Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... kit (Stratagene, La Jolla, CA, USA). Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGT GCT ATTCTACCAAAAGAATGG...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... majus, Bromhaedia finlaysonia, Arabidopsis thaliana, Persea americana, Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ... doi:10.1046/j.1432-1033.2002.03108.x Several intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance,...

Ngày tải lên: 21/02/2014, 03:20

9 864 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely cono...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... shortest functional domain from a crenarchaeal plasmid endowed with DNA and RNA synthesis and terminal transferase activity. Abbreviations AEP, archaeo-eukaryotic replicative primases; dNTP, deoxyribonucleotide; ... replicative primases (AEPs) [11]. Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio- phages and crenarchaeal...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... as substrate in PCR with the following Ras-GRF1 gene-speci- fic primers: ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, ... can induce the activation of intracellular cascades such as the mitogen-activated protein (MAP) kinase – also called extracellular signal-regulated kinase (ERK) – cascade. The serine ⁄ t...

Ngày tải lên: 19/02/2014, 18:20

13 730 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

... D not containing glycine and FTHF. Such an enzyme was once again incubated with glycine (10 m M) and differ- ent concentrations of FTHF as in (j) and the absorbance was mea- sured at 500 nm. ... is at a distance of 2.95 A ˚ from the a- carbon atom of Gly and appears to be suitable for this proton transfer. As the internal and external aldimines of SHMTs have simi- l...

Ngày tải lên: 18/02/2014, 16:20

13 514 0
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... overlap affecting the corresponding signals. Correlations were calculated by means of MATHEMATICA 5.2 software, using the relaxation dataset given in supplementary Table S2. Relaxation data obtained ... Universita ` di Udine, Italy Homeodomains (HDs) comprise a very well-known class of DNA-binding domains occurring in a large family of transcription activators involved in the...

Ngày tải lên: 18/02/2014, 16:20

14 744 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... N-terminal domain and is comparable to that of human defensins and human lysozyme. Elafin and trappin-2 are both antimicrobial against S. aureus and P. aeruginosa [14,15] but not against E. coli ... analysis of elafin and trappin-2 fractionated on heparin-Sepharose. The heparin-binding capacities of elafin and trappin-2 were evaluated by affinity chromatography using heparin...

Ngày tải lên: 18/02/2014, 17:20

13 610 0
Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

... phosphatase 2A interacts with the 70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl Acad Sci USA 96, 4438–4442. 11 Petritsch C, Beug H, Balmain A & ... stimulated for various times, fixed and stained with an antibody against the C-terminus of S6K1. Using an fluoroscein isothiocyanate (FITC)-labeled secondary anti-rabbit IgG and pha...

Ngày tải lên: 19/02/2014, 07:20

14 630 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... Helena Yusuf-Makagiansar 3 , Vincent T. K. Chow 2 , Teruna J. Siahaan 3 and Seetharama D. S. Jois 1 1 Department of Pharmacy and 2 Department of Microbiology, National University of Singapore, Singapore; 3 Department ... T-leukemia and the human colon adenocarcinoma (Caco-2) cell lines were obtained from the American Type Culture Collection (Rockville, MD, USA). Jurkat and M O...

Ngày tải lên: 19/02/2014, 13:20

14 658 0
w