v article xx a and outwardly directed measures a nexus requirement
Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx
... because they have different requirements associated with each, i.e Thai restaurants should be in the centre and cheap, while any French restaurants should be expensive1 and can be located anywhere ... knowledge such a combination of goals with different attribute values cannot be straightforwardly handled by comparable state-of-the-art statistical SDSs which appear in the literature Crook and Lemon ... objects that can take two attributes u, v with associated values u1, u2, u3 and v1 respectively The power set representation allows the demonstration system to straightforwardly handle previously...
- 5
- 331
- 0
WATERSTONE BANK SSB, F/K/A WAUWATOSA SAVINGS BANK, PLAINTIFF-APPELLANT, V. JOEL S. HELLER AND TERESA R. CLEWELL, DEFENDANTS-RESPONDENTS. ppt
... releasing and waiving all rights under any homestead exemption laws and all right to retain possession of said premises after any default in payment or breach of any of the covenants or agreements ... provision clarifies that the rights to hire and pay a property manager and to collect rents are separate from the right to enter upon and take possession of the property and are actually a subset ... property to make sure it was secure and see if anyone was living there He determined that no one was present at the property, and observed that the overhead garage door was open and the door leading...
- 13
- 241
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G ... diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen, Germany) or...
- 8
- 345
- 0
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf
... traffic load values over 24 Mbps, the AWPP traffic differentiation mechanism allocates a greater percentage of the scarce available bandwidth to the higher-priority traffic than POAP does As it has ... It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited load, as it is already explained ... mentioned that in order to retain traffic symmetry and produce more explanatory results, the AP flows are not favored in this scenario, that is AP ExtraPriority and WAP for AWPP and POAP are set to and...
- 11
- 516
- 0
Báo cáo hóa học: " Research Article Eigenvalue Problem and Unbounded Connected Branch of Positive Solutions to a Class of Singular Elastic Beam Equations" docx
... fourth-order boundary value problems,” Journal of Mathematical Analysis and Applications, vol 116, no 2, pp 415–426, 1986 R P Agarwal, “On fourth order boundary value problems arising in beam analysis,” ... Differential and Integral Equations, vol 2, no 1, pp 91–110, 1989 Z Bai, “The method of lower and upper solutions for a bending of an elastic beam equation,” Journal of Mathematical Analysis and Applications, ... boundary value problems has also been investigated see 26–28 and references therein Ma and An 26 and Ma and Xu 27 discussed the global structure of positive solutions for the nonlinear eigenvalue...
- 21
- 286
- 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear uncertain ... stability for time-delay systems with interval time-varying delays and nonlinear perturbations was investigated Based on the Lyapunov method, a new delay-dependent criterion for exponential stability...
- 13
- 444
- 0
Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx
... Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 B G Pachpatte, “On some new inequalities similar to Hilbert’s inequality,” Journal of Mathematical Analysis and Applications, ... with parameters,” Advances in Math, vol 38, no 3, pp 257–268, 2009 D S Mintrinovic, J E Pecaric, and A M Kink, Inequalities Involving Functions and their Integrals and Derivertives, Kluwer Academic ... operator is obtained As applications, a new Hilbert-Hardy-type inequality similar to 1.3 is given, and two equivalent inequalities with a best constant factor as well as some particular examples...
- 10
- 333
- 0
báo cáo hóa học:" Research Article Complete Asymptotic and Bifurcation Analysis for a Difference Equation with Piecewise Constant Control" potx
... nonlinear nature of our model at hand Indeed, we are dealing with a dynamical system with piecewise constant nonlinearlities see e.g., 2–6 , and the usual linear and continuity arguments cannot be applied ... will allow the bifurcation parameter λ to vary from to ∞ Indeed, we will consider five cases: i < λ < c/ − a , ii λ c/ − a , iii c/ − a < λ < b c / − a , iv λ b c / − a , and v λ > b c / − a and ... Huang, “Asymptotic behavior of solutions for a class of delay difference equation,” Annals of Differential Equations, vol 21, no 1, pp 99–105, 2005 Z Yuan, L Huang, and Y Chen, “Convergence and...
- 13
- 311
- 0
báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt
... Journal of Mathematical Analysis and Applications, vol 281, no 1, pp 395–401, 2003 T K Kar and U K Pahari, “Modelling and analysis of a prey-predator system with stage-structure and harvesting,” ... response,” Journal of Mathematical Analysis and Applications, vol 317, no 2, pp 464–474, 2006 D T Dimitrov and H V Kojouharov, “Complete mathematical analysis of predator-prey models with linear prey ... follows easily from 3.56 that max{ |v1 n |, |v2 n |} ≤ μ max{ |v1 n |, |v2 n |} 3.57 Therefore, lim supn → ∞ max{ |v1 n |, |v2 n |} → , as n → ∞, and we can easily obtain that lim supn → ∞ |v1 n | and...
- 20
- 442
- 0
báo cáo hóa học:" Research Article Exponential Stability and Global Attractors for a Thermoelastic Bresse System" pdf
... and V Pata, “Global attractors for a semilinear hyperbolic equation in ˜ viscoelasticity,” Journal of Mathematical Analysis and Applications, vol 260, no 1, pp 83–99, 2001 22 V Pata and A Zucchi, ... Chueshov and I Lasiecka, “Attractors and long time behavior of von Karman thermoelastic plates,” Applied Mathematics and Optimization, vol 58, no 2, pp 195–241, 2008 21 C Giorgi, J E Munoz Rivera, and ... Notes in Mathematics, Chapman & Hall/CRC, Boca Raton, Fla, USA, 1999 26 A Pazy, Semigroups of Linear Operators and Applications to Partial Differential Equations, vol 44 of Applied Mathematical Sciences,...
- 15
- 344
- 0
báo cáo hóa học:" Research Article Hardy-Littlewood and Caccioppoli-Type Inequalities for A-Harmonic Tensors" pdf
... u and v are a pair of conjugate harmonic tensors; see Hence, the Hardy-Littlewood w2 and c over any ball inequality is applicable Using inequality 2.5 with w1 B, we can obtain the norm comparison ... “Local and global norm comparison theorems for solutions to the nonhomogeneous Aharmonic equation,” Journal of Mathematical Analysis and Applications, vol 335, no 2, pp 1274–1293, 2007 S Ding and ... -averaging e domains,” Journal of Mathematical Analysis and Applications, vol 227, no 1, pp 200–215, 1998 B Liu, A Ω -weighted imbedding inequalities for A- harmonic tensors,” Journal of Mathematical...
- 14
- 209
- 0
báo cáo hóa học:" Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory Networks" potx
... network visualization, integration, and analysis 6 EURASIP Journal on Bioinformatics and Systems Biology Table 1: Parameters for the artificial data The artificial data involves regulators (R1, R2) and ... replacement as many as 200 times This approach, however, has a severe limitation for application to microarray data because most currently available time-course microarray data are either replicated ... 3.1.1 Artificial Data The artificial data consists of data streams of regulators, R1 and R2, and target genes, G1, G2, , G9 To simulate cell cycle gene expression data, the artificial data is created...
- 14
- 545
- 0
Báo cáo hóa học: " Research Article APRON: A Cellular Processor Array Simulation and Hardware Design Tool" doc
... cellular automata, and other phenomena related to CPAs, with a variety of tools for data analysis, performance evaluation, and algorithm development APRON software is written to take advantage of ... highlighting are available, promoting more rapid development The simulator provides tools for executing and analysing algorithms All registers are visually viewable as 2D images and can be numerically ... Modelling ASPA in APRON The ASPA vision chip [5] is a digital cellular processor array, which contains a bit-serial/bit-parallel synchronous data path as well as asynchronous wave-propagation circuitry...
- 9
- 355
- 0
Báo cáo hóa học: " Research Article Lutin: A Language for Specifying and Executing Reactive Scenarios" potx
... the actual implementation, for an average value av and a standard variation sv, we use a relatively simple approximation as follows (i) First of all, the underlying discrete repartition law is approximated ... of literals) abce is a solution of the formula It means that variables a and e should be false; variables b and c should be true; and variable d can be either true or false The monomial abce, therefore, ... the variable values (inputs and memories) Constraint resolution, weight evaluation, and random selection are also performed by the environment We keep this environment abstract As a matter of fact,...
