vector technology and cell targeting peptide tagged adenoviral vectors as a powerful tool for cell specific targeting
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx
... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... between ETS for respiratory diseases such as adult and pediatric asthma Also a series of epidemiological analyses on parental smoking and respiratory health in children have been performed [60,64,65,4,66-71] ... men For women, significant values were found for heavy ETS exposure in small spaces and in large indoor areas and for total ETS exposure [60] Figure search for the terms cough and tobacco and...
- 6
- 304
- 0
Nonviral gene delivery using polymer and peptide to develop safe and cell specific gene vectors
... therapy Viral vectors including retroviruses, adenoviruses and adeno-associated viruses are particular attractive as vectors due to ease of production and generally high efficiency of transgene ... luciferase activity in cell extracts was measured using a luciferase assay kit (Promega, WI, USA) Each measurement was carried out for 10 seconds in a single-well luminometer (Berthold Lumat LB ... more than two-thirds of clinical gene therapy trials use viral vectors Because of the many intrinsic problems of viral vectors, non-viral vectors emerge as a viable alternative They are basically...
- 96
- 184
- 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
... restraints, and eight dihedral angle restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than ˚ ˚ 0.5 A and A, respectively, ... function was applied to the t1 and t2 dimensions Peak picking and assignment were performed with sparky (T D Goddard and D G Kneller, sparky 3, University of California, San Francisco, CA) 1D and 2D ... stage, the same protocol was applied by adding hydrogen bond restraints and dihedral angle restraints Additional NOE constraints were added in each round of calculations, and restraints that...
- 11
- 565
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... challenging, as IL-2 is first and foremost a T cell growth factor, and as such, has strong proliferative effects on all T cells, including pathogenic CD4 + and CD8+ Teff cells For the past decade, ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient...
- 12
- 573
- 0
Báo cáo hóa học: " Molecular and macromolecular alterations of recombinant adenoviral vectors do not resolve changes in hepatic drug metabolism during infection" potx
... TGT CA Antisense: GGC CAG GAA ATA CAA GAC AA Sense: CTG CTG CTG CTG AAA CAC GTC Antisense: GGA TGA CAG CGA TAC TAT CAC Sense: GAG CTC TGG GCA GAA ACA TC Antisense: ACA CGG CAG ATT TGA AGA CC ... μg, Sigma) was added as an internal standard The organic phase was evaporated under a constant stream of air, dissolved in 200 μl of methanol and stored in a sealed tube at 4°C until analysis ... asthma and COPD, was used as a positive control It contained all virus expression elements A first generation adenoviral vector, expressing the E coli beta-galactosidase transgene (AdlacZ) was...
- 17
- 340
- 0
Báo cáo y học: "Integration of Arabidopsis thaliana stress-related transcript profiles, promoter structures, and cell-specific expression" pptx
... interactions The yeast Snf1 protein kinase and the mammalian AMP-activated protein kinase act as metabolic sensors that monitor cellular AMP and ATP levels Activation increases the ATP:AMP ratio ... D, Doyle A, GarciaHernandez M, Huala E, Lander G, Montoya M, et al.: The Arabidopsis Information Resource (TAIR): a model organism database providing a centralized, curated gateway to Arabidopsis ... microarray datasets used for this analysis Additional data file includes the stress datasets used for fuzzy k-means analysis Additional data file includes clustering results of all stress datasets...
- 22
- 276
- 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... interfering RNA 13 1.1 Glioblastoma Malignant brain tumors such as glioblastoma multiforme (GBM) and childhood brain cancer, medulloblastoma, have remained virtually untreatable and lethal The median survival...
- 134
- 439
- 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... that glial cells also play a part in exaggerated pain states created by inflammation and neuropathy (Hashizume et al., 2000; Watkins and Maier, 2002) Astrocytes, in particular, play an important ... my days as a researcher Thank you both so much for all the fun and laughter you have brought to my days in the laboratory I am also very grateful to Ms Jeyapriya Raja Sundaram for her help and ... hyperalgesia and allodynia when administered intrathecally in mice NST, on the other hand, blocks nociceptin-induced allodynia and hyperalgesia, and also attenuates pain due to prostaglandins In addition,...
