when prompted for the permission flags enter a question mark and press return to list t
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf
... signals received within the cytoplasm could be translocated to the genome and translated by a linked pathway of proteins from the cytoskeleton, across the nuclear membrane to the nuclear lamin structures ... Moreover, as cytoplasmic proteins such as vimentin and plectin are subject to multiple phosphorylation reactions [65,66], a link between the structural and the signalling state of the cytoskeleton with ... sequence identity within the coiled-coil forming domain of both lamins, it may be safe to speculate that they are able to associate into mixed dimers With the onset of mitosis, the lamina is disassembled...
- 8
- 510
- 0
An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot
... diagnostic and therapeutic, and the platform is designed to facilitate and optimize their work In this platform, the professionals can access the diagnosis and history of each participant for whom they ... the participants abandoned the study, and all of them participants came back to use Butler system They expressed satisfaction with all of their sessions and wanted to return the next week The ... the study Once the users voluntarily agreed to participate, they were given the state version of the State-Trait Anxiety Inventory Scale (STAI-S)28 and the Yesavage 15-item short version of the...
- 8
- 733
- 0
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf
... As interest rates and exchange rates are adjusting and global rebalancing is expected to lead to further realignments, carry trades are likely to unwind Thus far these trades have been profitable ... between ten-year and three-month futures rates in all cases shown, except the United States Feedback effects from the real It is also important to take into consideration that changes in interest ... financial institutions is more difficult to predict First, the foreign exchange market is rather opaque, as participants know their positions relative to a given counterparty, but not the aggregate...
- 18
- 384
- 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx
... possible at the time Indeed, their insights set off multiple lines of research aiming to expand on the work they had done Attempts to extend the compartmental modelling frame to handle relational concurrency ... Kretzschmar papers, a large multi-disciplinary group of statisticians and social scientists took the approach of setting out to develop the statistical models and programming tools needed to ... Unfortunately, for all the theoretical richness that this work generated, it did not spawn much subsequent research that used the new methods but with more detailed empirical data Even the later...
- 7
- 459
- 0
báo cáo hóa học:" Research Article Resource Allocation for the Multiband Relay Channel: A Building Block for Hybrid Wireless Networks" ppt
... i not have a total power constraint between the source and the relay and assume that each has its own battery We assume that the system has total bandwidth W We define the received SNRs at the ... where Ps and Pr are the total available power at the source and relay node αi and ζi are the nonnegative power allocation parameters for each orthogonal band at the source and relay node, and m ... and transmits it to the destination at the appropriate rate Based on whether the relay node is utilized by a certain channel (band), we note that there are 2m possible schemes We observe that...
- 13
- 305
- 0
Báo cáo hóa học: " Research Article Inequalities for the Polar Derivative of a Polynomial" pot
... Journal of Mathematical Analysis and Applications, vol 336, no 1, pp 171–179, 2007 11 A Aziz, “Inequalities for the derivative of a polynomial,” Proceedings of the American Mathematical Society, ... Singh, and A Mir, “Extensions of some polynomial inequalities to the polar derivative,” Journal of Mathematical Analysis and Applications, vol 352, no 2, pp 807–815, 2009 A Aziz and Q M Dawood, ... Recently, Dewan et al extented inequality 1.6 to the polar derivative of a polynomial and obtained the following result Theorem B If p z a0 |z| < k, k ≥ 1, then for |α| ≥ 1, n ν t max Dα p z |z| a ...
- 9
- 220
- 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc
... consists of a set of states and directions on how to change states Each state specifies a set of outputs that are asserted or deasserted when the machine is in that particular state The labels on the ... assumes that all outputs that are not explicitly asserted are deasserted, and the correct operation of the architecture often depends on the fact that a signal is deasserted Multiplexors and demultiplexor ... arc are conditions that are tested to determine which state is the next one When the next state is unconditional, no label is given Note that implementation of a finite-state machine usually assumes...
- 18
- 385
- 0
Báo cáo hóa học: " The Cramer-Rao Bound and DMT Signal Optimisation for the Identification of a Wiener-Type Model" pptx
... estimates are caused by the practical problem that, for these special phase sets ϕ, the Hessian matrix of the estimator of Section gets near to a singular matrix and thus the optimisation algorithm ... it turned out that in contrast to the linear FIR filter case, the amplitude as well as the phase distribution of the DMT excitation signal are of vital importance A three-step procedure to obtain ... signal with variance σu = 0.64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the...
- 14
- 294
- 0
Báo cáo toán học: "Lower Bounds for the Average Genus of a CF-graph" doc
... i=1 The joint-tree approach [17] is an alternative to the Heffter-Edmonds algorithm for calculating the genus of the surface associated with a given rotation system The rotation system is what combinatorializes ... combinatorializes the topological problem; a joint tree can be regarded as the combination of a spanning tree and a rotation system Given a spanning tree T and a rotation system R of G, the associated ... say we attach an open ear to the interior of e Similarly, if the vertices u = v, then we say we attach a closed ear to the interior of e The two vertices u and v are called the ends of the ear...
- 14
- 386
- 0
Báo cáo khoa học: "Comparison of RBE values of high- LET a-particles for the induction of DNA-DSBs, chromosome aberrations and cell reproductive death" potx
... studies and coordinated the study NAPF and GWB drafted the research, performed the dosimetry of the alpha particle irradiation and wrote the paper RtC and JH performed the chromosomal aberration studies ... as the contribution to the linear parameter a that after irradiation is repaired in conditions optimal for repair STLD, single track lethal damage, derived as the linear parameter a in conditions ... percent to the total effect This contribution is not detectable as a deviation from linearity in our results at low doses Based on the available literature, it can be suggested that the RBE for...
