what effect does the size of a plant s leaves have on the plant s transpiration rate
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... phosphate [15] According to its sequence, PhyK belongs to a group of phytases synthesized by plant- associated bacteria such as Xanthomonas campestris, Pseudomonas syringae and Erwinia carotovora ... of the substrate-free PhyK with substrate-free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate-free PhyK and the substrate-loaded AppA ˚ the averaged distance is only 1.87 A Distinct ... whereas AppA undergoes a distinct conformational change upon substrate binding Classification of HAPs Induced conformational changes upon substrate binding For a detailed structural superposition, lsqman...
- 13
- 766
- 0
On Estimating the Size of a Statistical Audit potx
... is now also available; there is also a nice associated audit size calculation utility on a web site [7] Stanislevic [11] also examines the issue of choosing a sufficient audit size; he gives a ... situation; the math is the same We assume that we are in an adversarial situation, where an adversary may have corrupted some of the objects For example, the adversary might have tampered with the ... replacement, instead of sampling with replacement, so a sample size derived by assuming sampling with replacement is going to be an overestimate—in some cases a serious overestimate Nonetheless the...
- 20
- 274
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ ... efficiencies than CA with the modified proteins, were analysed in catalytic assays Metabolism of alternate substrates The metabolism of CA analogues was assayed with the N302, I371 and K484 mutants (Table ... I37 1A I371K K484M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢...
- 12
- 380
- 0
in what ways and to what effect did the british cinema of the second world war mobilize support for th
... being a historical representation, and Shakespeare play, was worthy of note 'The success of Henry V challenges the assumption [ ] that documentary style realism is the sole criterion of propaganda ... loved ones and the very real temptation of extra-marital affairs Whilst the Ministry of Information were not unaware of these issues they wanted to maintain an image of strength These problems could ... individual possessed The situations presented were, at last, 'real' and not distortions of the truth as had been previously depicted The characters had a sense of power and ability despite their background...
- 4
- 433
- 0
Báo cáo hóa học: " Mechanics of lipid bilayer junctions affecting the size of a connecting lipid nanotube" pptx
... templates for nanoscale conduits and networks Science 1996, 273:933-935 Karlsson A, Karlsson R, Karlsson M, Cans A, Strömberg A, Ryttsén F, Orwar O: Networks of nanotubes and containers Nature ... junctions by simple geometrical shapes and express the free elastic energy of the membrane in terms of the length of the LNT, its radius, the radius of the junction and the tension of the membrane Variation ... theory, and applications Biophys J 2005, 88:2714-2726 15 Karlsson M, Sott K, Cans A, Karlsson A, Karlsson R, Orwar O: Micropipetteassisted formation of microscopic networks of unilamellar lipid bilayer...
- 6
- 226
- 0
Báo cáo toán học: "Towards the Distribution of the Size of a Largest Planar Matching and Largest Planar Subgraph in Random Bipartite Graphs" ppt
... is an elaboration on her/his suggestions 1.3 Models of Random Graphs: From k-regular Multi–graphs to Permutations Most work on random regular graphs is based on the so called random configuration ... detailed account of these results, history and related work see the surveys of Aldous and Diaconis [AD99] and Stanley [Sta02] 1.1 Main Results In this article we establish combinatorial identities which ... For example, if one allows them to be weakly increasing This is equivalent to asking for the distribution of the size of a largest planar subgraph, i.e the largest set of non–crossing edges which...
- 20
- 315
- 0
Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx
... purposes these calculations are considerably shorter as the oppositeness relation can be directly associated with the dual polar graph The dual polar graph is distance-regular and hence we readily ... Bose and T Shimamoto Classification and analysis of partially balanced incomplete block designs with two associate classes J Amer Statist Assoc., 47:151– 184, 1952 [4] A E Brouwer, A M Cohen, and ... In particular, the valency of i the oppositeness graph Γd+1 is q (d+1)(d+2+2ǫ)/2 Calculation of a specific subset of eigenvalues of the association scheme The eigenvalues of the dual polar graph...