- 11
- 389
- 0
Báo cáo hóa học: " Research Article Design, Analysis, and Performance of a Noise Modulated Covert Communications System" ppt
... received data frame is transformed back into the original sample values and the audio can be recovered At the receiver side, the received signals at the output of vertical polarization antenna and ... H(t) We assume that the signal bandwidth of V (t) and H(t) (hence the bandwidth of V (t) and H(t)) is BS , and that the bandwidth of nV (t) and nH (t) is Bn (equal to the receive antenna bandwidth) ... they are zero-mean random 2 variables and these are denoted as V and σH , respectively We further assume that the powers of V (t) and H(t), both of which are zero-mean band-limited Gaussian processes,...
- 12
- 274
- 0
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc
... of a self-adjoint operator and a new bilinear integral inequality,” Acta Mathematica Sinica, vol 23, no 7, pp 1311–1316, 2007 ´ e [5] A B´ nyi and C Oh, “Best constants for certain multilinear ... integral operators,” Journal of Inequalities and Applications, vol 2006, Article ID 28582, 12 pages, 2006 [6] B Yang, “On the norm of a certain self-adjiont integral operator and applications ... Society, vol 13, no 4, pp 577–584, 2006 [3] B Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol 321, no 1, pp 182–192, 2006 [4] B Yang,...
- 9
- 334
- 0
Báo cáo hóa học: " Research Article ASAP: A MAC Protocol for Dense and Time-Constrained RFID Systems" pdf
... design of ASAP to variants of ASAP, that is, p-ASAP, m-ASAP, and ASAP with faulty tags For each scenario, we have modified the ML estimator appropriately for providing the best performance We have shown ... transmits Collision ACK command is ‘0’ Ack wait Successful: ACK command is ‘1’ Silent - ID Identified Reader command, ACK command Kill command Destroyed Reader command, ACK command Figure 2: ASAP: ... current frame size These values are obtained by minimizing the reading time with a particular probability of reading all tags These values are computed and saved as a look-up table at the reader In...
- 13
- 355
- 0
Báo cáo hóa học: " Research Article StereoBox: A Robust and Efficient Solution for Automotive Short-Range Obstacle Detection Alberto Broggi, Paolo Medici, and Pier Paolo Porta" potx
... Computer Vision and Pattern Recognition (CVPR ’05), vol 1, pp 213–219, San Diego, Calif, USA, June 2005 [5] F Devernay and O Faugeras, “Straight lines have to be straight,” Machine Vision and Applications, ... providing an automated algorithm to calibrate the system A standard grid with easily recognizable markers will be placed in front of vehicle and an automated calibration procedure will be engaged ... In particular, for each pixel we define a square area A centered on it; the average value m of all the pixels in that area is computed and a threshold γ is applied on m The resulting value is assigned...
- 7
- 426
- 0
Báo cáo hóa học: " Research Article Implementing a WLAN Video Terminal Using UML and Fully Automated Design Flow" ppt
... extension cards for WLAN radio and on-board camera Application Application process (UML state machine) Thread Thread Thread [activated] [inactive] [activated] State machine scheduler State machine ... medium access control (MAC) layer The on-board camera is OmniVision OV7670FSL camera and lens module, which features a single-chip VGA camera and image processor The camera has a maximum frame rate ... hardware accelerators However, it may have limited scalability In data parallelism [25, 26] video frames are divided into uniform spatial regions that are encoded in parallel A typical approach...
- 15
- 442
- 0
Báo cáo hóa học: " Research Article Question Processing and Clustering in INDOC: A Biomedical Question Answering System" ppt
... document “Lack of attenuation of a candidate dengue vaccine (45AZ5) in human volunteers A dengue type1, candidate live virus vaccine (45AZ5) was prepared by serial virus passage in fetal rhesus lung ... Tell me about pathophysiology and treatment of disseminated intravascular coagulation Concepts Disseminated Intravascular Coagulation, Therapeutic procedure, physiopathological, therapeutic aspects ... tabular form; (ii) An alphabetical index to the disease entries; and (iii) A classification system for surgical, diagnostic, and therapeutic procedures (alphabetic index and tabular list) Parikshit...
- 7
- 213
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy