varicella zoster virus vzv human herpesvirus type 3 infections

Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

... 2 .36 0.88 1. 23 1.11 4.24 2.90 2.27 3. 19 2.75 6 .35 2.54 1.25 1.78 1 .34 3. 14 12.51 3. 35 2.22 4.14 5.42 2 .39 2 .30 3. 33 1.78 7.48 45.49 30 .78 39 .33 20.58 68.17 sumV 21.87 45. 23 18.22 13. 07 23. 78 9.82 ... L 13 PLA TBP GAP PPI G6P Tub sumRGC CMV HHV-6 CAMP SARS YF 2.10 5.98 3. 59 1.19 9.01 11.55 3. 54 14.19 1.71 14.25 3. 03 3 .35 3. 94 2.14 5.78 2.18 2.89 3. 17 1. 93 2.90 3. 95 4.99 2.71 2.52 9.62 2 .36 ... 0.70 1 .30 1 .38 0.95 1.66 0.89 1 .31 1 .37 1.08 1.40 0.84 1 .39 4.79 1.15 2.04 1.04 1 .31 1.54 0.96 1.92 0.80 1.48 20.09 13. 27 18.95 9. 73 17 .34 sumV 8.41 14.20 6.11 8.05 7. 03 6.29 6.19 6.08 10 .33 6.70...

5
452
0

báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Danh mục: Hóa học - Dầu khí

... 2 .36 0.88 1. 23 1.11 4.24 2.90 2.27 3. 19 2.75 6 .35 2.54 1.25 1.78 1 .34 3. 14 12.51 3. 35 2.22 4.14 5.42 2 .39 2 .30 3. 33 1.78 7.48 45.49 30 .78 39 .33 20.58 68.17 sumV 21.87 45. 23 18.22 13. 07 23. 78 9.82 ... L 13 PLA TBP GAP PPI G6P Tub sumRGC CMV HHV-6 CAMP SARS YF 2.10 5.98 3. 59 1.19 9.01 11.55 3. 54 14.19 1.71 14.25 3. 03 3 .35 3. 94 2.14 5.78 2.18 2.89 3. 17 1. 93 2.90 3. 95 4.99 2.71 2.52 9.62 2 .36 ... 0.70 1 .30 1 .38 0.95 1.66 0.89 1 .31 1 .37 1.08 1.40 0.84 1 .39 4.79 1.15 2.04 1.04 1 .31 1.54 0.96 1.92 0.80 1.48 20.09 13. 27 18.95 9. 73 17 .34 sumV 8.41 14.20 6.11 8.05 7. 03 6.29 6.19 6.08 10 .33 6.70...

5
539
0

Báo cáo y học: " Phosphodiesterase type 4 expression and anti-proliferative effects in human pulmonary artery smooth muscle cells" docx

Danh mục: Báo cáo khoa học

... 2000, 292:512-520 http://respiratory-research.com/content/7/1/9 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Palmer D, Tsoi K, Maurice DH: Synergistic inhibition of vascular smooth ... production in a variety of human cell types [30 ,31 ] cAMP-elevating agents have also been found to suppress MT1-MMP activity [32 ] and upregulate tissue inhibitors of MMPs [33 ], however, it is uncertain ... of the total activity (35 .9 ± 2 .3% ; P < 0.01; n = 5) compared to PDE3 (21.5 ± 2.5%), PDE2 (15.8 ± 3. 4%) or PDE1 activity (14.5 ± 4.2%) (A) P

12
249
0

Báo cáo y học: " Ancient, independent evolution and distinct molecular features of the novel human T-lymphotropic virus type 4" pot