- 6
- 327
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... databases, and 2) International Medication System (IMS) Because Turkey is an inflation country we have escalated all antibiotic prices The cost of antibiotics was calculated as US dollars (USD) ... consumption calculated by two-tailed Spearman s coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the ... many of the restricted antibiotics was decreased and the trend of resistance rates became downwards after implementation of NARP The amount of money saved increased further After two years of...
- 6
- 692
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... measurements the concentration of pro-protease has been used in the calculations because once the proteases are autocatalytically activated as described above, it is difficult to isolate the active ... domain and is > A when the extension is on its own The fluctuation in the radius of gyration was also analyzed (Fig 6B) as a measurement of the overall stability of the CT-extension for both forms These ... intervals for 10 each and then immediately chilled on ice The activity of the proteases was measured at 65 °C (optimum temperature of activity for the proteases) against azocasein as substrate, as...
- 13
- 759
- 0
Tài liệu Ecology and Management of a Forested Landscape Fifty Years on the Savannah River Site pptx
... and probably concentrated along bottomlands and terraces adjacent to streams (Sassaman et al 1990; Sassaman 1993) Sustained seasonal habitation of the area began between 9,800 and 8,000 years ... of the area The SRS manages its forests on a far longer rotation length than most managed lands in the Southeast Thus, the vast majority of the land area of SRS has suffered relatively minimal ... Terrestrial snakes associated with xeric upland habitats and mesic floodplain habitats on the Savannah River Site 212 Figure 4.19 Aquatic snakes associated with stream systems and Carolina bays on...
- 513
- 1,719
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... interpersonal skills, information provision, and availability; the nurses’ technical skills, interpersonal skills, information provision, and availability; the other hospital staff s interpersonal skills ... local situation as was suggested by Ganz [19] A subgroup of gynecologists, oncology nurses, a radiotherapist, a medical oncologist, as well as a general practitioner and a few patients adjusted ... participants on the other hand are unaware of the group assignment, as they are under the assumption that the hospital is providing usual care Intervention versus usual care Usual care: The health care provider...
- 8
- 786
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... Aspergillus niger and A awamori prefer longer malt-oligosaccharides as substrates, which is also the case for S fibuligera glucoamylases [15] The determination of the crystal structure of recom˚ binant ... in the ability to digest raw starch While Glu adsorbs to, but does not digest raw starch, Glm adsorbs well to starch granules and is capable of raw starch digestion The glucoamylases from Aspergillus ... al site, one acting as general acid and the other as general base [24] The mechanism of hydrolysis consisting of three steps involves proton transfer to the glycosidic oxygen of the scissile bond...
- 11
- 548
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
... c-glutamyl hydroxamate as standard Control assays were performed in the absence of ATP to ensure that the reaction was dependent on ATP Nitrate reductase (NR) was assayed in a total volume of 100 ... (Table 3) These findings suggest that the NR/GS inhibitor functions during both the assay preparation and the assays by converting the cofactors necessary for the NR or GS reactions into AMP Consistent ... percent of the amount of NADH used in our standard NR assay, and 60% of the amount of ATP in a GS assay, was converted into AMP within 10 at 30 °C by an amount of a Mono Q fraction that appeared...
- 7
- 457
- 0
A naturalist in Brazil; the record of a year''''s observation of her flora, her fauna, and her people pptx
... the Swiss Alps I have seen few landscapes which so insistently preach the gospel of becoming as the mountains of Guanabara Bay Just as some pictures are so vividly painted as to give the spectator ... clouds the slanting rays of the sun ; pour down upon sea and coast The city yonder takes plastic shape as we look above the house-fronts rises a forest of towers and steeples to the right gleams the ... by the much smaller State of Espirito Santo Voyaging along the coast, one enters the new State as through an inlet ; for abreast of the frontier waters of the of Bahia and Espirito Santo the Abrolho...
