Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism Lisa Pucci*, Silvia Perozzi*, Flavio Cimadamore, Giuseppe Orsomando and Nadia Raffaelli ` Istituto di Biotecnologie Biochimiche, Universita Politecnica delle Marche, Ancona, Italy Keywords ACMSD; NAD biosynthesis; picolinate; quinolinate; tryptophan catabolism Correspondence N Raffaelli, Istituto di Biotecnologie ` Biochimiche, Universita Politecnica delle Marche, Via Ranieri, 60131 Ancona, Italy Fax: +39 712204677 Tel: +39 712204682 E-mail: n.raffaelli@univpm.it *These authors contributed equally to this paper (Received 16 November 2006, accepted December 2006) doi:10.1111/j.1742-4658.2007.05635.x 2-Amino 3-carboxymuconate 6-semialdehyde decarboxylase (ACMSD, EC 4.1.1.45) plays a key role in tryptophan catabolism By diverting 2-amino 3-carboxymuconate semialdehyde from quinolinate production, the enzyme regulates NAD biosynthesis from the amino acid, directly affecting quinolinate and picolinate formation ACMSD is therefore an attractive therapeutic target for treating disorders associated with increased levels of tryptophan metabolites Through an isoform-specific real-time PCR assay, the constitutive expression of two alternatively spliced ACMSD transcripts (ACMSD I and II) has been examined in human brain, liver and kidney Both transcripts are present in kidney and liver, with highest expression occurring in kidney In brain, no ACMSD II expression is detected, and ACMSD I is present at very low levels Cloning of the two cDNAs in yeast expression vectors and production of the recombinant proteins, revealed that only ACMSD I is endowed with enzymatic activity After purification to homogeneity, this enzyme was found to be a monomer, with a broad pH optimum ranging from 6.5 to 8.0, a Km of 6.5 lm, and a kcat of 1.0 s)1 ACMSD I is inhibited by quinolinic acid, picolinic acid and kynurenic acid, and it is activated slightly by Fe2+ and Co2+ Site-directed mutagenesis experiments confirmed the catalytic role of residues, conserved in all ACMSDs so far characterized, which in the bacterial enzyme participate directly in the metallocofactor binding Even so, the properties of the human enzyme differ significantly from those reported for the bacterial counterpart, suggesting that the metallocofactor is buried deep within the protein and not as accessible as it is in bacterial ACMSD In mammals, tryptophan exceeding basal requirement for protein and serotonin synthesis, is oxidized via indole-ring cleavage through the kynurenine pathway, consisting of several enzymatic reactions leading to 2-amino 3-carboxymuconate 6-semialdehyde (ACMS) (Fig 1) [1,2] ACMS can be decarboxylated to 2-aminomuconate 6-semialdehyde (AMS) by the enzyme ACMS decarboxylase (ACMSD, EC 4.1.1.45), or it can undergo spontaneous pyridine ring closure to form quinolinate, an essential precursor for de novo NAD synthesis AMS can be routed to the citric acid cycle via the glutarate pathway, or converted nonenzymatically to picolinate By catalyzing ACMS decarboxylation, ACMSD thus diverts ACMS from NAD synthesis, channeling tryptophan towards complete oxidation or conversion to picolinate By determining picolinate and quinolinate formation, ACMSD directly participates in the cellular processes regulated by these molecules Quinolinate is a neurotoxic tryptophan metabolite, whose action has been ascribed to N-methyl-D-aspartate receptors activation and to its ability to generate free radicals Abbreviations ACMS, 2-amino 3-carboxymuconate 6-semialdehyde; ACMSD, ACMS decarboxylase; AMS, 2-aminomuconate 6-semialdehyde FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 827 Human ACMSD L Pucci et al Fig Schematic overview of tryptophan catabolism through the kynurenine pathway [3,4] This neurotoxicity might play an important role in the pathogenesis of major neurodegenerative and convulsive disorders In particular, many of the distinct neuropathological features of Huntington’s disease are duplicated in experimental animals by intrastriatal quinolinate injection [5,6] In addition, a significant elevation of quinolinate levels has been observed in low-grade Huntington’s disease brains, suggesting that the molecule might participate in the initial phases of the neurodegenerative process [7] Moreover, a role of quinolinate in the pathogenesis of AIDS–dementia complex, as well as Alzheimer’s disease, has been very recently proposed [8,9] In turn, picolinate exhibits important immunomodulatory properties, involving activation of macrophage tumori828 cidal, microbicidal and proinflammatory functions [10– 12] This metabolite also stimulates apoptosis in various transformed cell lines, and efficiently interrupts the progress of human HIV-1 in vitro [13,14] Although the physiological relevance of picolinate formation in vivo is not known, it has been detected in human milk, pancreatic juice, intestine and in the serum of patients with degenerative liver diseases [15–17] In addition, high levels have been measured in the cerebrospinal fluid of children with cerebral malaria and in the brain of a murine model of the syndrome [18,19] Interestingly, picolinate is reportedly able to prevent the neurotoxic effects of quinolinate in the rat central nervous system, suggesting that a highly regulated production of these metabolites is required for FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al normal neuronal function [20] Such considerations indicate that ACMS decarboxylation is a key metabolic control step and that the enzyme catalyzing this reaction is likely to be a drug target [21] Mammalian ACMSD has been purified and characterized from cat, hog and rat [22–24], where it is present only in kidney, brain and liver Several studies have demonstrated that in rats, nutritional factors and hormones affect both gene expression and enzymatic activity In particular, the enzyme is down-regulated by dietary polyunsaturated fatty acids, phthalate esters and peroxisome proliferators, like clofibrate, whereas it is up-regulated in rats fed a high protein diet [25–28] mRNA expression and enzymatic activity are elevated in the liver of streptozotocin-induced diabetic rats, and insulin injection suppresses such elevation [29] These studies clearly demonstrated that changes in ACMSD activity are readily reflected by serum and tissue quinolinate