Danh mục: Báo cáo khoa học

... – 32 1,800) 128,600 (57,000 – 226,550) 42 ,35 0 (11,650 – 87,100) 33 ,600 (15,750 – 58,200) 23, 000 (14 ,35 0 – 30 ,000) 175,100 ( 63, 850 – 33 4,750) 1 03, 700 (41 ,30 0 – 205,100) 37 ,200 (9,800 – 82,800) 30 ,100 ... [HTLV-2(Efe) = Y1 436 5], [STLV-2(Pan-p) = U90557], [STLV-2(pp1664) = Y14570], [HTLV -3( 2026ND) = DQ0 937 92], [HTLV[STLV -3( CTO604) = 3( Pyl 43) = DQ462191], NC_0 033 23] , [STLV -3( Ph969) = Y07616], [STLV3(TGE2117) ... HTLV-1(ATL-YS) 0.64 HTLV-1(Boi) STLV -3( TGE2117) 0.94 STLV -3( Ph969) HTLV -3( Pyl 43) STLV -3( CTO604) 0.9 HTLV -3( 2026ND) STLV -3( Ppaf3) 0.62 STLV -3( NG409) HTLV-4(1863LE) STLV-2(pp1664) STLV-2(Pan-p) HTLV-2d(Efe)...

20
320
0

AC R Sample Task Type 4 Task

Danh mục: Kỹ năng viết tiếng Anh

... Sample task type 4 Question 9 – 13 Complete the table below. Choose NO MORE THAN THREE WORDS from the passage for each answer. Write your answers in boxes 9 13 on your answer sheet. ... Spanish late spring 1 2 Spanish 1.25 cm 9 10 11 South African ball roller 12 13 ……… ...

2
672
0

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

Danh mục: Thạc sĩ - Cao học

... appropriate protection and humanitarian assistance in the enjoyment of applicable rights set forth in the present Convention and in other international human rights or humanitarian instruments ... human family is the foundation of freedom, justice and peace in the world, Bearing in mind that the peoples of the United Nations have, in the Charter, reaffirmed their faith in fundamental human ... the human person, and have determined to promote social progress and better standards of life in larger freedom, Recognizing that the United Nations has, in the Universal Declaration of Human...

28
611
0

Tài liệu E-Human Resource Management 4 pptx

Danh mục: Quản trị kinh doanh

... The company aim is to switch a portion of its current investment in R&D to more venture capital type activities; it aims to take stakes in or take over young start-up companies with innovative ... analyzed, such as the goods or services offered, the key business processes, the financial and human resources required, the organizational structures, and the major systems and procedures These ... goods — be it information, objects, money, or other resources — from providers to users (see Box 3) In Europe, distributive networks such as power companies, postal and telecommunications services,...

9
389
0

Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

Danh mục: Báo cáo khoa học

... PSY4–MYC 13 AY926 PSY4–MYC 13 AY925 PSY4–MYC 13, HA3–PPH21 AY925 PSY4–MYC 13, HA3-PPH3 AY925 PSY4–MYC 13, HA3–PPG1 AY925 PSY4–MYC 13, HA3–SIT4 BY47 43 (Y20000, diploid) MATa, ade2-1, his3-11, leu2 -3, trp1-1, ... GAATTCGAGCTCGTTTAAAC pFA6a-HIS3MX6 pFA6a-HIS3MX6 pFA6a-13Myc-HIS3MX6 pFA6a-13Myc-HIS3MX6 pMPY-3xHA Gene modiﬁcation pMPY-3xHA pMPY-3xHA pMPY-3xHA pMPY-3xHA Primer sequence (5¢- to 3 ) Transformation module ... (2006) 33 22 33 34 ª 2006 The Authors Journal compilation ª 2006 FEBS 33 25 33 26 PPG1 N-terminal 3HA tag SIT4 N-terminal 3HA tag SIT4 N-terminal 3HA tag TUB2 deletion R5 F6 R6 F 13 pF6a-HIS3MX6 TUB2...