- 472
- 368
- 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
... NPR -A also appears to regulate fatty acid mobilization [5] NPR -A is a phosphoprotein that contains 1029 amino acids and migrates as a band of % 125 kDa molecular mass under reducing SDS ⁄ PAGE ... undergoes desensitization, which correlates with a loss of phosphate content in the KHD It is suggested that dephosphorylation of the KHD by distinct protein phosphatases [17] occurs as a consequence ... log-transforms for all experiments Finally, antilogs of the corrected log transforms were obtained and used for further testing Statistical analysis was performed by analysis of variance (anova),...
- 12
- 338
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... also a single nonsense mutation leading to insertion of the TAA stop codon in exon of one of the vaspin A chain genes of V a zinnikeri (data not shown) These four clones are inactive The existence ... intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like...
- 10
- 451
- 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... IL, USA) was used for all statistical analyses A P value < 0.05 was considered to be statistically significant The results are reported as mean ± SD values Table 1: Baseline characteristics of ... terminated if participants developed severe dyspnea, dizziness, or chest pain, or had an abnormal heart rate response Expired gases were analysed every seconds using an automated online gas analyser ... cardiovascular risk profile, while assessing whether it remains successful at ensuring exercise adherence It appears that supervision and progression of the exercise programme may influence adherence...
- 10
- 662
- 0
Báo cáo y học: " Axial torsion as a rare and unusual complication of a Meckel’s diverticulum: a case report and review of the literature" ppsx
... this variant The etiology of axial torsion of MD remains unclear On the basis of the available literature, we have identified several risk factors Although primary neoplasms arising within MD is ... with a normal appearance of the rest of the bowel and viscera The twisted Meckel s diverticulum was resected along with an cm flange of ileum Discussion This case report presents the unusual case ... within MD, such as lipomas, have also been recognized as a potential cause of torsion [12] Complications associated with this presentation include intussusception, with the tumor as the lead point,...
- 4
- 441
- 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf
... although laparoscopy was shown to have a diagnostic accuracy of 96.9%, a significant number of cases still required conversion for their subsequent management Based on the above literature and the ... terminal ileum and the anastomosis over sewn with continuous 3/ sutures The small bowel was then decompressed and the content milked gently into the stomach before being aspirated via the nasogastric ... Suffolk Hospital with a 3-day history of abdominal pain, vomiting, absolute constipation and abdominal distension The abdominal pain initially started as a dull generalised discomfort, but later...
- 5
- 311
- 0
Báo cáo y học: " The effects of a commercially available botanical supplement on strength, body composition, power output, and hormonal profiles in resistance-trained males" docx
... data are presented as means ± standard deviations All statistical procedures were analyzed using SPSS (Statistical Package for Social Science) version 16.0 Results Medical Monitoring, Dietary Analysis, ... increased in cross sectional area, the possibility exists that a strength increase accompanied this adaptation, even though there were no strength measurements assessed in this study The results ... cross sectional area of muscle fibers There is a direct relationship between a muscle s cross sectional area and overall strength of that particular muscle [40] Therefore, if the levator ani muscle...
- 9
- 568
- 0
- complete what effect does the no cdp enable command have
- how does the size of a vibrating surface affect the pitch of its sound
- what effect does the time of day have on passive solar heating
- what effect does salt concentration have on the specific heat of an aqueous salt solution
- what effect does triangle size have on the strength of a truss bridge
- what effect does the concentration of a mordant have on the colorfastness of a natural dye
- what effect does the ph of food have on preventing tarnish on copper pots
- what effect does the type of video game have on blood pressure
- what effect does the type of ground cover have on the rate of soil erosion
- what effect does temperature have on the amount of solute needed to prepare a saturated solution
- what effect does the type of flour have on the ability of calcium propionate to inhibit bread mold
- what effect does the position of artificial light have on plant growth
- what effect does a glucose solution have on the longevity of cut flowers
- what effect does the color of light have on phototropism
- what effect does the physical form of a fertilizer have on plant growth
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25