levels and in the rate of tryptophan-to-NAD conversion Rat liver ACMSD gene expression is regulated by the two transcriptional factors: hepatocyte nuclear factor 4a (HNF4a) and peroxisome proliferator-activated receptor a (PPRa); the former activates ACMSD expression directly by site-specific binding to the promoter, and the latter represses ACMSD expression indirectly through suppression of HNF4a expression [30] The presence of ACMSD has been recently demonstrated in bacteria species that fully catabolize tryptophan or 2-nitrobenzoic acid [31,32] The biochemical and structural characterization of Pseudomonas fluorescens ACMSD revealed that the enzyme is metaldependent and catalyzes a novel type of nonoxidative decarboxylation [21,33–35] The human gene has been identified upon expression in COS7 cells of a cDNA from a brain library, encoding the human homologue of the rat protein [36] Recently, a cDNA sequence from a liver library, deriving from alternative splicing of the gene, has been deposited in GenBank In this study, we have demonstrated the constitutive expression in human organs of the two alternatively spliced ACMSD transcripts The corresponding cDNAs have been cloned in yeast expression vectors, allowing for the first time the purification and biochemical characterization of human ACMSD Results Cloning of ACMSD transcripts The complete coding sequence of human ACMSD was obtained from reverse-transcribed human kidney Human ACMSD RNA, by using the primers pair 1fw ⁄ 11rev, encompassing the ACMSD open reading frame (GenBank accession number Q8TDX5-1) (Fig 2A; Table 1) Agarose gel electrophoresis of the PCR product indicated the presence of two distinct bands between 1000 and 1100 bp of roughly the same extent (not shown) Cloning and nucleotide sequencing of these two products indicated that the lower band (1011 bp) corresponded to the expected cDNA (here named ACMSD I), while the higher band (1068 bp) corresponded to the cDNA currently in GenBank under accession number AAH16018 (here named ACMSD II) ACMSD II coding sequence was obtained by using the primers pair 4fw ⁄ 11 rev (Fig 2A) Again, two distinct PCR products were obtained, the longer (887 bp) corresponding to part of the ACMSD I cDNA, the shorter (837 bp) representing ACMSD II open reading frame (not shown) The two transcripts are produced by alternative splicing of exons and of the ACMSD gene (Fig 2A); the presence of exon in ACMSD II causes a shift in the open reading frame, resulting in the occurrence of the first available start codon in exon This, together with the absence of exon 5, gives rise to a ACMSD II protein, which differs from ACMSD I at the N-terminus (Fig 2B) Expression of ACMSD variants in Escherichia coli and Pichia pastoris ACMSD I and II cDNAs were subcloned into pET15b and pET32b E coli expression vectors, providing the recombinant proteins with a N-terminal His6-tag, and a thioredoxin-tag, respectively In both cases, proteins were expressed as inclusion bodies (not shown) Any effort to obtain soluble recombinant proteins, including lower growth temperatures (18 °C) and isopropyl b-D-1-thiogalactopyranoside concentrations (down to 0.1 mm), as well as inclusion of various metal ions in the growth medium during induction, were unsuccessful Expression in the methylotrophic yeast P pastoris was performed both via secretion and intracellularly, as described in Experimental procedures Both isoforms were secreted by yeast cells transformed with the pPIC9 recombinant plasmids (Fig 3); however, when ACMSD activity was assayed in the culture media, the enzymatic activity was only detected in media containing isoform I Both isoforms were also expressed intracellularly, as evidenced by the appearance of protein bands of the expected size upon SDS ⁄ PAGE analysis of the crude extracts prepared after days methanol induction (not shown) Again, only isoform I was endowed with enzymatic activity FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 829 Human ACMSD L Pucci et al A B Fig Alternative splicing of human ACMSD gene (A, upper panel) Genomic structure of the ACMSD gene with the alternative splicing patterns Exons are indicated by boxes and introns by connecting lines The approximate locations of the oligonucleotide primers used in the preparation of the cDNAs are shown by bold arrows (see Table for sequences) (A, lower panel) Representation of full length ACMSD I and ACMSD II mRNAs Open reading frames are underlined and the localization of the primers pairs and probes used for real-time PCR assays is also showed (see Table for sequences) (B) Alignment of the not conserved N-terminal regions of the two isoforms Alignment was carried out using the CLUSTALW program Fully conserved and similar residues are indicated by asterisks and colon, respectively Table Oligonucleotide primer sequences fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC In light of the recent findings that P fluorescens ACMSD requires a metal-ion cofactor and is able to take up the metal from the expressing host during protein synthesis [21,33], we investigated whether the 830 Fig ACMSD I and ACMSD II extracellular expression Tricine SDS ⁄ PAGE of the culture filtrates of the best expressing clones obtained by transformation of P pastoris GS115 cells with pPIC9ACMSD I (A) and pPIC9-ACMSD II (B) Culture filtrates were analyzed after 104 h (lane a) and 128 h (lane b) methanol induction Arrows indicate the recombinant isoforms Lane M, molecular mass standards production of the human recombinant isoforms might be enhanced by the presence of metal ions in the growth medium We found that addition of 200 lm to mm CoCl2 during methanol induction did not result in a significant increase of ACMSD I specific activity, and no activity was detected in the extracts prepared from cells expressing the other isoform FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al Human ACMSD 10 000-fold molar excess of ACMSD II and the same result was obtained when detection of ACMSD II was performed in the presence of ACMSD I The expression levels of ACMSD alternative transcripts in the organs we have examined are reported in Fig ACMSD I transcript was present in all tested organs, with an expression ratio of 1300 : 30 : in kidney, liver and brain, respectively Interestingly, ACMSD II was not detected in