... horsepower reaching the formation at the bit Since the drilling fluid flow rate sets the system pressure losses, and these pressure losses set the hydraulic horsepower across the bit, it can be concluded ... Support and Stabilize the Wellbore Control Subsurface Pressure A drilling fluid controls the subsurface pressure by its hydrostatic pressure Hydrostatic pressure is the force exerted by a fluid column ... and carries these cuttings tothe surface Several factors influence cuttings transport If the cuttings generated at the bit face are not immediately removed and started toward the surface, they...
... been made to present balanced, accurate science In some places, duplicate information is provided because the basic technology needs to be understood for each chapter xxvi Preface The individuals ... Motor 413 17.1 Introduction to Electrical Theory 413 17.2 Introduction to Electromagnetic Theory 421 17.3 Electric Motors 423 17.3.1 Rotor Circuits 424 17.3.2 Stator Circuits 425 17.4 Transformers ... above the screens, causing the screens to move with an elliptical motion The axis of the ellipse pointed toward the vibrator Since the axis of the ellipse at the feed end pointed toward the discharge...
... in the fluid’s density, viscosity, filter-cake quality/filtration control, and other chemical and mechanical properties The type of solid and its concentration influences mud and well costs, including ... from the fluid, it very quickly loses its ability to clean the hole and creates thick filter cakes To enable on-site recycling and reuse of the drilling fluid, cuttings must be continually and efficiently ... K+, Ca2+ Cl−, Br−, HCOO− Drilled Solids Low Gravity High Gravity Reactive Inert Commercial Clays Polymers Chemicals Weight Material Insoluble Salts (CaCO3) Smectite Clays Sand Limestone Other...
... 5C) andthe binding of either effector protein disrupts the interaction, so the N and R domains are separated, allowing AT to adopt the ‘open conformation’ The further changes that occur in the ... gray, is accessible to GS-AMP in all conformations except the uncomplexed closed conformation Uncomplexed AT has a closed conformation and has minimal activity in either assay Removal of the N ... agarose chromatography andthe MAPS II purification system (Bio-Rad) in thelow -pressure chromatography EconoSystem (Bio-Rad), following the manufacturer’s protocol Protein elution was detected with...
... fluids is to contain formation pressures To accomplish this, hydrostatic pressure must be higher or equal tothepressure of the formation Consequently, if the hydrostatic pressure is higher, the fluid ... as concentric cylindrical shells which slide past one another like sections of a telescope The velocity of the shell at the pipe wall is zero, andthe velocity of the shell at the center of the ... cylindrical cell three inches in I.D and five inches highto contain the fluid The bottom of the cell is fitted with a sheet of Whatman No 50 filter paper Pressure is applied tothe top of the cell...
... been made to present balanced, accurate science In some places, duplicate information is provided because the basic technology needs to be understood for each chapter xxvi Preface The individuals ... Motor 413 17.1 Introduction to Electrical Theory 413 17.2 Introduction to Electromagnetic Theory 421 17.3 Electric Motors 423 17.3.1 Rotor Circuits 424 17.3.2 Stator Circuits 425 17.4 Transformers ... above the screens, causing the screens to move with an elliptical motion The axis of the ellipse pointed toward the vibrator Since the axis of the ellipse at the feed end pointed toward the discharge...
... lack of high- quality flowering trees, andthe narrow reliance on a few such species, could be rectified by a conscious effort to broaden the choice to cover many worthwhile candidates The heavy ... 100 BC [39] Thereafter, the planting culture gradually spread to other parts of the city, culminating by AD 300 with half of the land covered by green-landscape enclaves Temple grounds and related ... helped to decipher the botanical complexities The continued existence of resident natives, andthe survival of alien immigrants, depend on dynamic interplays amongst the contributing factors [36] The...
... monochromatic cycles The history of Conjecture suggests that the cycle partition problem is difficult even in the r = case On the other hand, if we relax the problem and allow two monochromatic cycles to ... monochromatic matchings inside each Ai relate to each other We reduce the number of cases to be checked to just a few To check these we use only basic graph theory and a theorem of Cockayne and Lorimer ... fact that M is the electronic journal of combinatorics 18 (2011), #P53 12 connected we can connect the matching edges by monochromatic paths, following a cyclic ordering of the edges in M Then...
... approach to teaching writing 1.1.4 The writing process 1.2 Theoretical backgrounds of teacher written corrective feedback 1.2.1 Definition of teacher’s written corrective feedback ... 1.2.2 Controversy over the effectiveness of teacher written corrective feedback 11 1.2.3 The importance of teacher’s written corrective feedback 12 1.2.4 Feedback approaches ... 1.1.2 The importance of teaching writing 1.1.3 An overview of approaches to teaching writing 1.1.3.1 The product-oriented approach to teaching writing 1.1.3.2 The process-oriented...
