted selection using RFLP and PCR”, Theoretical and Applied Genetic, 95, pp. 313-320.
27. Islam, N., Bora, L. C. (1998), “Biologycal management of Bacterial leaf blight of rice (Oryza Santiva) with plant grow promoting Rhizobacteria”,
Indian Journal of Agricultural Univercity, 12, pp. 50-63.
28. Jefson, M. R., Bordner, J., Reese, C. P., Whipple, E. B. (1989), “UK-69, 753, a novel member of the efrotomycin family of antibiotics II. Structure determination and biological activity”, Journal of Antibiotic, 11, pp. 1610- 1618.
29. Ji, G. H., Wei, L. F., Wu, Y. P., Bai, X. H. (2008), “Biological control of rice bacterial blight by Lysobacter antibioticus strain 13-1”, Biological control, 45, pp. 288-296.
30. Khush, G. S., Bacalango, E., Ogawa, T. (1990), “A new gene for resistance to bacterial blight from O. longistaminata”, Rice Genetics Newsletter, 7, pp. 121-122.
31. Kimura, K., Iwatsuki, M., Nagai, T., Matsumoto, A., Takahashi, Y., Shiom, K., Mura, S. O., Abe, A. (2011), “A small-molecule inhibitor of the bacterial type III secretion system protects againstin vivo infection with Citrobacter rodentium”, Journal of Antibiotic, 64, pp. 197-203.
32. Lestari, Y. (2006), “Short communication : Identification of indigenous
Streptomyces spp. Producing antibacterial compounds”, Journal of Mikrobiology Indonesia, 11, pp. 99-101.
33. Mew, T. W., Alvarez, A. M., Leach, J. E., Swings, J. (1993), “Focus on bacterial blight of rice”, Plant Disease, 77, pp. 5-11.
34. Mitchell, J. I., Logan, P. G., Cushing, K. E., Ritchie, D. A. (2006), “Novobiocin resistance sequences from the novobiocin producing strain
35. Miyadoh, S. (2005), “ Actinomycetes: Isolation and their antibiotic screening”, VNU-CBT and NITE cooperation project
36. Ndonde, M. J. M., Semu, E. (2000), “ Preliminary characterization of some
Streptomyces species from four Tanzanian soils and their antimicrobial potential against selected plant and animal pathogenic bacteria”, World Journal of Microbiology and Biotechnology, 16, pp. 595-599.
37. Ogawa, T., Sekizawa, K. (1993), “Studies on the breeding of rice varieties resistant to bacterial leaf blight and test of the quantitative resistance of rice native varieties in Japan by clipping inoculation methods”, Bulletin of Chugoku National Agricultual Experiment, 27, pp. 19-36.
38. Ou, S. H. (1985), “Rice diseases”, Biological control, 380, pp. 295-486. 39. Rafi, A., Akhtar, M. A., Akmal, M., Bibi, A., Ali, M., Rahman, H., Junaid,
M. (2013), “Effect of planting dates on bacterial leaf blight incidence and yield performance of rice cultivars in different location of khyber pakhtunkhwa, pakistan”, Sarhad Journal of Agriculture, 29, pp. 408-414. 40. Schatz, A., Bugie, E., Waksman, S. A. (1994), “Streptomycin, a substance
exhibiting antibiotic activity against gram-positive and gram-negative bacteria”, journal of Biology and Medicine, 55, pp. 66-69.
41. Shang, K., Hu, H., Zhu, C., Zhu, B. (2008), “Production of 4′- epidaunorubicin by metabolic engineering of Streptomyces coeruleorubidus
strain SIPI-1482”, Journal of Microbiology and Biotechnology, 24, pp. 1107- 1113.
42. Shapiro, S., Vining, L. C. (1983), “Nitrogen metabolism and
chloramphenicol production in Streptomyces venezuelae”, Canadian Journal of Microbiology, 29, pp. 1706-1714.
43. Srivastava, D. N. (1972), “ Bacterial leaf blight of rice”, Phytopathol, 26, pp. 1-16.
44. Subramoni, S., Jha, G., Sonti, R. V. (2009), “Virulence functions of
45. Tagami, Y., Mizukami, T. (1962). (1962), “Historical review of the researches on bacterial blight of rice caused by Xanthomonas oryzae (Uyede and Ishiyama) Dowson”, Special Report of Plant Disease and Insect Pests Forecasting Service, 10, pp. 1-112.
46. Thaker, M. N., Garcıa, M., Koteva, K., Waglechner, N., Sorensen, D., Medinab, R., Wright, R. D. (2012), “Biosynthetic gene cluster and antimicrobial activity of the elfamycin antibiotic factumycin”, Medicinal Chemistry Communications, 3, pp. 1020–1026
47. Thanh, D. T. (2006), “Identification of rice bacterial leaf blight Xanthomonas oryzae pv. oryzae by PCR”, journal of plant science and biotechnology, 6, pp. 44-47.
48. Unnamalai, N. (1987), “Seedborne nature of Xanthomonas campestris pv. oryzae (Ishiyama) Dye, the bacterial leaf blight pathogen of rice”, Ph.D. dissertation, University of Madras.
49. Vauterin, L., Hoste, B., Kesters, K., and Swings, J. (1995), “Reclassification of Xanthomonas”, International Journal of Systematic Bacteriology, 45, pp. 472–489.
50. Vauterin, L., Rademaker, J., Swings, J. (2000), “Synopsis of the taxonomy of the genus Xanthomonas”, Phytopathology, 90, pp. 677–682.
51. Vera Cruz, C. M., Gossele, F., Kersters, K., Segers, P., Mooter, V. D. M., Swings, J. (1984), “Differentiation between Xanthomonas campestris pv.
oryzae, Xanthomonas campestris pv. oryzicolaand the bacterial “brown blotch” pathogen on rice by numerical analysis of phenotypic features and protein gel electrophoregrams”, Journal of General Microbiology, 130, pp. 2983–2999.
52. Wang, Y. G., Davies, J. E., Hut Chinson, C. R. (1982), “Plasmid DNA in the erythromycin producing microorganism streptomyces erythreus NBRC 2338”, Journal of Antibiotic,, 35, pp. 335-342.
53. Weissbach, H., Redfield, B., Beaven, V., Katz, E. (1965), “Actinomycin synthesis in washed cells of Streptomycesantibioticus”, journal of Biology Chemistry, 240, pp. 4377-4381.
54. Yoneyama, K., Sekido, S., Misato, T. (1978), “Studies on the fungicidal action of dithiocarbamates 3 effect of sodium dimethyldithiocarbamate on fatty acid synthesis of Xanthomonas oryzae”, Annals of the Phytopathological Society of Japan, 44, pp. 313-320.
PHỤ LỤC
1. Phân tích thành phần axit amin
Dung môi chạy sắc ký bản mỏng TLC (ml): Methanol - 80; nƣớc cất - 17,5; 6 N HCl - 4, Pyridine - 10.
Điều kiện chạy HPLC: Sử dụng UV detector ở bƣớc sóng 254 nm. Dung dịch (A) 6% CH3CN, dung dịch (B) 60% CH3CN, tốc độ dòng chảy: 1 ml/ phút
Chƣơng trình chạy HPLC:
Bảng 13. Chƣơng trình chạy HPLC phân tích thành phần axit amin
Thời gian (phút) Nồng độ dung dịch B (%)
0 0 15 70 25 100 30 100 0 Dừng 2. Phân tích thành phần menaquinone
Dung môi chạy TLC: Toluen.
Điều kiện chạy HPLC: Dung môi (Methanol : Propanol = 2 : 1). Tốc độ dòng chảy 0,2 ml/ phút. Nhiệt độ cột 40oC. Nhận biết bằng UV detector với bƣớc sóng 275 nm.