brain, while no significant difference in the relative expression of the two isoforms within kidney and liver was observed ACMSD I purification and characterization Fig Quantitation of ACMSD variants by real-time PCR Tissues RNA was reverse-transcribed and ACMSD variants were quantitated as described in Experimental procedures, using the primers ⁄ probe sets reported in Table Data are the mean of three independent experiments and are presented as copies of the target variant per 109 copies of 18S RNA Quantitation of ACMSD variants in liver, kidney and brain An isoform-specific real-time PCR assay was performed to analyze the expression pattern of the two transcripts in brain, kidney and liver A hybridization probe overlapping exon and exon was designed (T1), which is able to anneal to both variants (Fig 2A) Specific amplification was achieved by using the same reverse primer (10rev), located in exon 10, with ⁄ 3fw primer, spanning the boundaries of exons and 3, for ACMSD I, and 2fw, located in exon 2, for ACMSD II To assess the specificity of the assay, linearized pGEM plasmids harboring the two cDNAs were used as templates in control real-time PCR experiments Each isoform was subjected to amplification with the specific primer ⁄ probe set in the presence of increasing molar amounts of the other isoform (1 : 1, : 1000 and : 10 000) Detection of ACMSD I was not influenced by the presence of up to Recombinant human ACMSD I was purified to homogeneity from P pastoris cells transformed with the pHIL-D2-ACMSD I plasmid, by the purification procedure described in Experimental procedures and summarized in Table The final preparation was stable for several weeks when stored at °C, whereas the purified protein was sensitive to freezing at both )20 °C and )80 °C SDS ⁄ PAGE of the pure protein revealed a molecular mass of about 40 kDa, as expected for the recombinant enzyme (Fig 5) Gel filtration experiments showed a native molecular mass of about 50 kDa, indicating that the enzyme might exist as a monomer in solution (not shown) ACMSD I had an optimum pH ranging from 6.5 to 8.0 (Fig 6) The activity was significantly affected by the concentrations of the buffers used at pH values below 6.5, being markedly lower in the presence of 50 mm buffers, rather than mm at the same pH values (Fig 6) As shown in Table 3, the pure enzyme was fully active in the absence of metal ions, being slightly activated by Co2+ and Fe2+, whereas Zn2+, Cd2+ Cr3+ and Fe3+ strongly reduced the enzymatic activity Human ACMSD I exhibited a linear kinetic behavior, with Km for ACMS of 6.5 lm, Vmax of 0.105 mm s)1 and kcat of 1.0 s)1 (Fig 7) To identify possible enzyme modulators, we examined the effect of several NAD biosynthetic pathway intermediates on the human enzyme activity We found that NAD, nicotinate adenine dinucleotide, nicotina- Table Purification of recombinant human ACMSD I Step Total proteina (mg) Total activityb (units) Specific activity (unitsỈmg)1) Yield (%) Purification (-fold) Crude extract Streptomycin sulfate Hydroxyhapatite MonoQ 305 102 23.4 0.36 1.9 2.0 1.2 0.5 0.006 0.019 0.051 1.39 100 100 63 31 – 3.26 8.5 231 a Starting from 400 mL yeast culture bThe enzymatic activity was assayed spectrophotometrically, as reported in the Experimental procedures FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 831 Human ACMSD L Pucci et al Table Influence of metal ions on human ACMSD I activity Metal ion None Mg2+ Mn2+ Zn2+ Ni2+ Ca2+ Fe3+ Fe2+ Co2+ Cr3+ Cd2+ Concentration (mM) Relative activity (%) – 1.0 1.0 0.1 1.0 1.0 0.1 0.1 1.0 0.1 1.0 0.5 0.5 100 100 100 100 100 15 124 90 120 130 35 25 Fig Purification of recombinant human ACMSD I Tricine SDS ⁄ PAGE of fractions throughout the purification procedure: crude extract (lane a), hydroxyhapatite (lane b), MonoQ (lane c) Lane M, molecular mass standards Fig Effect of pH on ACMSD I activity The enzymatic activity was measured at different pH values in 50 mM (h) and mM (j) sodium succinate, 50 mM (s) and mM (d) Mes, 50 mM 4-morpholinepropanesulfonic acid (m), 50 mM Hepes (r) and 50 mM Tris ⁄ HCl (e) buffers Activity was determined as described in Experimental procedures mide, nicotinic acid, nicotinamide mononucleotide, nicotinate mononucleotide, tryptophan (present at mm concentration in the reaction mixture), and l-kynurenine and 3-hydroxykynurenine (present at 0.1 mm concentration) were without effect On the other hand, a significant inhibition was exerted by quinolinic acid, picolinic acid and kynurenic acid, as shown in Table Bacterial and human ACMSD share a high sequence identity, particularly with respect to the residues (i.e His9, His11, His177 and Asp294) known to be involved in metal binding in P fluorescens ACMSD (Fig 8) To confirm that these residues are essential for the human enzyme activity, we performed site832 Fig Lineweaver)Burk analysis of ACMSD I The reciprocal of the initial velocities was plotted against the reciprocal of ACMS concentrations Data are the means of three independent determinations Table Influence of tryptophan catabolites on human ACMSD I activity Compound Kynurenic acid Quinolinic acid Picolinic acid Concentration (mM) Relative activity (%) 0.5 1.0 0.5 1.0 0.25 0.5 1.0 67 59 72 61 80 58 47 directed mutagenesis experiments on human ACMSD I to replace His6 and His8 individually with alanine Mutated proteins were expressed in P pastoris cells at a level comparable with that of the wild-type enzyme FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al Human ACMSD Fig Alignment between human (Hs) and P fluorescens (Psf) ACMSD Residues involved in metal binding in the bacterial enzyme are highlighted in shaded boxes Residues subjected to mutational analysis in the human enzyme are indicated by # (not shown) and, as expected, exhibited a significantly lower catalytic activity In particular, the activity decreased by about 82% and 50% for His6Ala and His8Ala, respectively, indicating that the mutated residues are critical for catalysis The human enzyme is active in the absence of added metal-ions in the reaction mixture, suggesting that it might be able to take up the metal from the expressing host during protein synthesis This property was previously demonstrated for bacterial ACMSD, however, while the bacterial enzyme can be obtained in the inactive, metal-free form upon incubation