fish meal soybean meal ratio vitamin c and fish oil supplementations in diet on the growth and reproduction of red swamp crayfish procambarus clarkii crustacea decapoda
Báo cáo sinh học: " Impact of changes in diet on the availability of land, energy demand and greenhouse gas emissions of agriculture" pot
... contribution of conventional agricultural production Accounting for all sources, the production of t of wheat yields a CED of 676 kWh and emissions of 360 kg of CO2e, where 31% of the CED and 27% of the ... [1] In addition, agriculture also contributes to emissions by the consumption of energy, both directly, in the operation and maintenance of plant and machinery used to cultivate cropland and maintain ... this topic often focus on the impact of dietary choices either on energy and emissions or on the availability of land, e.g., in the studies conducted by Carlsson-Kanyama [4], Eshel and Martin [9],...
- 27
- 553
- 0
Báo cáo toán học: " Impact of changes in diet on the availability of land, energy demand, and greenhouse gas emissions of agriculture" docx
... contribution of conventional agricultural production Accounting for all sources, the production of t of wheat yields a CED of 676 kWh and emissions of 360 kg of CO e, where 31% of the CED and 27% of the ... to consider the different conditions of production specific to various farming regions Despite these uncertainties, the positive effects of reducing meat consumption and basing nutrition on plants ... production, crop rotation constraints have to be taken into account In this case, the following crop rotation constraints were assumed for conventional agriculture in Austria: the share of grains...
- 14
- 457
- 0
Báo cáo thú y: "The effect of the combination of acids and tannin in diet on the performance and selected biochemical, haematological and antioxidant enzyme parameters in grower pig" docx
... grade of inhibition of the described reaction The standard calibration curve of percentage of inhibition by standard solutions and log concentrations (U/ml) was used to determine SOD activity in our ... effect of the combination of acids and tannin in diet on the performance and selected biochemical, haematological and antioxidant enzyme parameters in grower pigs Acta Veterinaria Scandinavica ... feeding, clearly indicating no diet effects However, the inclusion of organic acids and the combination of acids and tannin had no deleterious effects on haematological, biochemical and antioxidant...
- 8
- 469
- 0
DSpace at VNU: Comparison of enzyme-assisted and ultrasound-assisted extraction of vitamin C and phenolic compounds from acerola (Malpighia emarginataDC.) fruit
... external calibration curve prepared with the standard ascorbic acid According to Mezadri et al (2008), ascorbic acid is the predominant form of vitamin C in acerola; hence, the content of ascorbic acid ... with the increase in enzyme concentration and approached the highest value at enzyme concentration of 8.1 NCU g)1 Higher enzyme concentration did not result in higher vitamin C and phenolic contents ... temperature control The reduction in ascorbic acid concentration under the uncontrolled temperature condition may be due to (i) the interaction of this compound with hydroxyl radicals, and ⁄ or (ii) the...
- 9
- 157
- 0
Vitamin C giúp ngăn ngừa bệnh đục thủy tinh thể ở phụ nữ pdf
... tinh mắt bị vẩn đ c Chứng đ c thủy tinh thể vỏ xuất Mắt bệnh đám mờ xuất nhân bị đ c thủy lăng kính trung tâm bên mắt tinh thể Phát c ng c quan niệm cho chất chống ơxy hóa (trong c vitamin C) ... người không dùng vitamin Kết luận nhà khoa h c Boston (Mỹ) đưa sau tiến hành nghiên c u 3.492 phụ nữ độ tuổi 53 -73 Nghiên c u đăng Tạp chí Dinh dưỡng Lâm sàng Mỹ số tháng Đ c thủy tinh thể bệnh ... phụ nữ 60 tuổi, vi c dùng 362 mg vitamin C/ ngày làm giảm 57% nguy bị đ c vỏ thủy tinh thể so với người dùng 140 mg/ngày Ngồi ra, khả m c bệnh giảm 60% phụ nữ dùng vitamin C bổ sung đặn 10 năm,...