... Despite the perceived importance of teachers’ written corrective feedback, there lacks clear evidence that students successfully incorporate teacher feedback in their revised writings Corrective ... employ to handle their teachers’ written corrective feedback they received? What are students’ preferences for types and strategies of teacher’s written corrective feedback? Methods of the study ... the theoretical background regarding writing pedagogy and teacher written corrective feedback Chapter 2: The methodology – describes in details the setting, data collection methods and procedure,...
... history, the company’s history, the product, andthe overall drive for your company and your product Walk them through your solution To help you with this, make sure you practice your pitch ... practice makes perfect? Well that phrase definitely applies here Make sure you have internalized your speech Know every turn and topic and ways that you can enhance it Be prepared to tell them ... through the confidence, knowledge, and planning you are able to bring into each and every meeting Below you will find three big angles you need to perfect before meeting with any type of investor...
... encourage them to continue C Interrupt them and correct the mistake every time they make D Wait until students finish and correct all mistakes they made E Get angry and ask them to stop F Others ... instruct students how tothe task C Give students some background knowledge about the topic D Provide some necessary vocabulary and structures related tothe topic E Discuss with students to lead them ... Press Savinon, S J (1983) Communicative Competence: Theory and Classroom Practice AddisonWesley Publishing Company Ur, P (1996) A Course in Language Teaching: Practice and Theory Cambridge: Cambridge...
... in the system Because of the lack of feedback loops in the early bottom-up models, it was difficult to account for sentence-context effects andthe role of prior knowledge of text topic as facilitating ... Samuel and Kamil (1988: 31), is "the lack of feedback, in that no mechanism is provided to allow for processing stages which occur later in the system to influence processing which occurs earlier ... a constant interaction between bottom-up and top-down processing in reading, each source of information contributing to a comprehensive reconstruction of the meaning of the text"(1988: 94) According...
... effective use of didactic resources (blackboard, cassette, video, IT, ect.) + 30 T assesses student work on the spot, checks the answers with the whole class, corrects typical errors at the end ... Interviewing 17 Communicative Games +- 0 C - Didactical evidences 18 T shows enthusiasm for the subject s/he teaches 19 T connects toand activates prior knowledge of students 20 T gives clear instruction ... checks the answers with the whole class, corrects typical errors at the end of the activities + +- +- D- Collaborative learning activity 33 T does good instruction (explain the task briefly and...
... that they are seeing lower numbers of total and new customers per month, andthe cost of acquisition increasing This isn’t surprising, considering that the B -to -C sector, namely retail and inancial ... #5 Consumer Marketers Feel Effects More Than Others Economic factors are already hitting the business -to- consumer realm much more than the business -to- business sector More than 50% of B -to -C responders ... marketing lands on the chopping block Historically, marketing budgets are among the irst to get cut in a budget crunch And economic downturns give new meaning tothe words “survival of the ittest...
... Nanotechnology Past and Present (A) a hand holding a computer chip (B) computer chip (C) living cell placed on the chip (D) two nanocomputers beside the cell (E) shows an irregular protein from the ... the cell on the lower right, and a cylindrical gear made by molecular manufacturing at top left (F) shows two atoms in the protein, (G) reveals the nucleus of the atom as a tiny speck Below: ... A “nano-factory” If it falls into the wrong hands Genocide and ethnic cleansing (pictures from Kosovo) Some Final Thoughts • Still a young science, but could take off at any time • Presents wonderful...
... substrates The percentage of GalNAc incorporated was calculated based on the total amount of acceptor substrates the case, then the biosynthetic pathway of O-glycans on consecutive Ser/Thr should strictly ... sequence context and surface accessibility Glycoconjugate J 15, 115–130 Chou, K .C. , Zhang, C. T., Kezdy, F.J & Poorman, R.A (1995) A vector projection method for predicting the specificity of GalNAc-transferase ... histolytica and rat hepatic N-acetylgalactosamine/galactose lectins Glycobiology 8, 1037–1043 52 Amano, J., Morimoto, C & Irimura, T (2001) Intestinal epithelial cells express and secrete the CD43...
... gene-speci c probe, the oligonucleotides were TGCTTTG ATTTTGTAGGTCA and CATCTCCAGAATCACC ACCAAG; and for the AtPasp A3 gene-speci c probe, the oligonucleotides were TGATGACAGCTAAAAAT GGGAACTAGG and CCATATCCGCATTTTCATC ... and CCATATCCGCATTTTCATC GTTCAGG To generate strand-speci c probes for in situ hybridization, these PCR fragments were cloned using the AdvanTAge system (Clontech Laboratories, Palo Alto, CA, USA) ... USA) to produce the speci c DIG-labeled fragment The oligonucleotides for amplification of the AtPasp A1 speci c probe were (5¢fi3¢) GTTGTCAATGAATAGGTAAAATG and CAGAATCTCCAAGTCTGTAAG; for the AtPasp...