Bảng 14. Phân tích thành phần menaquinone chuẩn
Pick Thời gian lƣu Diện tích peak Chiều cao peak Phần trăm diện tích peak (%) Phần trăm chiều cao peak (%) Thành phần menaquinone chuẩn 1 11,326 201944 12461 11,182 13,675 MK - 9 (H2) 2 12,709 570803 28753 31,605 31,555 MK - 9 (H4) 3 14,031 732861 36762 40,578 40,344 MK – 9 (H6) 4 15,682 300428 13146 16,635 14,427 MK - 9 (H8) Tổng 1806036 91122 100,000 100,000 Hình 27. Sắc ký đồ thành phần menaquinone chuẩn MK - 9 (H6) MK - 9 (H8) MK - 9 (H4) MK - 9 (H2)
3. Phân tích thành phần axit béo
Dung dịch: R1: NaOH 15 g, Methanol 50 ml, MQ 50 ml R2: 6N HCl 65 ml, Methanol 55 ml, pH 1,5 R3: n- hexane 50 ml, methyl-ter-butyl ethel 50 ml R4: NaOH 10,8 g, MQ 900 ml
R5: 100 ml MQ + 40 g NaCl
Bảng 15. Phân tích thành phần axit béo chuẩn
Thời gian lƣu Axit béo Tỷ lệ phần trăm (%)
6,962 14:0 iso 2,11 7,491 14:0 1,15 8,462 15:0 iso 7,71 8,603 15:0 anteiso 22,49 9,049 15:0 9,820 16:1 iso H 4,85 10,101 16:0 iso 17,32 10,421 12,98 10,723 16:0 6,96 11,453 4,13 11,641 17:1 anteiso 6,90 11,820 17:0 iso 1,83 11,982 17:0 anteiso 9,03
Thời gian lƣu Axit béo Tỷ lệ phần trăm (%)
12,107 17:1 w8c 0,79
13,184 17:0 10methyl 0,59
13,291 18:1 iso H 0,68
13,917 0,48
Hình 28. Sắc ký đồ thành phần axit béo chuẩn
4. Phân tích thành phần G+C trong ADN
Đệm acetate (40 mM, pH 5,3): 2 mM ZnSO4 25 μl + dung dịch nuclease P1 (20 U/ ml) 25 μl.
Bảng 16. Trình tự mồi dùng cho phản ứng đọc trình tự ADNr 16S Mồi Trình tự 5’-3’ 27F AGAGTTTGATCCTGGCTCAG 1525R AAAGGAGGTGATCCAGCC 780F GAATTGATACCCTGGTAG 350R CTGCTGCCTCCCGTAG 1100F GCAACGAGCGCAACCC 920R GTCAATTCCTTTGAGTTT
3M SKS N8 301 2M 16M ĐC 7N 6N 5N 4N 3N ĐC 125ml 150ml ĐC 25ml 75ml 100ml 50ml 35o C 30oC 40oC ĐC 1x108 2x108 3x108 4x108 24h 48h 72h 96h A) B) B) C) ) D) E) F)
Hình 29. Hoạt tính kháng Xoo của VN08 - A12 trong các điều kiện nuôi cấy khác nhau
(A). Thể tích nuôi cấy khác nhau (25, 50, 75, 100, 125, 150 ml), ĐC (-)
(B). Thời gian nuôi cấy khác nhau ( 3, 4, 5, 6, 7 ngày), ĐC (-)
(C). Môi trƣờng nuôi cấy khác nhau (3M, 16M, 2M, 301, N8, SKS), ĐC (-)
( D). Nhiệt độ nuôi cấy khác nhau ( 30, 35, 40oC), ĐC (-)
(E). Cấy giống bằng bào tử (1x108, 2x108, 3x108, 4x108 bào tử) (F). Giống cấp I ( 24, 48, 72, 96 giờ)
7. Tách chiết và tinh sạch