- 3
- 310
- 0
Dissertation for doctor of philosophy in agriculture study on the growth and development ability of some imported soybean varieties and cultivation techniques for prospect variety in thai nguyen
... technical methods c/ Monitoring indicators: The farmers participated in conducting and evaluation of the trials: Yield (tons/ha), economic efficiency of the trials (expenditure - outcomes) and ... CONCLUSION AND DISCUSSION Conclusion The favorable factors for developing the soybean production in Thai Nguyen were the favorable climate conditions and the large land resource The fact that soybean ... the new technical methods was very suitable with climate and land conditions of the region and obtained much higher yield as well as economic efficiency than the local varieties 23 CONCLUSION...
- 26
- 375
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... as inlet to the first collector The outlet of first collector will be inlet to the second collector and the outlet of the second collector will be inlet to the next and so on up to the Ncth collector ... The difference in evaporation from saline water and fresh water is because of chemical salt concentration The evaporation rate can be linked to the salinity by introducing water molar fraction ... in salinity, the evaporation of water decreases due to increase in ion activity and the reduction of thermodynamically spontaneous change of a liquid phase into a vapour phase Increasing the water...
- 26
- 568
- 0
Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx
... accessible care and information from community-based providers Community-based providers often are the first point of contact for both care of sick children and provision of health information They include ... success in Malawi, World Relief faced some initial challenges in introducing it, including difficulty Community Approaches to Child Health in Malawi with community acceptance and mobilization ... curiosity and increase the project’s exposure to local residents In time, every village in the project area asked to be included and received training in all of the project’s interventions The current...
- 33
- 555
- 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... be contradictory to the conclusions of the Final Document of the Moscow Meeting of the Conference on the Human Dimension of the CSCE and in breach of Article 19 of the International Covenant on ... account in the Commission’s deliberations with a view to the adoption in the first half of 2011 of a Communication on electronic commerce, including on the impact of the Electronic Commerce Directive ... practice and delivered opinions on the functioning of the telecoms market in the EU Communication from the Commission to the European Parliament, the Council, the Economic and Social Committee and...
- 238
- 2,697
- 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx
... conformation Oxidation of the catalytic cysteine decreased the contacts made to the cysteine Sc but resulted in the formation of 17 additional interactions with the oxygens of the cysteine sulfonic acid ... contact with Od1 and a 1.81 A ˚ tact with Sc, a 2.21 A contact with Od2 of the cysteine sulfonic acid In addi˚ tion to these contacts, there is a 1.82 A contact between Gly255 Ca and Od2 of the ... values for InsP6 [30] The ionic strength P was calculated using the equation I = ½ ciZi2, where I is the ionic strength of the solution, and ci and Zi are the concentration and charge of species i,...
- 10
- 596
- 0
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt
... dispersions of two zwitterionic phospholipids and one anionic phospholipid by DSC In each case the result of progressively increasing the Fig The amino acid sequence, structure and conformation of the ... MLVs containing mole percent GS14 (–—) and its deconvolution into sharp and – broad components (- - - -) cooperativity is only moderately reduced In contrast, the incorporation of both GS10 and ... Northampton, MA, USA) and ORIGIN software (OriginLab Corporation, Northampton, MA, USA) Samples containing the GS ring-size analogs alone, dissolved in buffer at a peptide concentration corresponding...
- 10
- 683
- 0
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc
... to intergenerational equity; - takes into consideration the social, economic, and environmental contexts of a particular place and shapes the curriculum or programme to reflect these unique conditions ... understanding that the actions of an individual or a group can affect the lives of others and the social, economic, and environmental situations locally and abroad Beyond envisioning a sustainable ... alliances in which they function: - vision-building and advocacy; - consultation and ownership; - partnership and networks; - capacity-building and training; - research and innovation; - use of Information...
- 27
- 631
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
... PHCP, indicating that the position of the sixth ligand to the heme iron is empty, as discussed for other cytochromes c [14] In addition, the a-band in the pyridine hemochrome spectrum of reduced ... The arrow and arrowhead indicate the positions of the PHCP and PH c5 52 proteins, respectively The band denoted by the asterisk on the right-hand side is the result of nonspeci c staining of the ... 20118005) from the Ministry of Education, Culture, Sports, Science and Technology of Japan References Ambler RP (1982) The structure and classification of cytochromes c In From Cyclotrons to Cytochromes...
