... phản ứng sau : n + 92 U → 53 I + 39 Y +30 n Khối lượng hạt tham gia phản ứng: mU = 23 4, 9 933 2u; mn = 1,0087u; mI = 138 ,8970u; mY = 93, 89014u; uc2 = 931 ,5 MeV Nếu có lượng hạt nhân U 2 35 đủ nhiều, ... 22 : Một vật dao động theo phương trình x = 20 cos( A ω1 = 2 Z L1 Z C1 B ω1 = 2 Z C1 Z L1 C ω1 = 2 Z L1 Z C1 D ω1 = 2 Z C1 Z L1 23 5 139 94 Câu 24 : Biết đồng vị urani U 2 35 bị phân hạch theo ... Trang 3/ 6 - Mã đề thi 35 7 5 π ) A B i2 = 2 cos(100πt + ) A 12 π 5 C i2 = cos(100πt + ) A D i2 = 2 cos(100πt + ) A 12 Câu 31 : Một lắc lò xo treo trần thang máy Khi thang máy đứng yên lắc dao...
... 10.1 126 /science.1 141 038 Greenland and Antarctica vary together from glacial to interglacial, but are out of phase during the abrupt climate changes ofthe last glacial period Abrupt climate changes in Greenland are ... climates and warmings? 22 References Alley, R.B 20 04 GISP2 Ice Core Temperature and Accumulation Data IGBP PAGES/World Data Center for Paleoclimatology Data Contribution Series #20 04- 0 13 NOAA/NGDC ... (20 01) Atmospheric CO2 Concentrations over the Last Glacial Termination Science, 29 1 (55 01), 1 12 1 14 doi:10.1 126 /science .29 1 .55 01.1 12 23 MIT OpenCourseWare http://ocw.mit.edu 12. 34 0 Global Warming...
... fluorescence at 3 42 nm (Fig 2) The apparent equilibrium dissociation constant of Na+ binding was calculated using a single site binding equation and was 22 .0 ± 1 .5 and 24 ± 2. 6 mm for WT and DK9 thrombins, ... residues, located at the boundary between the A- and B-chains and interacting with Arg 137 via three water structural molecules having low mobility (w 32 1 , w 32 5 , and w4 54 ) [ 12] , have been shown ... drawn according to the best-fit parameters values of Eqns (2 4) and listed in Table The vertical bars are the standard errors ofthe determinations 160 FEBS Journal 27 3 (20 06) 159 –169 ª 20 05 FEBS...
... create a new label, we look for the Display Widgets group (at the bottom ofthe box) and pull the Label entry onto the dialog via drag and drop Figure 3 .2: The dialog contains the first widgets 82 3. 1 ... creating complex dialogs and layouts You can add widgets in the Designer via drag and drop and set their properties For example, you can change the text ofa QLabel or its color and typeface ... function calls and thus identify passages in the source code that are to be translated Figure 1. 12: The Qt Linguist enables applications to be translated into other languages 50 1 .5 Qt at a Glance...
... we call the new slot manually so that the label can obtain an initial status After we have entered updateStats() as a slot in the class declaration of MainWindow, we must now find a way of having ... point of view is again a “black box.” The crucial difference is in the declaration ofthe class We declare the class generated by uic as a private member ofa QDialog subclass This allows for abitrary ... allows the basic graphical framework of most applications to be put together “by mouse click” in Qt versions 4. 1 and later The basis of this is the QMainWindow Qt class 4. 1 The Anatomy ofthe Main...
... 18 Activity 3 .2: Identifying Sourcesof Information Exercise 1: Identifying Sourcesof Information ! Develop a list ofsourcesof information Review the information in the Ferguson and Bardell, ... Ferguson and Bardell, Inc case study In the following table, list examples for each source of information You will discuss your results in a class discussion Sources Examples Artifacts Systems People...
... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5 -CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC -3 and its complement for His6Ala; 5 -GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC -3 and ... Hasegawa Y, Zhang H & Liu A (20 06) a- Amino-b-carboxymuconic-e-semialdehyde decarboxylase (ACMSD) is a new member ofthe Human ACMSD 22 23 24 25 26 27 28 29 30 31 32 amidohydrolase superfamily...
... Functions and Features The C2COM -2 and C2COM -3 RS - 23 2/ 42 2 /48 5 expansion cards provide RS - 23 2, RS- 42 2 , or RS -48 5 serial communication for a Crestron® 2- Series control system (PRO2, RACK2, PAC2, or AV2 ... (CTS) RS - 23 2 Clear to Send (TXD-) RS- 42 2 Transmit Data (Idles low) To C2COM -2/ 3 From C2COM -2/ 3 From C2COM -2/ 3 Ground To C2COM -2/ 3 From C2COM -2/ 3 To C2COM -2/ 3 From C2COM -2/ 3 *RS- 42 2 transmit and receive ... the IBM PC AT connector except for the RS 42 2 signals on pins 1, 4, 6, and Operations & Installation Guide - Doc 81 92 2-Series RS - 23 2/ 42 2 /48 5 Expansion Cards: C2COM -2/ 3 • 2- Series RS - 23 2/ 42 2 /48 5...
... from the Y 14. 5. 1 standard directly into their software We are not yet aware ofthe actual extent of usage ofthe mathematical tolerance definitions from the Y 14. 5. 1 standard among CAE software ... T andA , anda radius r such that all ofthe points ofthe v actual feature consist ofa subset of these points P , then the feature meets the cylindricity tolerance 7 .4. 5 .3 Flatness A flatness ... Requirement 9 .2. 2 Gap ≥ 0 05 Gap ≥ Gap ≥ 20 0 Gap ≥ Gap ≥ and ≤ 020 Loop Diagram The loop diagram is a graphical representation of each analysis Each requirement requires a separate loop diagram Simple...
... 10. 43 1 10 .30 3 10 .29 34. 641 8 4. 54 9 54. 43 6 7 4. 43 8 54. 031 9 3. 97 053. 956 7 E' and U are the modulus of elasticity and Poisson's ratio Coating material properties are used for E2 and u2 because coating ... rnl at T1 and m2 at T2 (where T1 and T2 are absolute temperature, say, K = 27 3. 16 "C, ml and m2 are kinematic viscosity in centi9 + + 30 4 Chapter 19 20 21 22 23 7.9 stokes), substitute ml, T l and ... 28 1 RollinglSliding Contacts Table 7 .3 Values ofaand b for Some Commonly Used Lubricant Oils Oil SAE 10 SAE 20 SAE 30 SAE 40 SAE 50 SAE 60 SAE 70 b a ~~ ~ 11.768 11 .5 83 11 . 35 5 I 1 .39 8 10. 43 1 ...