with mm EDTA for 12 h at °C [21,33], human ACMSD retained full activity in the same conditions Incubations at EDTA concentrations higher than 10 mm (i.e 20 mm and 50 mm) only resulted in 50% loss of the decarboxylase activity Moreover, unlike the P fluorescens ACMSD apoprotein, which can be successfully reconstituted [21,33], catalytic activity of the human enzyme was not regained upon removal of EDTA and addition of metal-ions Figure shows the hydrophobicity profiles of human and P fluorescens ACMSD, performed according to Kyte and Doolittle [37] By comparing the mean A Fig Hydrophobicity profiles of human (A) and P fluorescens (B) ACMSD The profiles were computed according to Kyte and Doolittle [37], using a window size of 7, suitable for discriminating between buried and surface exposed regions Residues involved in catalysis in the bacterial enzyme and the corresponding amino acids in the human protein are pointed with arrows The mean hydrophobicity values of residues within the window centered on the pointed amino acids are reported in brackets B FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 833 Human ACMSD L Pucci et al hydrophobic index of the residues within the window centered on amino acids involved in metal binding, it can be noticed that regions around His6 and His8 in the human protein are predicted to be more hydrophobic than the corresponding regions in the bacterial enzyme Likewise Arg47, whose corresponding residue in P fluorescens ACMSD (Arg51) is essential for catalysis and it has been hypothesized to directly participate in substrate binding [34], is located in a more hydrophobic region in human ACMSD Pseudomonas fluorescens ACMSD crystallographic structures have been used as the templates for the prediction of the human enzyme structure based on homology modeling As shown in Fig 10, the overall architecture of the human enzyme model is very similar to that of its bacterial counterpart In particular, the root-mean-squared deviations values calculated between the superimposed backbones of the human enzyme model and the crystallographic templates are ˚ all below A The residues that directly coordinate to A B C Fig 10 Homology modeling of human ACMSD I Prediction of the human enzyme structure (right) was made on the base of the crystal structure analysis of P fluorescens ACMSD (left), as described in Experimental procedures (A) Ribbon diagram of the two structures The arginine residue probably involved in substrate binding is marked by an asterisk, and the residues ligated to the metal ion cofactor (orange sphere) are shown in ball-and-stick representation (B) metal coordination centers (C) Molecular surface models Hydrophobic and polar residues are colored in blue and gray, respectively 834 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al the metal cofactor in the bacterial protein are conserved in the human model (Fig 10B) The molecular surface model of both proteins, shown in Fig 10C, confirm the higher hydrophobicity in human ACMSD of the region surrounding the metal active site and the Arg47 likely involved in substrate binding Discussion In this study, the expression of the human ACMSD transcript coding for the active enzyme has been examined in kidney, liver and brain The tissue distribution of the transcript closely resembles that of mouse ACMSD mRNA [36] The highest expression has been observed in kidney, suggesting that the tryptophanNAD pathway might not be the preferred route of tryptophan utilization in this organ Indeed, in kidney the kynurenine pathway is mostly used to convert tryptophan catabolites, including kynurenine and hydroxykinurenine taken up from the blood, to a series of metabolites which are then excreted [38] The presence of ACMSD suggests that tryptophan catabolites might also be channeled into the glutarate pathway towards complete oxidation High levels of the enzyme might prevent excessive formation and accumulation of quinolinate Indeed experiments performed on patients with renal insufficiency, as well as on rats with induced renal failure, showed a decrease of kidney ACMSD activity and significant elevation of quinolinate in serum, urine, cerebrospinal fluid and peripheral tissues [38–41] On the other hand, we found significantly lower levels of human ACMSD expression in liver and in brain than that observed in kidney, suggesting that in the former organs the tryptophan–NAD conversion might represent a relevant pathway Indeed, most of the intracellular NAD in liver is synthesized from the amino acid rather than from dietary niacin and the formed dinucleotide is the main vitamin source for extrahepatic tissues [42] Likewise, maintenance of brain NAD levels is of extreme importance, because NAD depletion is linked to neuronal damage Recent reports have demonstrated that reversal of NAD depletion can profoundly decrease ischemic brain damage and stimulation of NAD biosynthetic pathways prevents or delays axonal degeneration [43,44] The observed low levels of liver and brain ACMSD would allow tryptophan to be channeled towards NAD formation, thus guaranteeing adequate NAD supply Our work defines a reliable procedure for the expression and purification of the active recombinant ACMSD in good yield The purification method differs from that reported for other mammalian Human ACMSD ACMSDs, due to the rapid inactivation of the human enzyme both in the absence of salts and in the presence of high ionic strength (i.e NaCl or sulfate ammonium concentrations higher than 0.3 and 0.4 m, respectively) The subunit and native molecular weight values are comparable with those reported for all ACMSDs so far characterized, including the bacterial protein [23,24,34], and are consistent with the lack of a quaternary structure In contrast with the rat enzyme, which is mostly active at pH 6.0 [24], human ACMSD displays a broad pH optimum, ranging from pH 6.5–8.0 Like all ACMSDs [22–24,34], the human enzyme exhibits a very low micromolar-range Km for ACMS However, it shows a specific activity six times lower than that reported for the rat enzyme and a kcat value that is about 6.5 times lower than that calculated for the bacterial counterpart [24,34] The enzymatic activity is not significantly affected by the intermediates of the NAD biosynthetic pathways Given that the high concentrations required for inhibition by quinolinic acid, picolinic acid and kynurenic acid are far from the physiopathological levels of the tryptophan metabolites [8], these effects are unlikely to be of physiological significance However, it may be worth noting that the three inhibitory compounds share a COOH group on the C-2 of the pyridine ring This feature seems to be essential for ACMSD inhibition, since nicotinic acid, which differs from picolinic acid only in the position of the COOH group, was ineffective Very recently, the structural characterization of P fluorescens ACMSD has demonstrated that the bacterial enzyme requires a transition metal ion as cofactor (i.e Zn2+), thus representing a novel member of the metal-dependent amidohydrolase superfamily [21,34] Members of this superfamily employ a great variety of divalent metal ligands for catalysis and share a conserved metal binding site, suggesting common aspects in their catalytic mechanism [21] From the sequence alignment of human and bacterial ACMSD and the comparison of their three-dimensional structures, the presence of the metallocofactor in the human enzyme can be reliably predicted Indeed, in the present work, the essentiality in the human enzyme-catalyzed reaction of residues involved in metal binding in P fluorescens ACMSD has been confirmed by site-directed mutagenesis As expected, replacement of His6 and His8 with alanine in human ACMSD I resulted in a significant reduction of the decarboxylase activity Accordingly, ACMSD II isoform, which differs from ACMSD I in the first 24 residues at the N-terminus and lacks the two mutated histidines, is enzymatically inactive In contrast to FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 835 Human ACMSD L Pucci et al what observed for the bacterial enzyme, however, human recombinant ACMSD specific activity was not increased by the presence of divalent metal ions in the growth medium, during protein expression In addition, EDTA concentrations higher than those used for the preparation of the bacterial apoprotein were required to obtain a significant inactivation of the human enzyme, and we were not able to reconstitute the activity by using the treatment that successfully restored the bacterial protein [21,33] Interestingly, the same difficulty in stripping off the metallocofactor from the protein has been described for murine adenosine deaminase, a member of the amidohydrolase superfamily, which uses Zn2+ as cofactor and shares with ACMSD the same metal center configuration [34,45] The metal was inaccessible to chelators, and was not exchanged with solvent to any appreciable extent at neutral pH [45] Authors also reported a competitive inhibition by Zn2+ with respect to the substrate (Ki lm), suggesting that the cation might bind elsewhere within the enzyme active site and block adenosine binding [45] Accordingly, we found that 0.1 mm Zn2+ exerts a strong inhibitory effect on human ACMSD The presence of the metallocofactor in human ACMSD might also be inferred by our study on the enzyme pH dependence, showing that the increase of the concentrations of succinate and 4-morpholineethanesulfonic acid buffers at pH values below 6.5 significantly reduced the activity It can be hypothesized that these salts might chelate the metal and efficiently remove it from the protein at acidic pH Both the different sensitivity to EDTA, and the lower kcat value exhibited by the human protein with respect to the bacterial counterpart suggest that the active site is very well buried within the human protein, not so easily accessible as it is in the bacterial enzyme This conclusion is validated by the comparison of both the hydrophobicity profiles and the threedimensional structures of human and bacterial ACMSD, demonstrating that the region surrounding residues involved in catalysis is more hydrophobic in the human, rather than in the bacterial protein Finally, this study demonstrated the expression in kidney and liver of an alternatively spliced ACMSD transcript coding for a protein which differs from the other variant in the N-terminal region and carries an incomplete metal binding domain In particular, in this variant only two out of four residues which are directly involved in the metal cofactor binding are present Consistent with this structural deficiency is our finding that ACMSD II is catalytically inactive when overexpressed as recombinant protein Inspec836 tion of the residues which in ACMSD I mark the boundary of the predicted substrate-binding pocket, reveals that some of them are conserved in the inactive isoform (i.e Trp191 and Phe294) Even though the precise role of these active site residues has not been established, the possibility that ACMSD II might still be able to bind the substrate cannot be definitively ruled out If this would be the case, the metabolic relevance of the inactive isoform would be related to its capability of binding and sequestering a reactive intermediate like ACMS The results we have presented represent the first biochemical report on human ACMSD They may be instrumental in promoting the structural analysis of the protein, particularly with respect to developing therapeutic leads for treating disorders associated with increased levels of quinolinate and ⁄ or picolinate Experimental procedures PCR amplification and cloning of ACMSD isoforms Human brain, liver and kidney total RNA (Clontech Laboratories, Inc., Mountain View, CA, USA) was reverse transcribed in the presence of random primers, by using the First Strand cDNA Synthesis kit (Biotech Department Bio Basic Inc., Markham, Ontario, Canada) Transcripts encoding for the two splice variants were amplified by polymerase chain reaction (PCR) using specific primers, and kidney cDNA as the template PCR conditions were as follows: at 94 °C; 30 s at 94 °C, 30 s at 55 °C, at 72 °C for 30 cycles; 10 at 72 °C The reaction was performed in the presence of 0.5 pmolỈlL)1 of each primer, 200 lm dNTPs, mm MgCl2 and 0.025 unitsỈlL)1 Taq polymerase (Finnzymes, Espoo, Finland) The amplified PCR products were separated on a 2% agarose gel, bands were excised and purified by using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland) Purified DNA was subcloned into pGEM T easy vector (Promega, Madison, WI, USA) following manufacturer’s instructions and recombinant plasmids