- 136
- 600
- 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 273-284 49 Powell SN and Bindra RS Targeting the DNA damage response for cancer therapy DNA Repair (Amst) 2009; 8: 1153-1165 50 Shimada M and Nakanishi M DNA damage checkpoints and cancer J Mol Histol...
- 10
- 408
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... condition, such as TLS, we need a drug, as rasburicase, with rapid onset of action A comparison between rasburicase and oral allopurinol has showed the major efficacy of rasburicase in controlling ... Poly-pharmacology Low pH of urine High creatinine levels Table Studies on rasburicase Authors Pui et al (dose-validation phase and accrual phase) Phase II trial [13] Year 2001 Treatment plan Rasburicase...
- 11
- 715
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... ((AUC ) × Dose ) A BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis ... detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...
- 7
- 391
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... both gas and liquid phase in the same computational domain, and thus allows for the implementation of phase change inside the gas diffusion layers The model includes the transport of gaseous ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing...
- 18
- 549
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... endo-glucanase, exo-glucanase and β-glucosidase Endo -and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital...
- 20
- 437
- 0
Tài liệu New and Evolving Web-based Marketing – How to Find a Market Outlet for your Wildlife Friendly Products ppt
... National Mail Order Association (NMOA) and the American Catalog Mailers Association (ACMA) show that the US catalog industry is a $400+ billion marketplace and is made up of thousands of catalogs ... Organization (FAO) has declared 2009 the International Year of Natural Fibers so we are using Wildlife Friendly certified plant and animal fibers, specifically yarn as a mini case to illustrate ... luxury, fair trade as well as specific yarn types – alpaca, tasar silk, bamboo, etc Distributors - There are thousands of yarn wholesalers and distributors around the world It is a very crowded market...
- 28
- 857
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... 3, panels A and B, suggest a signi…cant and positive contemporaneous relation between GDP changes and loan growth, as well as a signi…cant and negative relation between GDP growth and changes ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3,...
- 30
- 911
- 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf
... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling ... vital for a rapid response As a key regulator shaping the early phase of IFNa signalling, IRF9 represents an appealing target for innovative therapeutic approaches IRF9 accelerates IFNa signal ... normalized unscaled standard error indicates the standard error estimate distributions obtained for each gene on each array when performing RMA analysis Normalization ensures that the median standard...
- 14
- 432
- 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ ... 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ Primers used for mutations by PCR and the QuikChangeTM ... between the a subunits of Na+/K+-ATPase and the gastric H+/K+ATPase [26] This segment was also demonstrated to be important for ion conduction, as shown for Asp884 and Asp885 mutants [4], to affect...
- 11
- 318
- 0
Agency and Consciousness in Discourse: Self-other Dynamics as a Complex System ppt
... Prevignano, Duane Savage-Rumbaugh, Susan SavageRumbaugh, Zhang Shaojie, Jared Tagliatela, Godfrey Tanner, Amy Tsui, Theo van Leeuwen, Eija Ventola, and David Wallace To my daughter, Ilaria, many thanks ... scalar levels of semiotic and material organization Michael Halliday, Ruqaiya Hasan, and Jay Lemke deserve a very special mention for their generosity and support – both intellectual and personal ... realm of constructive imagination and treats him to the same deictic words as before so that he may see and hear what can be seen and heard there (and touch, of course, and perhaps even smell and...
- 369
- 307
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...
- 28
- 764
- 2
Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx
... Community-Based Social Marketing as a Planning Tool local, state, and federal government agencies” (Global Action Plan) The U.S program is part of a larger international effort that is operating in ... students, and community associations The program worked by offering discounted bus passes to individuals who purchased passes as part of a larger group-purchasing program The discount pass acted as an ... qualitative and quantitative information For example, quantitative information is found through literature reviews and samples taken from community surveys, and qualitative information is gained...
- 70
- 425
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008