13
389
0

Báo cáo khoa học: Mutational analysis of substrate recognition by human arginase type I ) agmatinase activity of the N130D variant pot

Danh mục: Báo cáo khoa học

... (M)1Æs)1) Wild -type N 130 D 190 ± 10 33 ± 1.5 ± 0.2 13. 3 ± 2.5 1.27 · 105 2.48 · 1 03 1.0 ± 0.2 7.8 ± 0.1 56 ± 39 ± – 3 1 – 1.4 ± 0 .3 – 2.14 · 1 03 5626 FEBS Journal 2 73 (2006) 5625–5 631 ª 2006 The ... 26 27 28 29 30 31 32 33 ˚ tal structure of human arginase I at 1.29 A resolution and exploration of inhibition in the immune response Proc Natl Acad Sci USA 102, 130 58– 130 63 Bewley MC, Jeffrey ... primers for the N 130 D variant were 5¢-GTGGAGTGTCGATATCA -3 and 5¢-TGATATCGAC ACTCCAC -3 , respectively The corresponding primers for the Asn 130 ﬁ Gln mutation were 5¢-GTGGAGTTTGGA TATCA -3 and 5¢-TGATATCCAAACTCCAC -3 ...

7
303
0

Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

Danh mục: Báo cáo khoa học

... interaction of + MCM4/6/7 A + Tag 1.4 14 1.4 14 0. 43 4 .3 43 0. 43 4 .3 43 (μM) HQ Pi ATP B 120 100 Tag % 80 60 40 20 MCM 0. 43 1.4 4 .3 (μM) HQ 14 43 Fig (A) Effect of increasing concentrations of ... heliquinomycin, approximately 27% of the cells A + Tag + MCM4/6/7 14 1.4 1.4 14 43 (μM) HQ 0. 43 4 .3 43 0. 43 4 .3 17-mer/M 13 were stained with anti-BrdU Ig As the concentration of heliquinomycin was ... MCM 0. 43 1.4 4 .3 (μM) HQ 14 43 + Werner 1.4 0. 43 4 .3 14 43 (μM) HQ 17-mer/M 13 B 17-mer 120 100 % 80 60 40 20 33 84 0. 43 4 .3 1.4 (μM) HQ 14 43 Heliquinomycin at an IC50 value of 7–14 lm inhibits the...

10
538
0

Báo cáo khoa học: Functional analysis of disease-causing mutations in human UDP-galactose 4-epimerase pot

Danh mục: Báo cáo khoa học

... (s)1) Wild type N34S G90E V94M D103G L183P K257R L313M G319E R 335 H 69 82 93 160 140 97 66 35 78 99 36 32 0.046 1.1 5.0 11 5.1 5.8 30 15 ± ± ± ± ± ± ± ± ± ± 12 15 24 38 21 40 15 11 13 12 ± ± ± ... Metab Dis 23, 7 13 729 Thoden JB, Wohlers TM, Fridovich-Keil JL & Holden HM (2001) Molecular basis for severe epimerase Disease-causing mutations in human GALE 29 30 31 32 33 34 35 36 37 38 39 40 deﬁciency ... compilation ª 2005 FEBS 61 73 Disease-causing mutations in human GALE D J Timson UDPgal V94 R 335 NAD+ N34 D1 03 G90 K257 G319 L3 13 L1 83 UDPgal NAD+ Fig Structure of human UDP-galactose 4-epimerase...

8
424
0

Báo cáo sinh học: " Purification of infectious human herpesvirus 6A virions and association of host cell proteins" pot

Danh mục: Hóa học - Dầu khí

... simplex virus V Purification and structural proteins of the herpesvirion J Virol 1972, 9:1 43- 159 http://www.virologyj.com/content/4/1/101 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Huang ... variant B human herpesvirus- 6 infection in a bone marrow-transplant recipient N Engl J Med 1994, 33 0: 135 6- 136 0 Mackenzie IR, Carrigan DR, Wiley CA: Chronic myelopathy associated with human herpesvirus- 6 ... nonstructural polypeptides of human herpesvirus- 6 Virus Res 1989, 13: 1 73- 178 Takemoto M, Koike M, Mori Y, Yonemoto S, Sasamoto Y, Kondo K, Uchiyama Y, Yamanishi K: Human herpesvirus open reading frame...