- 8
- 606
- 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... a Compound concentration required to reduce enzyme activity by 50% ± SD b Compound concentration required to reduce the HIV-1induced cytopathic effect in MT-2 cells by 50% c Compound concentration ... and steric modifications occur The binding mode of K-49 in the Y18 1C RT is different, and the contribution of the p–p stacking interaction is lost Furthermore, the low number of good contacts with ... quick spin column and T4 polynucleotide kinase were from Roche (Switzerland) The p12 DNA oligonucleotide (5¢-GTCTTTCTGCTC-3¢), the tC5U RNA oligonucleotide (5¢-CCCCCUCUCAAAAACAGGAGCA GAAAGACAAG-3¢)...
- 14
- 425
- 0
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... GCTGAACCCAGAAGTGCTGTCGCCC ACCCAGAAGTGCTGTCGCCCAACGCCG TGC Ó FEBS 2002 1120 S Bechtel et al (Eur J Biochem 269) Transient transfections and enzymatic assays Transfections were performed using the ... from one of the cytochromes P450 with known three-dimensional structure and determination of the sidechain conformations based on information about the backbone secondary structure and the side chains ... presence of DOC, indicating that other amino acids, including some at the N-terminus, contribute to efficient CYP11B1 and CYP11B2 wild-type activity In addition, it is known from the crystal structures...
- 10
- 648
- 0
Dutch and English on the Hudson A Chronicle of Colonial New York doc
... Such a man was a poor person to be put in control of the complicated finances of New Netherland and of the delicate relations between the colonists and the Indians relations calling for infinite ... Rebellion illustrates the difficulty of sifting conflicting historical testimony Among the earlier chroniclers of New Netherland there is the widest difference of opinion about the chief actor in the ... one and closed at four o'clock It was the duty of the teacher to instruct the children in the catechism and common prayer The teacher was ordered to appear at the church on Wednesdays with the children...
- 91
- 440
- 0
báo cáo hóa học:" Impact of recent life events on the health related quality of life of adolescents and youths: the role of gender and life events typologies in a follow-up study" potx
... Coddington Life Events Scales (CLES)[3,4,27], which measure the occurrence of 53 LEs Respondents indicate for each item describing a specific LE and the number of times the event has occurred in the ... education was collected from the adult respondent and included the highest family level of education according to the International Standard Classification of Education (ISCED) Categories were: ... last months, 4-6 months earlier, 7-9 months earlier, or 10-12 months earlier The frequency of occurrence is taken into account in the calculation of Life Change Units (LCUs) which also reflect the...
- 9
- 583
- 0
Báo cáo hóa học: " Effect of thermal treatment on the growth, structure and luminescence of nitride-passivated silicon nanoclusters" pptx
... by the Centre for Photonics, a division of Ontario Centres of Excellence Inc, by the Canadian Institute for Photonics Innovations (CIPI), and by the Natural Sciences and Engineering Research Council ... and into the near-infrared portion of the electromagnetic spectrum by increasing the excess silicon content in the film This correlates well with expected quantum confinement effects as Si-ncs ... is certainly necessary to gain accurate and specific information on the changes in the silicon nitride host matrix Isothermal anneals at 600 C As described previously, in the case of isochronal...
- 12
- 362
- 0
Báo cáo hóa học: " Research Article On the Fixed-Point Property of Unital Uniformly Closed Subalgebras of C X" docx
... involution on X We denote by C X, τ the set of all f ∈ C X for which f ◦ τ f Then C X, τ is a unital uniformly closed real subalgebra of C X which separates the points of X, does not contain the constant ... topological space and let τ be a topological involution on X Then i CR X, τ is in nite dimensional; ii C X, τ is in nite dimensional Fixed Point Theory and Applications Proof Choose a sequence {xn ... an in nite first countable compact Hausdorff topological space Then X, and X has at least one limit point Hence S0 C X , X contains a limit point S0 C X , X of X Therefore, C X fails to have the...
- 9
- 363
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose