visualizing the governance environment of a reform project
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... directly accessed on the screen But the translation is always done by the translator This data base is composed of dictionaries, "formats" and "procedures" of the analysis, transfer and synthesis phases ... phases (the conventional phases of a CAT system) For any given source lexical unit in this data base, VISULEX searches for all the associated information THAM consists of a set of functions programmed ... help translators in several ways, particularly with Machine Aided Human Translation (MAHT) The translator is provided with a text editing system, as well as an uncoded dictionary which may be...
- 4
- 404
- 0
Báo cáo toán học: " Shrinking projection algorithms for equilibrium problems with a bifunction defined on the dual space of a Banach space" doc
... Inspired and motivated by Ceng et al [2], Takahashi and Zembayashi [14], Takahashi and Zembayashi [9], the main aim of this paper is to introduce and investigate a new iterative method for finding a ... et al Fixed Point Theory and Applications 2011, 2011:91 http://www.fixedpointtheoryandapplications.com/content/2011/1/91 Page of 11 and Takahashi [10] and Takahashi et al [13], Takahashi and ... YJC and ZW carried out the studies on nonlinear analysis and applications, wrote this article together and participated in its design of this paper All authors read and approved the final manuscript...
- 11
- 396
- 0
Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc
... Computing the orientable genus of projective graphs Journal of Graph Theory 20 (1995), 297–308 [8] M Juvan, A Malniˇ, and B Mohar Systems of curves on surfaces, Journal of c Combinatorial Theory ... and so in this case the number of crossings in D is within a constant factor ∆2 /(8cg ) of crg (G) Remark 4.2 In the planar case of Theorem 1.2, the described approximation algorithm yields a ... edges of C ∗ Then G − F is actually a plane embedding, and we easily add the edges of F back to G − F , making a plane drawing D with at most |F | pairwise crossings This whole algorithm can run...
- 8
- 336
- 0
Báo cáo khoa học: "A comparison of five indirect methods for characterizing the light environment in a tropical fores" pptx
... correlated in a positive way, this suggested that the greater the number of trees or basal area was, the greater the amount of incident light Because the mean density of trees and the mean basal area ... was analysed in the same way The relationship between light variables and quantitative stand variables (ND and BD) was tested with Pearson’s correlation coefficient, whereas an analysis of variance ... radiation The camera was oriented so that the top of each photograph pointed north in order to calculate suntracks for analysis Diazo paper metres were attached to metal stakes at a height of...
- 16
- 317
- 0
báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot
... release, a sample of native flies was taken to determine the allelic frequencies in the natural population Another sample was taken at the end of release During the following weeks, new bananas ... supplying a large amount of alcohol to the cultures The aim of the present study was to check the hypothesis of balanced polymorphism in a natural environment A large number of flies genetically marked ... electrophoresis and ADH activity was stained by the usual procedure, using isopropanol as a substrate II1 Results About 000 gcnitically-marked adults were released over a week in the close of the banana baits...
- 6
- 251
- 0
The Marketing Strategy of a multinational join stock company.doc
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf
... www.casesjournal.org To increase acceptability of the product, messages also emphasized the fact that the Orasel tasted better than the available ORS and that the zinc had a sweet taste ORS replaces ... in the day to day care of their children and treating diarrhea The docudrama covered a range of sanitation and hygiene issues including causes, prevention, and appropriate treatment of diarrhea, ... promoting the OraselKIT® brand and increasing awareness of the product’s availability The docudrama movie presented a fictionalized version of real challenges faced by Cambodian mothers and caregivers...
- 19
- 438
- 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... Annals of Mathematics, 159 (2004), 1–52 On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri To the memory of Michael R Herman (1942–2000) Abstract...
- 53
- 383
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25