11
374
0

Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

Danh mục: Hóa học - Dầu khí

... of human CD4+ T lymphocytes by HIV-1 and HHV-6 Nature 1989, 33 7(6205) :37 0 -37 3 Asada H, Klaus-Kovtun V, Golding H, Katz SI, Blauvelt A: Human herpesvirus infects dendritic cells and suppresses human ... ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc g [5] [5] [5] [5] [33 ] [33 ] [33 ] [34 ] [34 ] Page of (page number not for citation purposes) Virology Journal 2007, 4:106 http://www.virologyj.com/content/4/1/106 ... Hepatitis C virus NS5B protein is a membrane-associated phosphoprotein http://www.virologyj.com/content/4/1/106 30 31 32 33 34 with a predominantly perinuclear localization Virology 1997, 227(2): 439 -446...

8
410
0

Báo cáo sinh học: " Thiol-reactive reagents inhibits intracellular trafficking of human papillomavirus type 16 pseudovirions by binding to cysteine residues of major capsid protein L" pot

Danh mục: Hóa học - Dầu khí

... 82.0 29 .3 54.9 3. 46 ND 33 .8 81.2 8. 53 5.85 44 .3 13. 1 100 35 .7 66.9 4.22 41.2 99.0 10.4 7.14 54.0 16.0 1.77.E+05 1.05.E+05 1.64.E+05 8.60.E+04 NT 1.62.E+05 2.82.E+05 9.60.E+04 8.50.E+04 3. 30.E+05 ... 3. 30.E+05 1.62.E+05 100 59 .3 92.4 48.1 91.4 159 54.6 50.2 187 91.4 17.5 1.40 3. 37 2.04 3. 86 4.46 5.59 2.47 4. 03 4. 43 WT C102A C146A C157A C161A C185A C225A C229A C324A C345A C379A ND: not detected ... AACCAGCTGTTC -3' (F for C324A), 5'-GAACAGCTGGTTGCCCCAGGCGATGCCGTTGTTGTG -3' (R for C324A), 5'-CCAACATGAGCCTGGCCGCCGCCATCAGCAC -3' (F for C345A), 5'-GTGCTGATGGCGGCGGCCAGGCTCATGTTGGTGCTCC -3' (R for C345A),...

11
270
0

Báo cáo sinh học: " The E5 protein of the human papillomavirus type 16 down-regulates HLA-I surface expression in calnexin-expressing but not in calnexin-deficient c" pptx

Danh mục: Hóa học - Dầu khí

... antibodies against human papillomavirus type 16 E6 24 25 26 27 28 29 30 31 32 33 34 35 and E7 proteins in sera of patients with cervical neoplasias Jpn J Cancer Res 1992, 83: 705-7 13 Muller M, Viscidi ... classification of human papillomavirus types associated with cervical cancer N Engl J Med 20 03, 34 8:518-527 Franco EL, Schlecht NF, Saslow D: The epidemiology of cervical cancer Cancer J 20 03, 9 :34 8 -35 9 Walboomers ... precancers Am J Pathol 1989, 134 :11 83- 1188 Garnett TO, Duerksen-Hughes PJ: Modulation of apoptosis by human papillomavirus (HPV) oncoproteins Arch Virol 2006, 151: 232 1- 233 5 Werness BA, Levine AJ,...

15
411
0

Báo cáo sinh học: " Human herpesvirus 6A induces apoptosis of primary human fetal astrocytes via both caspase-dependent and -independent pathways" potx

Danh mục: Hóa học - Dầu khí

... Yamanishi K: Predominant CD4 T-lymphocyte tropism of human herpesvirus 6-related virus J Virol 1989, 63( 7) :31 61 31 63 Yoshikawa T: [Human herpesvirus encephalitis] Brain Nerve 2010, 62(8):869–875 ... Keywords Apoptosis, Human herpesvirus 6A, Primary human fetal astrocyte, Caspase Background Human herpesvirus (HHV-6), a member of the beta herpesvirus family, is a T-lymphotropic virus and the causal ... Infection of primary human fetal astrocytes by human herpesvirus J Virol 1996, 70(2):1296– 130 0 11 Kurokawa M, Kornbluth S: Caspases and kinases in a death grip Cell 2009, 138 (5): 838 – 854 12 Green...