were sequenced Real-time PCR Real-time PCR was performed on a Corbett (Sidney, Australia) Rotor Gene RG 3000 TaqMan probe and primers were designed using the primer3 program Optimized amplification reactions contained 300 nm each primer, 400 nm probe, mm MgCl2, 200 lm dNTPs, 1.25 Units JumpStart Taq DNA polymerase (Sigma-Aldrich Corp., St Louis, MO, USA) and · of the provided buffer All PCR reactions were performed with one cycle of 94 °C for 60 s, followed by 45 cycles of 15 s at 94 °C and 60 s at 60 °C FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al The efficiency of the PCR method using different primer ⁄ probe sets was determined from the threshold cycle values obtained with 10-fold serial dilutions of linearized pGEM T easy vectors harboring the ACMSD variants Standard curves for 18S RNA were obtained using cDNAs from each organ All the calibration curves exhibited slopes ranging from 3.34 to 3.48, indicating comparable amplification efficiency The copy number of each variant in the unknown samples was determined from the calibration curves and data were normalized to the copy number of 18S RNA Expression of ACMSD isoforms in E coli pGEM-ACMSD I and pGEM-ACMSD II were digested with XhoI and Bpu1102I and cloned into pET-15b and pET-32b expression vectors The four constructs obtained were used to transform E coli BL21(DE3) cells for proteins production E coli cells harboring the recombinant plasmids were grown at 37 °C in Luria–Bertani medium, containing 100 lgỈmL)1 ampicillin After reaching an A600 of 0.3, cultures were shifted at 25 °C and expression was induced with mm isopropyl b-D-1-thiogalactopyranoside at an A600 of 0.6 Cells deriving from mL cultures were collected at different induction times and the pellets were resuspended in 100 lL of 20 mm Tris ⁄ HCl buffer, pH 8.0, mm MgCl2, mm dithiothreitol, mm phenylmethanesulfonyl fluoride Cells were disrupted by vortexing with glass beads (250 lm) four times for min, with intervals After centrifugation, the supernatants representing the soluble fractions and the corresponding pellets were analyzed by SDS ⁄ PAGE [46] Expression of ACMSD isoforms in P pastoris pHIL-D2 and pPIC9 vectors (Invitrogen, San Diego, CA, USA) were used for intracellular and extracellular expression, respectively; pGEM plasmids harboring ACMSD I, II were digested with EcoRI and the purified products were ligated into the expression vectors at the EcoRI site In the resulting constructs, correct inserts orientation and sequence were checked by automated sequencing Transformation of P pastoris GS115 competent cells with SalI linearized recombinant pPIC9 plasmids generated clones with a His+Mut+ phenotype Transformation of the same yeast cells with NotI linarized recombinant pHIL-D2 plasmids favored the alcohol oxidase structural gene displacement, allowing generation of His+MutS phenotype [47] PCR-positive His+Mut+ and His+MutS clones were cultured in buffered glycerol-complex medium, and for expression induction, cultures were transferred in buffered methanolcomplex medium and grown with daily methanol pulses, as described in [47] At different induction times, aliquots of the culture filtrate of His+Mut+ cells were subjected to SDS ⁄ PAGE analysis and ACMSD activity determination Human ACMSD The time course of ACMSD expression in His+MutS cells was monitored in the cells crude extracts, prepared by suspending cells collected from mL of the cultures, in 100 lL of 50 mm sodium phosphate, pH 7.4, 5% glycerol, mm phenylmethanesulfonyl fluoride, and disrupting them by vortexing with glass beads (0.5 mm) eight times for 30 s with 30-s intervals Site-directed mutagenesis Mutagenesis to change the selected residues to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and its complement for His8Ala (substituted nucleotides are underlined) pHILD2-ACMSD I was used as the template for the PCR mutagenesis reaction Mutants were sequenced to verify incorporation of the desired modification and to ensure the absence of random mutations The mutagenized plasmids were transformed into P pastoris GS115 competent cells and expression was performed as for the wild-type protein Crude extracts were analyzed by SDS ⁄ PAGE and assayed for the enzymatic activity ACMSD I purification All steps were performed at °C mm dithiothreitol and mm 2-mercaptoethanol were included in all buffers P pastoris GS115 cells transformed with pHIL-D2ACMSD I were incubated in buffered glycerol complex medium, at 30 °C, up to an A600 of 3.0 The culture was centrifuged at 5000 g for 10 (Sorvall centrifuge RC5B plus, Superlite GSA rotor) and the cell pellet was resuspended in one-fifth of the original culture volume of buffered methanol complex medium Cells were cultured for days, at 30 °C, with daily addition of methanol to maintain a 0.5% concentration Cells were harvested by centrifugation as above, and resuspended in 10 mL of lysis buffer containing 10 mm potassium phosphate, pH 7.0, mm phenylmethanesulfonyl fluoride, and 0.02 mgỈmL)1 each of leupeptin, antipain, chymostatin, and pepstatin After disruption by three cycles of French Press (SLM-Aminco, Urbana, IL, USA) at 1000 p.s.i., the suspension was centrifuged at 40 000 g for 20 (Sorvall centrifuge RC5B plus, Kontron-Hermle A8.24 rotor) The supernatant was made 10 mgỈmL)1 by dilution with the lysis buffer, and streptomycin sulfate was added dropwise at a final concentration of 1% After 20 stirring, the sample was centrifuged at 8000 g for 10 (Sorvall centrifuge RC5B plus, KontronHermle A8.24 rotor) and the supernatant was loaded onto a hydroxyhapatite (Bio-Rad, Hercules, CA, USA) column (2.5 cm · 4.9 cm2) equilibrated with 10 mm potassium phosphate, pH 7.0, 50 mm NaCl After washing with the FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 837 Human ACMSD L Pucci et al same buffer, the recombinant protein was eluted with a linear gradient of potassium phosphate from 10 mm to 0.3 m, containing 50 mm NaCl The active pool was dialyzed against 10 mm Tris ⁄ HCl, pH 8.0, 25 mm NaCl, and applied to a fast protein liquid chromatography column of MonoQ (Pharmacia, Stockholm, Sweden), equilibrated with the dialysis buffer After washing with the same buffer, elution was performed with 10 mm Tris ⁄ HCl, pH 8.0, 0.13 m NaCl Active fractions were pooled and stored at °C Gel filtration chromatography