- 8
- 329
- 0
Báo cáo y học: "Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" docx
... collated the data and assisted with statistical analysis HM performed the statistical analysis and helped to draft the manuscript TO helped perform the statistical analysis and contributed to draft ... intervention because the study participants received no feedback after the test and the period between the assessment dates was rather long Another potential source of bias could be the fact that the GPs ... evaluation form [33] Study arm A and B All participants were asked to complete a further knowledge test about dementia management that was sent by post after six months as well as a feedback questionnaire...
- 10
- 418
- 0
báo cáo khoa học: " Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" potx
... collated the data and assisted with statistical analysis HM performed the statistical analysis and helped to draft the manuscript TO helped perform the statistical analysis and contributed to draft ... intervention because the study participants received no feedback after the test and the period between the assessment dates was rather long Another potential source of bias could be the fact that the GPs ... evaluation form [33] Study arm A and B All participants were asked to complete a further knowledge test about dementia management that was sent by post after six months as well as a feedback questionnaire...
- 10
- 346
- 0
Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot
... Bolton, Canada) Total nucleic acid was extracted from each specimen using the easyMag automated extraction system (bioMérieux, Montreal, Canada) as per the manufacturer's protocols To control for ... Combimatrix and Luminex testing, RY and AE carried out the Combimatrix testing, JB assessed assay design, SB analyzed the data and wrote the manuscript, SJD conceived the idea for the study References ... Bolotin S, De Lima C, Choi KM, Lombos E, Burton L, Mazzulli T, Drews SJ: Validation of the TaqMan Influenza A Detection Kit and a rapid Automated Total Nucleic Acid Extraction Method for the Detection...
- 3
- 246
- 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... (5' to 3'): β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... Lentivial production and flow cytometry The target sequences used for this study were: shRNACycT1: GCAGCGTCTTAACGTCTCA; shRNA-Control: GCTATAGCTGTTCTAGTTC Oligo-nucleotides containing the target ... GCCCT- http://www.retrovirology.com/content/3/1/32 GTCCATAGCCTCTACTG, cyclin T1 (forward) AACCTTCGCCGCTGCCTTC, cyclin T1 (reverse) ACCGTTTGTTGTTGTTCTTCCTCTC, Cdk9 (forward) AGCACCAACTCGCCCTCATC,...
- 16
- 178
- 0
Báo cáo y học: " A multi-center, randomized, double-blind, parallel, placebo-controlled trial to evaluate the efficacy, safety, and pharmacokinetics of intravenous ibuprofen for the treatment of fever in critically ill and non-critically ill adults" pdf
... maintaining the blind The study was double-blind with respect to the treatment assignment The patient, Investigator, and sponsor were blinded to the assigned treatment until all patients had completed the ... power for a χ2 test, at the significance level of = 0.05, to detect this same treatment difference approximately 37%) The data demonstrated are for the Intention to Treat population (ITT) Continuous ... contributions to the conception and design of the study, acquisition of data and the interpretation of data PM and PW drafted the manuscript and PM, JP, KG, PW and MA revised it critically for important...
- 13
- 369
- 0
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot
... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data ... Database and Database of Abstracts of Reviews of Effects We restricted the search to studies on adult human populations and used the Mesh, Embase and Cinahl thesaurus in addition to free text ... this meta-analysis) were not reported Where there was missing data or ambiguity of data presentation, attempts were made to contact the study author(s) to resolve these issues Search strategy and...
- 15
- 536
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... acquisition and analysis of data and participated in drafting and editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and ... In this way, being able to refine, adapt and create tools that are suited to the realities and contexts of PA programmes for the elderly, and that improve these programmes, is therefore important, ... leonel@dsi.uminho.pt Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt...
- 30
- 369
- 0
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?
... 1.Respect the person you talk to • 2.Listen, listen, listen and then speak • 3.Accommodate to the person you are talking to • 4.Take into account that you can be wrong • 5.Leave the space for others ... • a manager has to improve themselves and makes an effort to meet the employees’ expectation A good manager always put the interests of employees first .And the role of managers is to find the ... paperwork but the manager also very intoxicated with them If you're afraid to see them, please assign someone else to but you have to know way to manage them most effectively The best data processing...
- 16
- 1,351
- 1
The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products
... Salvia dominica Salvia fruticosa Salvia officinalis Salvia sclarea Satureja thymbra Thymus vulgaris Geraniaceae Apiaceae Apiaceae Lamiaceae Rutaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae ... citrates Foeniculum vulgare Laurus nobilis Lavandula officinalis Majorana siriaca Matricaria camomilla Mentha piperita M rotundifolia Apiaceae Apiaceae Poaceae Apiaceae Lauraceae Lamiaceae Lamiaceae ... dolabrata hondai which was found to have high bioactivity against the cockroach (Periplaneta fuliginosa), the mite (Dermatophagoids farinae), and the termite (Coptotermes farmosanus) (Asada et al.,...
- 20
- 483
- 0
The Greenhouse Gas Protocol: A Corporate Accounting and Reporting Standard pdf
... data input may not reasonably be applied to all past years or new data points may not be available for past years The company may then have to backcast these data points, or the change in data ... usage, material usage, waste and byproduct generation, and other material streams Using this data and the GHG Protocol calculation tools, Tata Steel generates two key long-term, strategic performance ... limitations in the measurement processes are made transparent, users of the information will understand the basis of the data and the trade off that has taken place I As an international, values-driven...
- 116
- 375
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25