21
326
0

Báo cáo sinh học: " Human herpesvirus 8 – A novel human pathogen" potx

Danh mục: Điện - Điện tử

... patients using a whole Page 30 of 32 (page number not for citation purposes) Virology Journal 2005, 2:78 232 233 234 235 236 237 238 239 240 241 242 2 43 244 245 246 247 virus enzyme-linked immunosorbent ... less frequent in human immunodeficiency virus type than in human immunodeficiency virus type infection despite a high prevalence of human herpesvirus J Hum Virol 1998, 1 (3) :1 93- 199 130 Hudnall SD, ... http://www.virologyj.com/content/2/1/78 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 ratory evaluation of cytomegalovirus-induced mononucleosis in previously healthy individuals Report of 82 cases Medicine 1986, 65(2):124- 134 ...

32
402
0

nghiên cứu phát hiện sự gắn chèn gene e6 và e7 của human papilomavirus type 16 vào bộ gene người bằng kỹ thuật multiplex rt-pcr

Danh mục: Báo cáo khoa học

... 200 37 1 :3 300 1:4 400 1:5 500 2:1 100 2:2 200 2 :3 200 30 0 2:4 400 2:5 500 3: 1 100 3: 2 200 3: 3 30 0 30 0 3: 4 400 3: 5 500 4:1 100 4:2 200 4 :3 400 30 0 4:4 400 4:5 500 5:1 100 5:2 200 5 :3 500 30 0 ... 100 2:1 200 3: 1 30 0 4:1 400 100 38 5:1 1:2 100 2:2 200 3: 2 30 0 4:2 400 5:2 500 1 :3 100 2 :3 200 3: 3 30 0 4 :3 400 5 :3 500 1:4 100 2:4 200 3: 4 30 0 4:4 400 5:4 500 1:5 100 2:5 200 3: 5 30 0 4:5 400 ... + - 1:2 100 + + 2:2 200 + + 3: 2 30 0 + + 4:2 400 + + 5:2 500 + + 100 200 53 1 :3 100 + + 2 :3 200 + + 3: 3 30 0 + + 4 :3 400 + + 5 :3 500 + + 1:4 100 + + 2:4 200 + + 3: 4 30 0 + + 4:4 400 + + 5:4 500...

112
618
3

Nuclear Power Control, Reliability and Human Factors Part 4 docx

Danh mục: Kĩ thuật Viễn thông

... EPRI (20 03) Electric Power Research Institute (EPRI), EMI/RFI Issues, Technical Note, sections 3. 3 -3. 6, pp 49-50 EPRI (2002) Electric Power Research Institute (EPRI), EPRI Report TR-03T0 230 27, Guidelines ... enhanced security NUREG (20 03) Final report NUREG/CR-6782, Comparison of U.S Military and International Electromagnetic Compatibility Guidance, USNRC, pp 34 -36 NRC (20 03) RG 1.180, Guidelines for ... Implementation of a Mobile IP Telephony System in a Nuclear Power Plant 83 http://www.epri.com/targethigh.asp?program=249866&value=03T0 230 27&objid= 284710 FCC (2004) CFR 47, Part 15, Radio frequency Devices,...

30
413
0

Báo cáo hóa học: " Purification of infectious human herpesvirus 6A virions and association of host cell proteins" potx

Danh mục: Hóa học - Dầu khí

... simplex virus V Purification and structural proteins of the herpesvirion J Virol 1972, 9:1 43- 159 http://www.virologyj.com/content/4/1/101 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Huang ... variant B human herpesvirus- 6 infection in a bone marrow-transplant recipient N Engl J Med 1994, 33 0: 135 6- 136 0 Mackenzie IR, Carrigan DR, Wiley CA: Chronic myelopathy associated with human herpesvirus- 6 ... nonstructural polypeptides of human herpesvirus- 6 Virus Res 1989, 13: 1 73- 178 Takemoto M, Koike M, Mori Y, Yonemoto S, Sasamoto Y, Kondo K, Uchiyama Y, Yamanishi K: Human herpesvirus open reading frame...

11
359
0