ACMSD I native molecular weight was determined by gelfiltration on a Superose 12 HR 10 ⁄ 30 column (Amersham, Piscataway, NJ, USA) For elution, a buffer containing 10 mm Tris ⁄ HCl, pH 8.0, 0.2 m NaCl, mm dithiothreitol and mm 2-mercaptoethanol was used Standard proteins were b-amylase (200 kDa), bovine serum albumin (66 kDa), ovalbumin (45 kDa) and carbonic anhydrase (30 kDa) Assay for ACMSD activity ACMSD activity was determined spectrophotometrically, by measuring ACMS consumption, as described in [23] In our assay mixture, human 3-hydroxyanthranilic acid dioxygenase, which is used to catalyze ACMS formation from hydroxyanthranilic acid, was replaced with a dialyzed crude extract of E coli BL21 (DE3) cells expressing the recombinant enzyme from Ralstonia metallidurans (Plasmid pKLC100 harboring R metallidurans 3-hydroxyanthranilic acid dioxygenase was kindly provided by T Begley, Cornell University, New York, NY) Briefly, a pre-assay mixture consisting of 25 lm hydroxyanthranilic acid and 0.01 units of R metallidurans 3-hydroxyanthranilic acid dioxygenase, in 50 mm 4-morpholinepropanesulfonic acid, pH 6.0, was incubated at 25 °C, with monitoring ACMS formation at 360 nm After the reaction was complete, an appropriate aliquot of ACMSD was added and the activity was calculated by the decrease in absorbance Data were corrected for the spontaneous decrease in absorbance due to the cyclization of ACMS to quinolinate The effect of ACMS concentration on the enzyme activity was investigated by varying 3-hydroxyanthranilic acid concentration from to 20 lm Kinetic parameters were calculated from the initial velocity data by using the Lineweaver-Burk plot One unit is defined as the amount of ACMSD consuming lmol ACMS per minute at 25 °C Three-dimensional structure prediction Human ACMSD structure was modeled using the threedimensional coordinates of the P fluorescens enzyme in complex with Zn2+ and Co2+ (PDB codes 2HBV and 838 2HBX, respectively) using the SWISS-PDBviewer software in conjunction with the SWISS-MODEL server (http:// www.expasy.org/spdbv/) The quality of the predicted structure was checked by computing its Ramachandran plot using procheck program [48]: 86.6% of the residues were in the most favored regions, 12.1% in the additional allowed, three residues in the generously allowed (Asn148, Leu246 and Glu298) and only two residues in the forbidden regions (Asp181 and Met180) The human ACMSD–Zn2+ complex was constructed by superimposing the ACMSD model with the bacterial ACMSD–Zn2+ complex and pasting the zinc ion in the predicted human structure Figures were generated with the software swiss-pdbviewer and visual molecular dynamics [49] Acknowledgements We thank G Magni and S Ruggieri for helpful comments and suggestions and T Begley (Department of Chemistry and Chemical Biology, Cornell University, New York, NY) for the gift of the plasmid pKLC100 References Bender DA (1983) Biochemistry of tryptophan in health and disease Mol Aspects Med 6, 101–197 Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N & Ruggieri S (2004) Enzymology of NAD homeostasis in man Cell Mol Life Sci 61, 19–34 Stone TW (2001) Endogenous neurotoxins from tryptophan Toxicon 39, 61–73 Rios C & Santamaria A (1991) Quinolinic acid is a potent lipid peroxidant in rat brain homogenates Neurochem Res 16, 1139–1143 Schwarcz R, Whetsell WO & Mangano RM (1983) Quinolinic acid: an endogenous metabolite that produces axon-sparing lesions in rat brain Science 219, 316–318 Burns LH, Pakzaban P, Deacon TW, Brownell AL, Tatter SB, Jenkins BG & Isacson O (1995) Selective putaminal excitotoxic lesions in non-human primates model the movement disorder of Huntington’s disease Neuroscience 64, 1007–1017 Guidetti P, Luthi-Carter RE, Augood SJ & Schwarcz R (2004) Neostriatal and cortical quinolinate levels are increased in early grade Huntington’s disease Neurobiol Dis 17, 455–461 Guillemin GJ, Wang L & Brew BJ (2005) Quinolinic acid selectively induces apoptosis of human astrocytes: potential role in AIDS dementia complex J Neuroinflam 2, 16 Guillemin GJ, Brew BJ, Noonan CE, Takikawa O & Culler KM (2005) Indoleamine 2,3 dioxygenase and FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS L Pucci et al 10 11 12 13 14 15 16 17 18 19 20 21 quinolinic acid immunoreactivity in Alzheimer’s disease hippocampus Neuropathol Appl Neurobiol 31, 395–404 Bosco MC, Rapisarda A, Reffo G, Massazza S, Pastorino S & Varesio L (2003) Macrophage activating properties of the tryptophan catabolyte picolinic acid In Developments in Triptophan and Serotonin Metabolism (Allegri G, Costa CVL, Ragazzi E, Steinhart H & Varesio L, eds), pp 55–65 Kluwer Academic ⁄ Plenum Publishers, Norwell, MA Leuthauser SW, Oberley LW & Oberley TD (1982) Antitumor activity of picolinic acid in CBA ⁄ J mice J Natl Cancer Inst 68, 123–129 Blasi E, Bauer D, Barluzzi R, Mazzolla R & Bistoni F (1994) Pattern of cytokine gene expression in brains of mice protected by picolinic acid against lethal intracerebral infection with Candida albicans J Neuroimmunol 52, 205–213 Ogata S, Takeuchi M, Fujita H, Shibata K, Okumura K & Taguchi H (2000) Apoptosis induced by niacin-related compounds in K562 cells but not in normal human lymphocytes Biosci Biotechnol Biochem 64, 1142–1146 Fernandez-Pol JA, Klos DJ & Hamilton PD (2001) Antiviral, cytotoxic and apoptotic activities of picolinic acid on human immunodeficiency virus-1 and human herpes simplex virus-2 infected cell Anticancer Res 21, 3773–3776 Rebello T, Lonnerdal B & Hurley L (1982) Picolinic acid in milk, pancreatic juice and intestine: inadequate for role in zinc absorption Am J Clin Nutr 35, 1–9 Evans GW & Johnson PE (1980) Characterization and quantitation of a zinc binding ligand in human milk Pediatr Res 14, 867–871 Dazzi C, Candiano S, Massazza S, Ponzetto A & Varesio L (2001) New high-performance liquid chromatography method for the detection of picolinic acid in biological fluids J Chromatogr B 751, 61–68 Medana IM, Day NPJ, Salahifar-Sabet H, Stocker R, Smythe G, Bwanaisa L, Njobvu A, Kayira K, Turner GDH, Taylor TT et al (2003) Metabolites of the kynurenine pathway of tryptophan metabolism in the cerebrospinal fluid of Malawian children with malaria J Infect Dis 188, 844–849 Clark CJ, Mackay GM, Smythe GA, Bustamante S, Stone TW & Phillip RS (2005) Prolonged survival of a murine model of cerebral malaria by kynurenine pathway inhibition Infect Immun 73, 5249–5251 Beninger RJ, Colton AM, Ingles JL, Jhamandas K & Boegman RJ (1994) Picolinic acid blocks the neurotoxic but not the neuroexcitant properties of quinolinic acid in the rat brain: evidence from turning behaviour and tyrosine hydroxylase immunohistochemistry Neuroscience 61, 603612 Li T, Iwaki H, Fu R, Hasegawa Y, Zhang H & Liu A (2006) a-Amino-b-carboxymuconic-e-semialdehyde decarboxylase (ACMSD) is a new member of the Human ACMSD 22 23 24 25 26 27 28 29 30 31 32 amidohydrolase superfamily Biochemistry 45, 6628– 6634 Ichiyama A, Nakamura S, Kawai H, Honjo T, Nishizuka Y, Hayaishi O & Senoh S (1965) Studies on the metabolism of the benzene ring of tryptophan in mammalian tissues Enzymic formation of a-aminomuconic acid from 3-hydroxyanthranilic acid J Biol Chem 240, 740–749 Egashira Y, Kouhashi H, Ohta T & Sanada H (1996) Purification and properties of a-amino-b-carboxymuconic-e-semialdehyde decarboxylase (ACMSD), key enzyme of niacin synthesis from tryptophan, from hog kidney J Nutr Sci Vitaminol 42, 173–183 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Purification and molecular cloning of rat 2-amino-3-carboxymuconate-6-semialdehyde Biochem J 361, 567–575 Egashira Y, Murotani G, Tanabe A, Saito K, Uehara K, Morise A, Sato M & Sanada H (2004) Differential effects of dietary fatty acids on rat liver a-amino-b-carboxymuconate-e-semialdehyde decarboxylase activity and gene expression Biochim Biophys Acta 1686, 118–124 Fukuwatari T, Ohsaki S, Fukuoka SI, Sasaki R & Shibata K (2004) Phtalate esters enhance quinolinate production by inhibiting a-amino-b-carboxymuconatee-semialdehyde decarboxylase (ACMSD), a key enzyme of the tryptophan pathway Toxicol Sci 81, 302–308 Shin M, Ohnishi M, Iguchi S, Sano K & Umezawa C (1999) Peroxisome-proliferator regulates key enzymes of the tryptophan-NAD pathway Toxicol Appl Pharmacol 158, 71–80 Kimura N, Fukuwatari T, Sasaki R & Shibata K (2005) The necessity of niacin in rats fed on a high protein diet Biosci Biotechnol Biochem 69, 273–279 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Expression of rat hepatic 2-amino3-carboxymuconate-6-semialdehyde decarboxylase is affected by a high protein diet and by streptozotocininduced diabetes J Nutr 132, 1153–1159 Shin M, Kim I, Inoue Y, Kimura S & Gonzalez FJ (2006) Regulation of mouse hepatic alpha-amino-betacarboxymuconate-epsilon-semialdehyde decarboxylase, a key enzyme in the tryptophan-nicotinamide adenine dinucleotide pathway, by hepatocyte nuclear factor 4alpha and peroxisome proliferator-activated receptor alpha Mol Pharmacol 70, 1281–1290 Colabroy KL & Begley TP (2005) Tryptophan catabolism: identification and characterization of a new degradative pathway J Bacteriol 187, 7866–7869 Muraki T, Taki M, Hasegawa Y, Iwaki H & Lau PCK (2003) Prokaryotic homologs of the eukaryotic 3-hydroxyanthranilate 3,4-dioxygenase and 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase in the 2-nitrobenzoate degradation pathway of Pseudomonas FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS 839 Human ACMSD 33 34 35 36 37 38 39 40 L Pucci et al fluorescens strain KU-7 Appl Environ Microbiol 69, 1564–1572 Li T, Walker AL, Iwaki H, Hasegawa Y & Liu A (2005) Kinetic and spectroscopic characterization of ACMSD from Pseudomonas fluorescens reveals a pentacoordinate mononuclear metallocofactor J Am Chem Soc 127, 12282–12290 Martynowski D, Eyobo Y, Li T, Yang K, Liu A & Zhang H (2006) Crystal structure of a-amino-b-carboxymuconic-e-semialdehyde decarboxylase: insight into the active site and catalytic mechanism of a novel decarboxylase reaction (2006) Biochemistry 45, 10412–10421 Liu A & Zhang H (2006) Transition metal-catalyzed nonoxidative decarboxylation reactions Biochemistry 45, 10407–10411 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human a-amino-b-carboxymuconate-e-semialdehyde decarboxylase (ACMSD) J Biol Chem 277, 35162–35167 Kyte J & Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein J Mol Biol 157, 105–132 Pawlak D, Tankiewicz A, Matys T & Buczko W (2003) Peripheral distribution of kynurenine metabolites and activity of kynurenine pathway enzymes in renal failure J Physiol Pharmacol 54, 175–189 Saito K, Fujigaki S, Heyes MP, Shibata K, Takemura M, Fuji H, Wada H, Noma A & Seishima M (2000) Mechanism of increases in 1-kynurenine and quinolinic acid in renal insufficiency Am J Physiol Renal Physiol 279, F565–F572 Egashira Y, Nagaki S & Sanada H (2006) Tryptophan-niacin metabolism in rat with puromycin amino- 840 41 42 43 44 45 46 47 48 49 nucleoside-induced nephrosis Int J Vitam Nutr Res 76, 28–33 Fukuwatari T, Morikawa Y, Hayakawa F, Sugimoto E & Shibata K (2001) Influence of adenine-induced renal failure on tryptophan-niacin metabolism in rats Biosci Biotechnol Biochem 65, 2154–2161 Bender DA & Olufunwa R (1988) Utilization of tryptophan, nicotinamide and nicotinic acid as precursors for nicotinamide nucleotide synthesis in isolated rat liver cells Br J Nutr 59, 279–287 Ying W (2006) NAD and NADH in cellular functions and cell death Front Biosci 11, 3129–3148 Sasaki Y, Araki T & Milbrandt J (2006) Stimulation of nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy J Neuroscience 26, 8484–8491 Cooper BF, Sideraki V, Wilson DK, Dominguez DY, Clark SW, Quiocho FA & Rudolph FB (1997) The role of divalent cations in structure and function of murine adenosine deaminase Protein Sci 6, 1031– 1037 Schagger H & Von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from to 100 kDa Anal Biochem 166, 368–379 Pichia Expression Kit A Manual of Methods for Expression of Recombinant Proteins in Pichia Pastoris Invitrogen Corporation, San Diego, CA Laskowski RA, MacArthur MW, Moss DS & Thornton JM (1993) procheck: a program to check the stereochemical quality of protein structures J Appl Cryst 26, 283–291 Humphrey W, Dalke A & Schulten K (1996) VMD: visual molecular dynamics J Molec Graphics 14 1, 19–25 FEBS Journal 274 (2007) 827–840 ª 2007 The Authors Journal compilation ª 2007 FEBS ... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and its... milk, pancreatic juice and intestine: inadequate for role in zinc absorption Am J Clin Nutr 35, 1–9 Evans GW & Johnson PE (1980) Characterization and quantitation of a zinc binding ligand in human